Potential Role of Ribonucleotide Reductase Enzyme in Mitochondria Function and Woody Breast Condition in Broiler Chickens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Enzyme Activities
2.3. Quantitative Real-Time PCR
2.4. Histology Analysis
2.5. Analysis
3. Results
3.1. Quantitative Real-Time PCR
3.2. Histology Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Baldi, G.; Soglia, F.; Laghi, L.; Tappi, S.; Rocculi, P.; Tavaniello, S.; Prioriello, D.; Mucci, R.; Maiorano, G.; Petracci, M. Comparison of quality traits among breast meat affected by current muscle abnormalities. Food Res. Int. 2019, 115, 369–376. [Google Scholar] [CrossRef]
- Barbut, S. Understanding the woody breast syndrome and other myopathies in modern broiler chickens. In Proceedings of the Australian Poultry Science Symposium, Sydney, Australia, 19–22 February 2020; pp. 99–102. [Google Scholar]
- Che, S.; Wang, C.; Iverson, M.; Varga, C.; Barbut, S.; Bienzle, D.; Susta, L. Characteristics of broiler chicken breast myopathies (spaghetti meat, woody breast, white striping) in Ontario, Canada. Poult. Sci. 2022, 101, 101747. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.; To, K.V.; Jarvis, T.R.; Campbell, Y.L.; Hendrix, J.D.; Suman, S.P.; Li, S.; Antonelo, D.S.; Zhai, W.; Chen, J. Broiler genetics influences proteome profiles of normal and woody breast muscle. Poult. Sci. 2021, 100, 100994. [Google Scholar] [CrossRef] [PubMed]
- Hisasaga, C., Jr. Assessing the Accuracy of a Woody Breast Identification Technique and Evaluating the Association between Mitochondria Values to Woody Breast Severity. Ph.D. Thesis, California State University, Fresno, CA, USA, 2021. [Google Scholar]
- Li, B.; Dong, X.; Puolanne, E.; Ertbjerg, P. Effect of wooden breast degree on lipid and protein oxidation and citrate synthase activity of chicken pectoralis major muscle. LWT 2022, 154, 112884. [Google Scholar] [CrossRef]
- Hasegawa, Y.; Hosotani, M.; Saito, M.; Nagasawa, T.; Mori, Y.; Kawasaki, T.; Yamada, M.; Maeda, N.; Watanabe, T.; Iwasaki, T. Mitochondrial characteristics of chicken breast muscle affected by wooden breast. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2022, 273, 111296. [Google Scholar] [CrossRef] [PubMed]
- Mutryn, M.F.; Brannick, E.M.; Fu, W.; Lee, W.R.; Abasht, B. Characterization of a novel chicken muscle disorder through differential gene expression and pathway analysis using RNA-sequencing. BMC Genom. 2015, 16, 399. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khan, N.A.; Govindaraj, P.; Meena, A.K.; Thangaraj, K. Mitochondrial disorders: Challenges in diagnosis & treatment. Indian J. Med. Res. 2015, 141, 13. [Google Scholar] [PubMed]
- Wang, Z.; Brannick, E.; Abasht, B. Integrative transcriptomic and metabolomic analysis reveals alterations in energy metabolism and mitochondrial functionality in broiler chickens with wooden breast. Sci. Rep. 2023, 13, 4747. [Google Scholar] [CrossRef]
- Torrents, E. Ribonucleotide reductases: Essential enzymes for bacterial life. Front. Cell. Infect. Microbiol. 2014, 4, 52. [Google Scholar] [CrossRef] [Green Version]
- Chen, G.; Luo, Y.; Warncke, K.; Sun, Y.; Yu, D.S.; Fu, H.; Behera, M.; Ramalingam, S.S.; Doetsch, P.W.; Duong, D.M. Acetylation regulates ribonucleotide reductase activity and cancer cell growth. Nat. Commun. 2019, 10, 3213. [Google Scholar] [CrossRef] [Green Version]
- Fumagalli, M.; Ronchi, D.; Bedeschi, M.F.; Manini, A.; Cristofori, G.; Mosca, F.; Dilena, R.; Sciacco, M.; Zanotti, S.; Piga, D. A novel RRM2B mutation associated with mitochondrial DNA depletion syndrome. Mol. Genet. Metab. Rep. 2022, 32, 100887. [Google Scholar] [CrossRef] [PubMed]
- Lax, N.Z.; Turnbull, D.M.; Reeve, A.K. Mitochondrial mutations: Newly discovered players in neuronal degeneration. Neuroscientist 2011, 17, 645–658. [Google Scholar] [CrossRef]
- Shakeri, M.; Berisha, D.; Martinson, A.; Davis, J.; Moussavi-Harami, F. Ribonucleotide reductase mediated regulation of mitochondrial activity in the adult heart. Biophys. J. 2022, 121, 396a–397a. [Google Scholar] [CrossRef]
- Tran, P.; Wanrooij, P.H.; Lorenzon, P.; Sharma, S.; Thelander, L.; Nilsson, A.K.; Olofsson, A.-K.; Medini, P.; von Hofsten, J.; Stål, P. De novo dNTP production is essential for normal postnatal murine heart development. J. Biol. Chem. 2019, 294, 15889–15897. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Malila, Y.; Srimarut, Y.; U-Chupaj, J.; Strasburg, G.; Visessanguan, W. Monitoring of chicken RNA integrity as a function of prolonged postmortem duration. Asian-Australas. J. Anim. Sci. 2015, 28, 1649. [Google Scholar] [CrossRef] [Green Version]
- Fontanesi, L.; Colombo, M.; Beretti, F.; Russo, V. Evaluation of post mortem stability of porcine skeletal muscle RNA. Meat Sci. 2008, 80, 1345–1351. [Google Scholar] [CrossRef] [PubMed]
- Tijare, V.V.; Yang, F.; Kuttappan, V.; Alvarado, C.; Coon, C.; Owens, C. Meat quality of broiler breast fillets with white striping and woody breast muscle myopathies. Poult. Sci. 2016, 95, 2167–2173. [Google Scholar] [CrossRef]
- Shakeri, M.; Zulkifli, I.; Soleimani, A.; o’Reilly, E.; Eckersall, P.; Anna, A.; Kumari, S.; Abdullah, F. Response to dietary supplementation of L-glutamine and L-glutamate in broiler chickens reared at different stocking densities under hot, humid tropical conditions. Poult. Sci. 2014, 93, 2700–2708. [Google Scholar] [CrossRef]
- Richter, K.; Kietzmann, T. Reactive oxygen species and fibrosis: Further evidence of a significant liaison. Cell Tissue Res. 2016, 365, 591–605. [Google Scholar] [CrossRef] [Green Version]
- Carlson, A.B.; Kraus, G.P. Physiology, Cholinergic Receptors. 2018. Available online: https://europepmc.org/books/nbk526134 (accessed on 1 June 2023).
- Lykhmus, O.; Gergalova, G.; Koval, L.; Zhmak, M.; Komisarenko, S.; Skok, M. Mitochondria express several nicotinic acetylcholine receptor subtypes to control various pathways of apoptosis induction. Int. J. Biochem. Cell Biol. 2014, 53, 246–252. [Google Scholar] [CrossRef]
- Li, X.; Zhang, W.; Cao, Q.; Wang, Z.; Zhao, M.; Xu, L.; Zhuang, Q. Mitochondrial dysfunction in fibrotic diseases. Cell Death Discov. 2020, 6, 80. [Google Scholar] [CrossRef]
- Teodoro, J.S.; Rolo, A.P.; Palmeira, C.M. The NAD ratio redox paradox: Why does too much reductive power cause oxidative stress? Toxicol. Mech. Methods 2013, 23, 297–302. [Google Scholar] [CrossRef] [PubMed]
- Wolfe, R.R. Metabolic interactions between glucose and fatty acids in humans. Am. J. Clin. Nutr. 1998, 67, 519S–526S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Troisi, J.; Cavallo, P.; Colucci, A.; Pierri, L.; Scala, G.; Symes, S.; Jones, C.; Richards, S. Metabolomics in genetic testing. Adv. Clin. Chem. 2020, 94, 85–153. [Google Scholar] [PubMed]
- Taricani, L.; Shanahan, F.; Malinao, M.-C.; Beaumont, M.; Parry, D. A functional approach reveals a genetic and physical interaction between ribonucleotide reductase and CHK1 in mammalian cells. PLoS ONE 2014, 9, e111714. [Google Scholar] [CrossRef] [Green Version]
- Itsko, M.; Schaaper, R.M. dGTP starvation in Escherichia coli provides new insights into the thymineless-death phenomenon. PLoS Genet. 2014, 10, e1004310. [Google Scholar] [CrossRef] [Green Version]
- Greene, E.; Cauble, R.; Dhamad, A.E.; Kidd, M.T.; Kong, B.; Howard, S.M.; Castro, H.F.; Campagna, S.R.; Bedford, M.; Dridi, S. Muscle metabolome profiles in woody breast-(un) affected broilers: Effects of quantum blue phytase-enriched diet. Front. Vet. Sci. 2020, 7, 458. [Google Scholar] [CrossRef]
Target 1 | Forward | Reverse |
---|---|---|
ATP6 | AATTCTCAAGCCCCTGCCTA | AGGAGGCCTAGGAGGTTAAT |
CHRND | GTGGTCCTCAACTTCCATTTCC | AGGATCTCCAGGAACACCTCT |
COX14 | GGCTGATTTCGGCTACAAAGC | GCACAGGTACCCGCCGTA |
COX1 | TCCTTCTCCTACTAGCCTCA | AGGAGTAGTAGGATGGCAGT |
CYTB | TGCCTCATGACCCAAATCCT | AGTGTGAGGAGGAGGATTACT |
GLUT1 | GCATGATCGGCTCCTTCTCTGT | AGCAGCGGCCAGAGAGAGTCGT |
ND2 | AGCATAACCAACGCCTGATC | GATGTTAGGAGGAGGAGTGT |
ND4L | TCCCCTACACTTCAGCTTCT | TTCGCATGCTGAGAAGGCTA |
NDUFB7 | GACGCCTTCCCCAGCCTATG | CTCGCGCTCAAACTCCTTCAT |
PDK4 | TCTCCGCTCTCCATCAAGCA | TCTTGTCGCAGGAACGCAAA |
PPARG | GTGCAATCAAAATGGAGCC | CTTACAACCTTCACATGCAT |
RRM2 | AGTGAGTGTGTATATGCTCCCC | CCAAAAGTCAAGGACGCTG |
18S 2 | TCCCCTCCCGTTACTTGGAT | GCGCTCGTCGGCATGTA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Shakeri, M.; Kong, B.; Zhuang, H.; Bowker, B. Potential Role of Ribonucleotide Reductase Enzyme in Mitochondria Function and Woody Breast Condition in Broiler Chickens. Animals 2023, 13, 2038. https://doi.org/10.3390/ani13122038
Shakeri M, Kong B, Zhuang H, Bowker B. Potential Role of Ribonucleotide Reductase Enzyme in Mitochondria Function and Woody Breast Condition in Broiler Chickens. Animals. 2023; 13(12):2038. https://doi.org/10.3390/ani13122038
Chicago/Turabian StyleShakeri, Majid, Byungwhi Kong, Hong Zhuang, and Brian Bowker. 2023. "Potential Role of Ribonucleotide Reductase Enzyme in Mitochondria Function and Woody Breast Condition in Broiler Chickens" Animals 13, no. 12: 2038. https://doi.org/10.3390/ani13122038