Next Article in Journal
Evaluation of the Effect of Pb Pollution on Avian Influenza Virus-Specific Antibody Production in Black-Headed Gulls (Chroicocephalus ridibundus)
Previous Article in Journal
Goose Hepatic IGFBP2 Is Regulated by Nutritional Status and Participates in Energy Metabolism Mainly through the Cytokine−Cytokine Receptor Pathway
Previous Article in Special Issue
Evaluation of Cow-Side Meters to Determine Somatic Cell Count in Individual Cow Quarter and Bulk-Tank Milk Samples
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 14
10.3390/ani13142337
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization and Antimicrobial Susceptibilities of Corynebacterium pseudotuberculosis Isolated from Caseous Lymphadenitis of Smallholder Sheep and Goats

by
Hend M. El Damaty
1,*,
Azza S. El-Demerdash
2,
Norhan K. Abd El-Aziz
3,*,
Sarah G. Yousef
1,
Ahmed A. Hefny
4,
Etab M. Abo Remela
5,6,
Asmaa Shaker
7 and
Ibrahim Elsohaby
1,8,9
1
Department of Animal Medicine, Infectious Diseases, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
2
Agriculture Research Center (ARC), Animal Health Research Institute (AHRI), Zagazig 44516, Egypt
3
Department of Microbiology, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
4
Veterinary Hospital, Faculty of Veterinary Medicine, Zagazig University, Zagazig 44511, Egypt
5
Department of Bacteriology, Mycology and Immunology, Faculty of Veterinary Medicine, Kafrelsheikh University, Kafrelsheikh 33516, Egypt
6
Department of Biology, College of Science, Taibah University, Medina 42353, Saudi Arabia
7
Department of Microbiology, Veterinary Hospital, Faculty of Veterinary Medicine, University of Sadat City, Sadat City 32897, Egypt
8
Department of Infectious Diseases and Public Health, Jockey Club of Veterinary Medicine and Life Sciences, City University of Hong Kong, Hong Kong SAR 999077, China
9
Centre for Applied One Health Research and Policy Advice (OHRP), City University of Hong Kong, Hong Kong SAR 999077, China
*
Authors to whom correspondence should be addressed.
Animals 2023, 13(14), 2337; https://doi.org/10.3390/ani13142337
Submission received: 5 May 2023 / Revised: 4 July 2023 / Accepted: 10 July 2023 / Published: 18 July 2023
(This article belongs to the Special Issue Disease Diagnostics and Surveillance in Ruminants)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

The present study aimed to isolate Corynebacterium pseudotuberculosis from caseous lymphadenitis (CLA) in smallholder sheep and goats. Thereafter, antimicrobial resistance determinants, virulence characteristics, and phylogenetic analysis of the isolates were investigated. Our results revealed that 24.54% (54/220) of examined animals showed CLA-compatible lesions from which C. pseudotuberculosis was isolated. Antimicrobial susceptibility testing revealed that all isolates were resistant to bacitracin and florfenicol. Additionally, 92.6% of the isolates displayed resistance to penicillin and erythromycin, while none of the isolates were resistant to norfloxacin. Interestingly, 16.7% of C. pseudotuberculosis isolates recovered from sheep showed vancomycin resistance. Molecular characterization revealed that PLD, PIP, and FagA virulence genes were detected in all examined C. pseudotuberculosis isolates. The bla (β-lactam) resistance gene was present in all isolates. Additionally, 83% of sheep isolates carried the aminoglycoside (aph(3″)-lb), chloramphenicol (cat1), and bacitracin (bcrA) resistance genes. Notably, the glycopeptide (vanA) resistance gene was detected in 8% of the sheep isolates as a first report. Enterobacterial Repetitive Intergenic Consensus Polymerase Chain Reaction (ERIC-PCR) genotyping of 10 multi-drug resistant C. pseudotuberculosis isolates showed a high similarity index of 83.6% between isolates from sheep and goats. Nucleotide sequence analysis of partial 16S rRNA sequences of these isolates showed 98.83% similarities with biovar Ovis of globally available reference sequences on the Genbank database. In conclusion, this study emphasized the high isolation rate of C. pseudotuberculosis and its molecular characterization in smallholder sheep and goats in four districts in Egypt.

Abstract

Caseous lymphadenitis (CLA) is a bacterial infection caused by Corynebacterium pseudotuberculosis (C. pseudotuberculosis) that affects sheep and goats, leading to abscess formation in their lymph nodes. The present study aimed to isolate and identify C. pseudotuberculosis from CLA in smallholder sheep and goats, and determine the resistance patterns, virulence, and resistance genes of the isolates. Additionally, genotypic and phylogenetic analysis of the isolates was conducted using ERIC-PCR and DNA sequencing techniques. A cross-sectional study examined 220 animals (130 sheep and 90 goats) from 39 smallholder flocks for clinical signs of CLA. Fifty-four (24.54%) animals showed CLA-compatible lesions, confirmed by C. pseudotuberculosis isolation and PCR identification. Sheep had a lower infection rate of CLA (18.46%) compared with goats (33.3%). Antimicrobial susceptibility testing of 54 C. pseudotuberculosis isolates to 24 antimicrobial drugs revealed that they were 100% resistant to bacitracin and florfenicol, while none of the isolates were resistant to norfloxacin. A high resistance rate was observed for penicillin and erythromycin (92.6% each). Interestingly, 16.7% of C. pseudotuberculosis isolates recovered from sheep showed vancomycin resistance. Molecular characterization of C. pseudotuberculosis isolates revealed that PLD, PIP, and FagA virulence genes were present in all examined isolates. However, the FagB, FagC, and FagD genes were detected in 24 (100%), 20 (83%), and 18 (75%) of the sheep isolates, and 26 (87%), 26 (87%), and 18 (60%) of the goat isolates, respectively. The β-lactam resistance gene was present in all isolates. Furthermore, 83% of the sheep isolates carried the aminoglycoside (aph(3″)-lb), chloramphenicol (cat1), and bacitracin (bcrA) resistance genes. Among the isolates recovered from goats, 73% were found to contain macrolides (ermX), sulfonamide (sul1), and bacitracin (bcrA) resistance genes. It is worrisome that the glycopeptide (vanA) resistance gene was detected in 8% of the sheep isolates as a first report. ERIC-PCR genotyping of 10 multi-drug-resistant C. pseudotuberculosis isolates showed a high similarity index of 83.6% between isolates from sheep and goats. Nucleotide sequence analysis of partial 16S rRNA sequences of C. pseudotuberculosis revealed 98.83% similarity with biovar Ovis of globally available reference sequences on the Genbank database. Overall, our findings might indicate that C. pseudotuberculosis infection in smallholders in Egypt might be underestimated despite the significant financial impact on animal husbandry and potential health hazards it poses. Moreover, this study highlights the importance of implementing a sustainable control strategy and increasing knowledge and awareness among smallholder breeders to mitigate the economic impact of CLA.

1. Introduction

Caseous lymphadenitis (CLA) is a widespread chronic wasting disease of sheep and goats caused by facultative intracellular Corynebacterium pseudotuberculosis. CLA accrues significant financial losses due to reduced wool, meat, and milk production, loss of fertility, culling of affected animals, and their condemnation at the time of slaughter and inspection [1,2]. C. pseudotuberculosis is a Gram-positive, non-motile pleomorphic rod that often presents as characteristic Chinese letters in the stained smear [3]. Two biotypes of C. pseudotuberculosis exist, the first nitrate-negative strains classified as biotype Ovis and the second nitrate-positive strains classified as biotype Equi, depending on nitrate-reducing potential [4].
CLA has different forms depending on the location of the abscesses [5]. The most common is the classical “external” form, which is characterized by the formation of abscesses in the superficial lymph nodes. Visceral CLA abscessation, on the other hand, occurs in various lymph nodes and other internal organs [5]. The most commonly infected superficial lymph glands are the parotid, submandibular, prescapular, prefemoral, popliteal, and supramammary lymph glands [6]. C. pseudotuberculosis can rarely infect humans. Reported cases are primarily detected in farm workers and veterinarians who have direct contact with sick animals [7].
Bacterial culture is the primary laboratory test used for the diagnosis of CLA, while biochemical and nucleic acid-based detection methods are used for confirming the diagnosis [8]. Serological tests such as ELISA have also been used to identify CLA-infected animals [9]. Molecular typing strategies, including restriction fragment length polymorphisms [10], pulsed-field gel electrophoresis [11], and ribotyping [12], classify C. pseudotuberculosis into two biovars but not for further characterization, particularly among biovar Ovis isolates, which may be noticeably homogeneous. Thus, for investigating the epidemiological relationships and sources of infection in C. pseudotuberculosis isolates from sheep and goats, Enterobacterial Repetitive Intergenic Consensus (ERIC-PCR) has shown good discriminatory power, typeability, and promising results, which consequently improve CLA control trials [13,14,15].
Several virulence genes contribute to the pathogenicity of C. pseudotuberculosis, including the phospholipase D (PLD) gene, integral membrane protein (FagA), iron enterobactin transporter (FagB), ATP-binding cytoplasmic membrane protein (FagC), and iron siderophore binding protein (FagD) [16]. The PLD gene encodes the phospholipase D-PLD exotoxin, which is the primary virulence factor in C. pseudotuberculosis [17]. This exotoxin is an enzyme that dissociates sphingomyelin, increases vascular permeability, and enables the survival of C. pseudotuberculosis in the cells, facilitating the invasion of the body and transport by phagocytes to regional lymph nodes [18]. In addition to the PLD gene, downstream putative genes, including FagA, FagB, FagC, and FagD, are related to iron regulation and uptake by C. pseudotuberculosis [16,19].
The emergence and spread of antimicrobial resistance is a relevant problem, generating inefficient treatment against CLA, its dissemination among small ruminants around the world, and significant economic losses [20]. Previous studies have reported high resistance of C. pseudotuberculosis to penicillins, which are the primary drugs for treating CLA in sheep and goats [21,22].
In Egypt, CLA is a significant economic and welfare concern for sheep and goat farmers, as it reduces productivity in infected animals. Additionally, abscesses in the carcass decrease the value of the meat. Studies have reported the prevalence of CLA in sheep and goats from the Nile Delta region of Egypt to range from 3.7% to 32.7% in sheep and 5.6% in goats [23,24]. There have been limited studies investigating the occurrence, distribution, antimicrobial resistance, and genetic characteristics of C. pseudotuberculosis infection in smallholder sheep and goats. Therefore, the objectives of the present study were to (i) isolate and identify C. pseudotuberculosis from CLA in smallholder sheep and goats; (ii) determine the antimicrobial resistance patterns, virulence, and resistance genes of C. pseudotuberculosis isolates; and (iii) conduct genotyping and phylogenetic analysis of the C. pseudotuberculosis isolates using ERIC-PCR and DNA sequencing techniques.

2. Materials and Methods

2.1. Study Design and Population

A cross-sectional study was conducted between February 2021 and January 2022 to investigate the C. pseudotuberculosis infection in sheep and goats in smallholder flocks in four districts of Sharkia Governorate, Egypt. Smallholders in the four districts were invited to participate in the study. However, only 39 smallholder flocks agreed to participate. All animals (n = 220, comprising 130 sheep and 90 goats) in these flocks were examined for clinical signs of CLA, particularly the presence of enlargement in the superficial lymph nodes (Figure 1).
Purulent material was collected using sterile syringes after the animals were prepared aseptically (by clipping, shaving, and disinfecting the skin). The abscesses were then surgically treated by lancing, antiseptic lavage, and drainage application until complete healing. A systemic course of antibiotics and anti-inflammatory drugs was administered for 5 and 3 successive days, respectively. Duplicate purulent material samples were collected for bacterial culture and direct-sample PCR. Samples were labeled with animal species, ID, date of collection, and districts before being transported to the laboratory on ice for further analysis. Information regarding age, gender, feeding, and skin lesions was collected.

2.2. C. pseudotuberculosis Isolation and Identification

Collected purulent material samples were bacteriologically examined following the procedures of Quinn et al. [25]. Briefly, each sample was transferred to 10 mL of brain heart infusion broth (BHI; Oxoid, Hampshire, UK), and incubated at 37 °C for 18 h to stimulate the growth of the microorganisms. A loopful of the pre-enriched sample was then plated onto a blood agar base (Oxoid, Hampshire, UK) enriched with 5% sterile defibrinated sheep blood and incubated aerobically at 37 °C for 48 h. The plates were examined for typical growth, morphological features, and hemolytic characteristics. Gram-positive bacilli in small, white, dry, and crumbly colonies were selected for further identification. Biochemical tests including catalase, urease, nitrate reduction, esculin hydrolysis, and fermentation of glucose, lactose, maltose, sucrose, arabinose, fructose, mannose, trehalose, xylose, and salicin sugars were performed [25,26]. In addition, the suspected colonies were subjected to synergistic hemolysis with Rhodococcus equi and antagonistic hemolysis with Staphylococcus aureus (ATCC 25923), as described by Cowan and Steel [27].

2.3. DNA Extraction and PCR Amplification

The QIAamp DNA Mini kit (Qiagen, Germany: Catalogue no. 51304) was used to extract DNA from C. pseudotuberculosis isolates, with modifications to the manufacturer’s recommendations. Briefly, 200 µL of the bacterial suspension were incubated with 10 µL of proteinase K and 200 µL of lysis buffer at 56 °C for 10 min. After incubation, 200 µL of ethanol (100%) were added to the lysate, which was then washed and centrifuged according to the manufacturer’s recommendations. The nucleic acid was eluted with 100 µL of elution buffer provided in the kit. PCR was performed using genus-and species-specific primers (Table 1) to confirm C. pseudotuberculosis.

2.4. Antimicrobial Susceptibility Testing

C. pseudotuberculosis isolates were tested for antimicrobial susceptibilities against 24 commonly used antimicrobial agents using the disc diffusion method on Mueller-Hinton agar with 5% sheep blood (Oxoid, Hampshire, UK). The 24 antimicrobials tested included: penicillin G (PEN, 10 U), novobiocin (NB, 30 μg), amoxicillin/clavulanic acid (AMC, 20/10 μg), ampicillin/sulbactam (SAM, 20 μg), oxacillin (OXA, 5 μg),vancomycin (VAN, 30 μg), piperacillin (PIP, 30 μg), ceftriaxone (CRO, 30 μg), cefuroxime sodium (CXM, 30 μg), cephradine (CEP, 30 μg), bacitracin (BAC, 10 U), ampicillin (AMP, 10 μg), doxycycline (DOX, 5 μg), clindamycin (CLI, 2 μg), nalidixic acid (NA, 30 μg), norfloxacin (NOR, 10 μg), streptomycin (STR, 10 μg), amikacin (AMK, 30 μg), kanamycin (KAN, 30 μg), neomycin (NEO 30 μg), florfenicol (FFC, 30 μg), rifampin (RIF, 30 μg),erythromycin (ERY, 10 μg), and trimethoprim/sulphamethoxazole (SXT, 1.25/23.75 μg). The inhibition zone diameters were interpreted according to the Clinical and Laboratory Standards Institute (CLSI) guidelines [46]. Isolates resistant to ≥3 different antimicrobial classes were classified as multidrug-resistant (MDR). The multiple antibiotic resistance (MAR) index for each isolate was calculated as the number of antimicrobials to which the isolate displayed resistance divided by the number of antimicrobials to which the isolate had been tested [47]. The minimum inhibitory concentration (MIC) of vancomycin (Sigma-Aldrich, Co., St. Louis, MO, USA) was estimated using the broth microdilution method following the CLSI guidelines [46], and the interpretive standards were those available in the relevant CLSI document. C. pseudotuberculosis biovar Ovis (ATCC 19410; Manassas, VA, USA) was used as a quality control.

2.5. Detection of Virulence and Resistance Genes

Plasmid DNA was extracted from bacterial strains using a Thermo Scientific GeneJET Plasmid Miniprep Kit (Thermo, Germany). PCR amplification of virulence-related genes of C. pseudotuberculosis, specifically PIP, PLD, FagA, FagB, FagC, and FagD, as well as antimicrobial resistance genes as erm(X) (macrolide, lincosamides and streptogramins resistance); aph(3″)-Ib (streptomycin resistance); aph(3′)-Ic (kanamycin resistance); sul1(sulfonamide resistance); tet(W) (tetracycline resistance); bla (beta-lactam resistance); cat1 (chloramphenicol resistance); dfrA1(trimethoprim resistance); vanA (vancomycin resistance); bcrA (bacitracin resistance); ermC (clindamycin resistance); rpoB (rifampin resistance and qnrA (nalidixic acid resistance) were performed by conventional PCR assays using the oligonucleotide primer sequences presented in Table 1.
PCR was performed using a PTC-100 programmable Peltier-Effect thermal cycler (Caerphilly, UK). The final volume of the reaction mixture was adjusted to 25 μL, consisting of 12.5 μL of DreamTaq TM Green Master Mix (2X) (Fermentas, Waltham, MA, USA), 0.4 μL of 100 pmoL of each primer (Sigma, USA), 5 μL of template DNA, and nuclease-free water added up to 25 μL. The PCR products were separated by electrophoresis on a 1.5% agarose gel (Applichem GmbH, Darmstadt, Germany,), and the gel was photographed using a gel documentation framework (Alpha Innotech, Biometra, Germany). The data were analyzed with the GeneTools analysis software (SynGen, London, UK). C. pseudotuberculosis ATCC-19410 was used as a quality control.

2.6. ERIC Genotyping

To analyze the fingerprinting profiles of different C. pseudotuberculosis-positive isolates, ERIC-PCR was conducted using the ERIC primers (Table 1), as previously described [45]. The ERIC fingerprinting data was transformed into a binary code depending on the presence or absence of each band. Dendrograms were generated by the unweighted pair group method with an arithmetic average (UPGMA) and Ward’s hierarchical clustering routine. Cluster analysis and dendrogram construction were performed using the hclust function in the “factoextra” package. The similarity index (Jaccard/Tanimoto Coefficient and number of intersecting elements) between all samples was calculated using the online tool (https://planetcalc.com/1664/; accessed on 20 March 2022).

2.7. DNA Sequencing and Analysis

The amplified DNA products were purified using the QIAquick PCR purification kit (QIAGEN, Valencia, CA, USA), following the manufacturer’s instructions. Sequencing was performed in both directions using 16S Rrna primers and an automated sequencer (Macrogen Inc., Korea ABI 3730XL DNA analyzer). The DNA sequences were compared to those published in National Center for Biotechnology Information databases (NCBI, www.ncbi.nlm.nih.gov; accessed on 25 March 2022) using the Basic Local Alignment Search Tool (BLAST). Nucleotide sequence alignment was applied using the MEGA7 program (http://www.megasoftware.net; accessed on 1 April 2022) [48]. A phylogenetic tree was constructed using the neighbor-joining method [49] and Kimura’s two-parameter method [50] with 1000 bootstrap iterations. The nucleotide sequences generated in the study were deposited in GenBank under accession numbers OP550121–OP550130.

2.8. Data Analysis

The data were analyzed and visualized using R software (R Core Team, 2022; version 4.2.0). The Wilcoxon test was used to examine the variation in the MAR index of C. pseudotuberculosis isolated from sheep and goats. The “ggplot2” package was utilized for data visualization.

3. Results

3.1. Study Population

A total of 220 animals, comprising 130 sheep and 90 goats from 39 mixed smallholder flocks, were examined for clinical signs of CLA. The animals were raised in four districts of Sharkia Governorate, namely Zagazig (90 animals from 15 flocks), Belbeis (55 animals from 10 flocks), Abo-Hammad (40 animals from 8 flocks), and Menia Elkamh (35 animals from 6 flocks). The majority of the animals were males (58.6%), and 65% of them were fed concentrates (Table 2).
The animals were classified into three age groups: <1 year (18.2%), 1–2 years (37.7%), and >2 years (44.1%). During the clinical examination, it was found that 36 animals (16.4%) had skin lesions. The skin lesions were due to shearing, castration, docking, umbilical, and tagging wounds. Moreover, 54 animals (24.6%) had enlarged superficial lymph nodes in various parts of their bodies, while 21 animals (9.5%) had both skin lesions and enlarged lymph nodes. The abscesses were soft, relatively large, and contained cheesy purulent material that had a milky white or yellow-green color.

3.2. C. pseudotuberculosis Isolation and Identification

C. pseudotuberculosis was isolated in pure culture from 54 purulent samples (24 from sheep and 30 from goats). Morphological and biochemical characteristics were used to identify all bacterial isolates, which were Gram-positive pleomorphic organisms, appearing as coccoid to filamentous rods arranged in single or paired acute angles (resembling Chinese letters) when viewed under the ordinary microscope. Biochemical tests revealed that the isolates were catalase and urease-positive, and negative for the oxidase test, lactose, trehalose, xylose fermentation, esculin hydrolysis, and nitrate reduction, indicating that they belonged to biovar Ovis.
On blood agar, colonies were small, white, circular, and beta hemolytic after 48 h of incubation. The reverse CAMP test with Staphylococcus aureus was positive for all 54 C. pseudotuberculosis isolates. Furthermore, a zone of synergistic hemolysis appeared around the colonies of C. pseudotuberculosis when tested with Rhodococcus equi. Finally, confirmation of all bacterial isolates was achieved through 16S rRNA and RNA polymerase beta-subunit (rpoB) gene-specific PCR, which yielded PCR products of 845 and 446 base pairs, respectively.

3.3. Antimicrobial Resistance of C. pseudotuberculosis Isolates

The antimicrobial susceptibility profiles of the 54 C. pseudotuberculosis isolates against 24 antimicrobial agents are shown in Table 3. All isolates exhibited 100% resistance to bacitracin and florfenicol and susceptibility to norfloxacin. The majority of isolates exhibited high levels of resistance to penicillin, erythromycin (92.6% each), and cephradine (88.9%). Interestingly, 7.4% of C. pseudotuberculosis isolates were vancomycin-resistant, with minimum inhibitory concentration (MIC) values of ≥64.
Table 4 shows the frequency of C. pseudotuberculosis resistant isolates in both sheep and goats. All sheep isolates were 100% resistant to streptomycin, erythromycin, trimethoprim/sulphamethoxazole, bacitracin, and florfenicol but 100% susceptible to norfloxacin. However, goat’s isolates were all resistant to cephradine, bacitracinand florfenicolbut susceptible to ampicillin/sulbactam, norfloxacin, and vancomycin. Resistance to vancomycin was reported in four (16.7%) of the C. pseudotuberculosis recovered from sheep for the first time in Egypt.
All of the C. pseudotuberculosis isolates in this study showed MDR with an average MAR index of 0.63, ranging from 0.38 to 0.88. The highest MAR index (0.88) was found in an isolate recovered from a sheep. However, there was no statistically significant difference (p = 0.065) between the MAR index of isolates recovered from sheep and goats (Figure 2).

3.4. Virulence and Resistance Genes

The PLD, PIP, and FagA virulence genes were found in all (100%) of the C. pseudotuberculosis isolates recovered from both sheep and goats. However, the FagB, FagC, and FagD virulence genes were found in 24 (100%), 20 (83%), and 18 (75%) of the isolates recovered from sheep, respectively. From goats, FagB was found in 26 (87%), FagC in 26 (87%), and FagD in 18 (60%) of the isolates (Figure 3).
Figure 4 shows the frequency of antimicrobial resistance genes in C. pseudotuberculosis isolates recovered from both sheep and goats. The β-lactam resistance gene (bla) was present in all of the isolates, while the glycopeptide (vanA) resistance gene was only found in 8% of the isolates from sheep. Additionally, 83% of the isolates from sheep carried the aminoglycoside (aph (3″)-lb), chloramphenicol (cat1), and bacitracin (bcrA) resistance genes. For the isolates recovered from goats, 73% were found to contain macrolides (ermX), sulfonamide (sul1), and bacitracin (bcrA) resistance genes.

3.5. Genotyping and Phylogenetic Analysis

Ten MDR C. pseudotuberculosis isolates from sheep and goats (5 of each) were analyzed using ERIC-PCR fingerprinting and 16S rRNA sequencing. The ERIC-PCR dendrogram analysis showed that the 10 isolates were grouped into three clusters based on their similarity (Figure 5). Two of the clusters contained isolates from both sheep and goats, with a similarity index of 83.6%.
The 16S rRNA of 10 virulent MDR C. pseudotuberculosis isolates from sheep and goats was sequenced and uploaded to GenBank (accession numbers OP550121 to OP550130). In addition, two published sequences of biotypes equi (GenBank accession numbers CP003540.3 and CP003652.3) were included in the analysis to differentiate between C. pseudotuberculosis biovar Ovis and Equi. The phylogenetic tree showed that the 16S rRNA sequences of C. pseudotuberculosis isolates from sheep and goats clustered in the biovar Ovis lineage and were clearly differentiated from biovar Equi (Figure 6). Therefore, the nucleotide disparity did not alter protein expression. However, a C. pseudotuberculosis sequence from a sheep source (GenBank accession No. OP550123.1) showed sequence heterogeneity and was closely related to other published sequences.

4. Discussion

C. pseudotuberculosis biovar Ovis is the causative agent of CLA, which is a chronic contagious disease of sheep and goats, particularly in small breeders [11,32]. Information on the prevalence of CLA is limited in many countries as it is not a notifiable disease and often proceeds subclinically without any sign of abscesses [21]. In this study, CLA-compatible lesions were detected in 54 (24.54%) of the 220 studied animals, which were then confirmed by C. pseudotuberculosis isolation and subsequent PCR identification. The high infection rate may result from inadequate vaccination, sharing contaminated instruments, a dry climate, and an inefficient quarantine protocol adopted by small breeders. Our results were higher than the results reported by Oreiby and coauthors [2], who recorded a lower infection rate (6.7%) based on clinical lesions of CLA, with rates of 7.54% in sheep and 3.98% in goats.
In this study, a lower CLA infection rate was observed in sheep (18.46%) compared with goats (33.3%). Previous studies in Egypt have reported higher infection rates in sheep than in goats [2,6]. However, the isolation rate of C. pseudotuberculosis in this study was similar to the 25.66% recorded in goats with CLA in Egypt [6] and the 39.2% reported in southwestern China [8]. Other studies have reported a higher infection rate in goats in Nigeria (50%) and India (51.9%) [52,53]. The higher CLA infection rate in goats could be explained by the goats’ tendency to scratch themselves against hard objects, making them more susceptible to superficial injuries than sheep [54]. The infection rate in sheep in this study was similar to the 22.7% reported based on clinical signs and the 20.1% reported based on bacteriological examination [55]. Furthermore, other studies have reported lower rates (10.47% and 3.71%) in different Egyptian governorates [56,57]. The variability of CLA prevalence between studies may be attributed to management and environmental conditions, as well as the abundance of sheep and goat flocks within other localities. The present study involved sheep and goats from both fixed and mobile flocks. The lowest infection rate of 18.8% was observed in Zagazig, where most flocks are fixed, in contrast to other study localities where flocks are mobile. This finding is consistent with previous research by Selim and coworkers [57], who also reported that mobile flocks had a higher risk of infection compared to fixed flocks, attributing it to the fact that free-grazing animals in mobile flocks are more likely to come into contact with other infected animals.
It is worth mentioning that, in the present study, C. pseudotuberculosis was isolated from all purulent material samples collected from clinically infected animals and confirmed by 16S rRNA and RNA polymerase b-subunit (rpoB) gene-specific PCR. This result indicates that the sensitivities of bacterial culture and PCR were the same, suggesting the adoption of PCR as an alternative to cumbersome bacterial culture procedures. However, other studies have indicated that the incidence of CLA on a clinical basis has always been higher than on a bacteriological or molecular basis [28,58,59].
The 54 C. pseudotuberculosis isolates were tested for antimicrobial susceptibility and exhibited varying susceptibility patterns. However, the majority of these isolates demonstrated resistance to numerous of the 24 tested antimicrobials. Most previous studies on the antimicrobial susceptibility of C. pseudotuberculosis showed diverse prevalence and patterns [8,21,32,60], which has been attributed by some authors to regional variations in antimicrobial use, the availability of over-the-counter antibiotics without prescriptions, and levels of veterinary service provided [60]. In Egypt, antimicrobials are available over-the-counter and extensively used by smallholder breeders as prophylactics and/or growth promoters [22], which might explain the high resistance rate reported in this study.
C. pseudotuberculosis isolates recovered in the present study showed high rates of resistance to bacitracin, florfenicol, penicillin, and erythromycin, which is consistent with previous studies from Saudi Arabia [61] and Kosovo [62]. However, other studies have reported C. pseudotuberculosis isolates that were sensitive to the majority of antimicrobial classes [8,21,32] and attributed this to the limited use of antimicrobials in sheep and goats. It is worth mentioning that all (100%) of the C. pseudotuberculosis isolates recovered in the current study were sensitive to norfloxacin, while the emergence of vancomycin resistance was noted in 7.4% of the examined isolates as a first report in Egypt. This finding was similar to that of Abebe and Sisay Tessema [21], who revealed that all of their C. pseudotuberculosis isolates were 100% sensitive to norfloxacin and 20.3% were resistant to vancomycin.
In this study, the presence of MDR C. pseudotuberculosis was found to be high, with most of the isolates being resistant to clinically important antimicrobial classes including cephalosporins, aminoglycosides, and macrolides, which are listed by the WHO as critically important antimicrobials for human health [51]. Considering its zoonotic potential and economic impact, MDR C. pseudotuberculosis could pose a potential threat to public health.
Herein, multiple virulence genes (PLD, PIP, FagA, FagB, FagC, and FagD) were detected in C. pseudotuberculosis isolates, with a consistent virulence profile of PLD, PIP, and FagA identified in all isolates. Similar virulence profiles were also detected in C. pseudotuberculosis isolates recovered from superficial abscesses in previous studies [8,63]. However, variations in virulence profiles between studies suggested that C. pseudotuberculosis strains may have different pathogenic modes [32]. For instance, the virulence profiles of PLD, FagA, FagB, FagC, and FagD were more prevalent among C. pseudotuberculosis strains isolated from visceral abscesses compared to surface abscesses, indicating variations in the invasive potential of C. pseudotuberculosis strains [32].
Notably, β-lactam and aminoglycoside resistance genes were detected in most of our C. pseudotuberculosis isolates recovered from both sheep and goats. These results are not surprising as the isolates showed high resistance to β-lactams and aminoglycoside antimicrobial agents in susceptibility tests, which is consistent with previous findings in Egypt [56] and Argentina [64], although our results were higher. All resistance genes were detected in C. pseudotuberculosis isolates from both sheep and goats, except for the vanA gene, which was only found in sheep, suggesting that antimicrobial misuse may be more prevalent in sheep compared to goats. This variation could be attributed to local antimicrobial usage practices and farm biosecurity and management, as previous studies have reported an association between resistance genes and farm practices [65].
Various molecular methods, such as ERIC-PCR, restriction fragment length polymorphism (RFLP), and whole genome sequence analysis, have been used to classify and identify the genetic relationship between C. pseudotuberculosis isolates from sheep and goats [66,67]. In the current study, ERIC-PCR fingerprinting grouped the 10 MDR C. pseudotuberculosis isolates into three clusters, with high similarity between isolates from sheep and goats. Similarly, a recent study by Torky et al. [68] reported clusters of C. pseudotuberculosis isolates from sheep and goats in the same group, which could be attributed to the endemic nature of CLA in Egypt and the practice of raising sheep and goats together in the same flock. Furthermore, C. pseudotuberculosis has been shown to be highly persistent within the farm environment and can survive for up to 6 months in the environment, increasing the likelihood of transmission between species [69].
A phylogenetic analysis based on 16S rRNA sequence was used in the present study to differentiate between C. pseudotuberculosis biovar Ovis and Equi. However, other studies have reported that genes like rpoB [63,70] and fusA [8,71], which have higher polymorphism than 16S rRNA, are more effective for differentiation. In addition, our analysis revealed low bootstrap values and intergroup divergence within biotype Ovis, consistent with previous studies that reported genetic diversity within biotype Ovis is independent of host and geographic origins [8,71]. This could be due to the fact that this study was conducted on sheep and goats in a smallholder production system where close coexistence or even common grazing and housing among different flocks is possible [60].
An important limitation in this study is the sampling strategy, which involved collecting samples only from sheep and goats with superficial lymph node enlargement and only from a limited number of farmers who willingly agreed to take part. This approach may explain the different estimates recorded, but the results cannot be extrapolated to a wider national context. However, it is worth noting that the classical “external” form of CLA is the most prevalent, while abscessation in internal lymph nodes and organs occurs less frequently [5].

5. Conclusions

This study revealed that superficial abscesses in sheep and goats, raised under smallholder production systems in four districts in Egypt, were mostly associated with C. pseudotuberculosis infection. C. pseudotuberculosis was isolated from both sheep and goats, with all isolates belonging to C. pseudotuberculosis biovar Ovis. Furthermore, C. pseudotuberculosis exhibited high levels of resistance to multiple antimicrobial agents, as well as varying patterns of virulence and resistance genes. Therefore, to effectively control and reduce the impact of C. pseudotuberculosis infection, a sustainable control strategy and increased knowledge and awareness among smallholder breeders are recommended.

Author Contributions

Conceptualization, H.M.E.D., A.S.E.-D. and N.K.A.E.-A.; methodology, H.M.E.D., A.S.E.-D., S.G.Y., E.M.A.R. and A.S. validation, A.A.H., S.G.Y., E.M.A.R., A.S. and I.E.; formal analysis, I.E.; investigation, H.M.E.D., A.S.E.-D., N.K.A.E.-A., A.A.H., S.G.Y., E.M.A.R., A.S. and I.E.; data curation, H.M.E.D., N.K.A.E.-A. and I.E.; writing—original draft preparation, H.M.E.D., A.S.E.-D., N.K.A.E.-A., S.G.Y. and I.E.; writing—review and editing, H.M.E.D., N.K.A.E.-A. and I.E. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

The Institutional Animal Care and Use Committee at Zagazig University, Zagazig, Egypt (ZU-IACUC/2/F/28/2021), approved the sampling and data collection protocol on 25 February 2021.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Acknowledgments

The authors thank the sheep and goat breeders for subjecting their animals to the study.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Arsenault, J.; Girard, C.; Dubreuil, P.; Daignault, D.; Galarneau, J.-R.; Boisclair, J.; Simard, C.; Bélanger, D. Prevalence of and carcass condemnation from maedi–visna, paratuberculosis and caseous lymphadenitis in culled sheep from Quebec, Canada. Prev. Vet. Med. 2003, 59, 67–81. [Google Scholar] [CrossRef]
  2. Oreiby, A.; Hegazy, Y.; Osman, S.; Ghanem, Y.; Al-Gaabary, M. Caseous lymphadenitis in small ruminants in Egypt. Tierärztliche Prax. Ausg. G Großtiere/Nutztiere 2014, 42, 271–277. [Google Scholar] [CrossRef]
  3. Collett, M.G.; Bath, G.F.; Cameron, C.M. Corynebacterium pseudotuberculosis Infections; Oxford University Press: New York, NY, USA, 1994. [Google Scholar]
  4. Oliveira, A.; Teixeira, P.; Azevedo, M.; Jamal, S.B.; Tiwari, S.; Almeida, S.; Silva, A.; Barh, D.; Dorneles, E.M.S.; Haas, D.J. Corynebacterium pseudotuberculosis may be under anagenesis and biovar Equi forms biovar Ovis: A phylogenic inference from sequence and structural analysis. BMC Microbiol. 2016, 16, 100. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  5. Fontaine, M.; Baird, G. Caseous lymphadenitis. Small Rumin. Res. 2008, 76, 42–48. [Google Scholar] [CrossRef]
  6. Al-Gaabary, M.H.; Osman, S.A.; Oreiby, A.F. Caseous lymphadenitis in sheep and goats: Clinical, epidemiological and preventive studies. Small Rumin. Res. 2009, 87, 116–121. [Google Scholar] [CrossRef]
  7. Bastos, B.; Portela, R.D.; Dorella, F.; Ribeiro, D.; Seyffert, N.; Castro, T.; Miyoshi, A.; Oliveira, S.; Meyer, R.; Azevedo, V. Corynebacterium pseudotuberculosis: Immunological responses in animal models and zoonotic potential. J. Clin. Cell Immunol. S 2012, 4, 10.4172. [Google Scholar] [CrossRef]
  8. Li, H.; Yang, H.; Zhou, Z.; Li, X.; Yi, W.; Xu, Y.; Wang, Z.; Hu, S. Isolation, antibiotic resistance, virulence traits and phylogenetic analysis of Corynebacterium pseudotuberculosis from goats in southwestern China. Small Rumin. Res. 2018, 168, 69–75. [Google Scholar] [CrossRef]
  9. Binns, S.H.; Green, L.E.; Bailey, M. Development and validation of an ELISA to detect antibodies to Corynebacterium pseudotuberculosis in ovine sera. Vet. Microbiol. 2007, 123, 169–179. [Google Scholar] [CrossRef] [Green Version]
  10. Sutherland, S.; Hart, R.; Buller, N. Genetic differences between nitrate-negative and nitrate-positive C. pseudotuberculosis strains using restriction fragment length polymorphisms. Vet. Microbiol. 1996, 49, 1–9. [Google Scholar] [CrossRef]
  11. Connor, K.M.; Quirie, M.M.; Baird, G.; Donachie, W. Characterization of United Kingdom isolates of Corynebacterium pseudotuberculosis using pulsed-field gel electrophoresis. J. Clin. Microbiol. 2000, 38, 2633–2637. [Google Scholar] [CrossRef]
  12. Sutherland, S.; Hart, R.; Buller, N. Ribotype analysis of Corynebacterium pseudotuberculosis isolates from sheep and goats. Aust. Vet. J. 1993, 70, 454–456. [Google Scholar] [CrossRef]
  13. de Sa Guimaraes, A.; Dorneles, E.M.S.; Andrade, G.I.; Lage, A.P.; Miyoshi, A.; Azevedo, V.; Gouveia, A.M.G.; Heinemann, M.B. Molecular characterization of Corynebacterium pseudotuberculosis isolates using ERIC-PCR. Vet. Microbiol. 2011, 153, 299–306. [Google Scholar] [CrossRef]
  14. Dorneles, E.; Santana, J.; Andrade, G.; Santos, E.; Guimarães, A.; Mota, R.; Santos, A.; Miyoshi, A.; Azevedo, V.; Gouveia, A. Molecular characterization of Corynebacterium pseudotuberculosis isolated from goats using ERIC-PCR. Genet. Mol. Res. 2012, 11, 2051–2059. [Google Scholar] [CrossRef]
  15. Dorneles, E.M.; Santana, J.A.; Ribeiro, D.; Dorella, F.A.; Guimaraes, A.S.; Moawad, M.S.; Selim, S.A.; Garaldi, A.L.M.; Miyoshi, A.; Ribeiro, M.G. Evaluation of ERIC-PCR as genotyping method for Corynebacterium pseudotuberculosis isolates. PLoS ONE 2014, 9, e98758. [Google Scholar] [CrossRef]
  16. Dorella, F.; Pacheco, L.G.C.; Oliveira, S.; Miyoshi, A.; Azevedo, V. Corynebacterium pseudotuberculosis: Microbiology, biochemical properties, pathogenesis and molecular studies of virulence. Vet. Res. 2006, 37, 201–218. [Google Scholar] [CrossRef] [Green Version]
  17. Hodgson, A.; Tachedjian, M.; Corner, L.A.; Radford, A.J. Protection of sheep against caseous lymphadenitis by use of a single oral dose of live recombinant Corynebacterium pseudotuberculosis. Infect. Immun. 1994, 62, 5275–5280. [Google Scholar] [CrossRef]
  18. Baird, G.; Fontaine, M. Corynebacterium pseudotuberculosis and its role in ovine caseous lymphadenitis. J. Comp. Pathol. 2007, 137, 179–210. [Google Scholar] [CrossRef]
  19. Billington, S.J.; Esmay, P.A.; Songer, J.G.; Jost, B.H. Identification and role in virulence of putative iron acquisition genes from Corynebacterium pseudotuberculosis. FEMS Microbiol. Lett. 2002, 208, 41–45. [Google Scholar] [CrossRef]
  20. Farias, A.M.; Alves, J.R.; Alves, F.S.; Pinheiro, R.R.; Faccioli-Martins, P.Y.; Lima, A.; Azevedo, S.S.; Alves, C.J. Serological study on Corynebacterium pseudotuberculosis infection in goats in the Brazilian Northeast using enzyme-linked immunosorbent assay (ELISA-indirect). Pesqui. Veterinária Bras. 2018, 38, 1344–1350. [Google Scholar] [CrossRef] [Green Version]
  21. Abebe, D.; Sisay Tessema, T. Determination of Corynebacterium pseudotuberculosis prevalence and antimicrobial susceptibility pattern of isolates from lymph nodes of sheep and goats at an organic export abattoir, Modjo, Ethiopia. Lett. Appl. Microbiol. 2015, 61, 469–476. [Google Scholar] [CrossRef] [Green Version]
  22. Algammal, A. Molecular characterization and antibiotic susceptibility of Corynebacterium pseudotuberculosis isolated from sheep and goats suffering from caseous lymphadenitis. Zagazig Vet. J. 2016, 44, 1–8. [Google Scholar] [CrossRef] [Green Version]
  23. Al-Gaabary, M.H.; Osman, S.A.; Ahmed, M.S.; Oreiby, A.F. Abattoir survey on caseous lymphadenitis in sheep and goats in Tanta, Egypt. Small Rumin. Res. 2010, 94, 117–124. [Google Scholar] [CrossRef]
  24. Magdy Selim, A.; Atwa, S.M.; El Gedawy, A.A.; Younis, E.E. Epidemiological, bacteriological and molecular studies on caseous lymphadenitis in sheep of Dakhlia, Egypt. Anim. Biotechnol. 2022, 33, 1655–1660. [Google Scholar] [CrossRef] [PubMed]
  25. Quinn, P.J.; Markey, B.K.; Leonard, F.C.; Hartigan, P.; Fanning, S.; Fitzpatrick, E. Veterinary Microbiology and Microbial Disease; John Wiley & Sons: Hoboken, NJ, USA, 2011. [Google Scholar]
  26. Markey, B.; Leonard, F.; Archambault, M.; Cullinane, A.; Maguire, D. Clinical Veterinary Microbiology E-Book; Elsevier Health Sciences: Amsterdam, The Netherlands, 2013. [Google Scholar]
  27. Cowan, S.T.; Steel, K.J. Manual for the Identification of Medical Bacteria, 3rd ed.; Cambridge University Press: Cambridge, UK, 1965; pp. 75–79. [Google Scholar]
  28. Cetinkaya, B.; Karahan, M.; Atil, E.; Kalin, R.; De Baere, T.; Vaneechoutte, M. Identification of Corynebacterium pseudotuberculosis isolates from sheep and goats by PCR. Vet. Microbiol. 2002, 88, 75–83. [Google Scholar] [CrossRef]
  29. Pacheco, L.G.; Pena, R.R.; Castro, T.L.; Dorella, F.A.; Bahia, R.C.; Carminati, R.; Frota, M.N.; Oliveira, S.C.; Meyer, R.; Alves, F.S. Multiplex PCR assay for identification of Corynebacterium pseudotuberculosis from pure cultures and for rapid detection of this pathogen in clinical samples. J. Med. Microbiol. 2007, 56, 480–486. [Google Scholar] [CrossRef] [Green Version]
  30. Ilhan, Z. Detection of Corynebacterium pseudotuberculosis from sheep lymph nodes by PCR. Rev. Med. Vet. 2013, 164, 60–66. [Google Scholar]
  31. D’Afonseca, V.; Prosdocimi, F.; Dorella, F.A.; Pacheco, L.G.C.; Moraes, P.M.; Pena, I.; Ortega, J.M.; Teixeira, S.; Oliveira, S.C.; Coser, E.M. Survey of genome organization and gene content of Corynebacterium pseudotuberculosis. Microbiol. Res. 2010, 165, 312–320. [Google Scholar] [CrossRef]
  32. de Sá, M.d.C.A.; Gouveia, G.V.; Krewer, C.d.C.; Veschi, J.L.A.; de Mattos-Guaraldi, A.L.; da Costa, M.M. Distribution of PLD and FagA, B, C and D genes in Corynebacterium pseudotuberculosis isolates from sheep and goats with caseus lymphadenitis. Genet. Mol. Biol. 2013, 36, 265–268. [Google Scholar]
  33. Rosato, A.E.; Lee, B.S.; Nash, K.A. Inducible macrolide resistance in Corynebacterium jeikeium. Antimicrob. Agents Chemother. 2001, 45, 1982–1989. [Google Scholar] [CrossRef] [Green Version]
  34. Jeong, D.-W.; Lee, B.; Heo, S.; Oh, Y.; Heo, G.; Lee, J.-H. Two genes involved in clindamycin resistance of Bacillus licheniformis and Bacillus paralicheniformis identified by comparative genomic analysis. PLoS ONE 2020, 15, e0231274. [Google Scholar] [CrossRef] [Green Version]
  35. Dutka-Malen, S.; Evers, S.; Courvalin, P. Detection of glycopeptide resistance genotypes and identification to the species level of clinically relevant Enterococci by PCR. J. Clin. Microbiol. 1995, 33, 24–27. [Google Scholar] [CrossRef]
  36. Williams, D.; Spring, L.; Collins, L.; Miller, L.; Heifets, L.; Gangadharam, P.; Gillis, T. Contribution of rpoB mutations to development of rifamycin cross-resistance in Mycobacterium tuberculosis. Antimicrob. Agents Chemother. 1998, 42, 1853–1857. [Google Scholar] [CrossRef] [Green Version]
  37. Charlebois, A.; Jalbert, L.-A.; Harel, J.; Masson, L.; Archambault, M. Characterization of genes encoding for acquired bacitracin resistance in Clostridium perfringens. PLoS ONE 2012, 7, e44449. [Google Scholar] [CrossRef] [Green Version]
  38. Jacoby, G.A.; Chow, N.; Waites, K.B. Prevalence of plasmid-mediated quinolone resistance. Antimicrob. Agents Chemother. 2003, 47, 559–562. [Google Scholar] [CrossRef] [Green Version]
  39. Gebreyes, W.A.; Altier, C. Molecular characterization of multidrug-resistant Salmonella enterica subsp. enterica serovar Typhimurium isolates from swine. J. Clin. Microbiol. 2002, 40, 2813–2822. [Google Scholar] [CrossRef] [Green Version]
  40. Miró, E.; Grünbaum, F.; Gómez, L.; Rivera, A.; Mirelis, B.; Coll, P.; Navarro, F. Characterization of aminoglycoside-modifying enzymes in Enterobacteriaceae clinical strains and characterization of the plasmids implicated in their diffusion. Microb. Drug Resist. 2013, 19, 94–99. [Google Scholar] [CrossRef]
  41. Heuer, H.; Smalla, K. Manure and sulfadiazine synergistically increased bacterial antibiotic resistance in soil over at least two months. Environ. Microbiol. 2007, 9, 657–666. [Google Scholar] [CrossRef]
  42. Schröder, J.; Maus, I.; Meyer, K.; Wördemann, S.; Blom, J.; Jaenicke, S.; Schneider, J.; Trost, E.; Tauch, A. Complete genome sequence, lifestyle, and multi-drug resistance of the human pathogen Corynebacterium resistens DSM 45100 isolated from blood samples of a leukemia patient. BMC Genom. 2012, 13, 141. [Google Scholar] [CrossRef] [Green Version]
  43. Alibi, S.; Ferjani, A.; Boukadida, J.; Cano, M.E.; Fernández-Martínez, M.; Martínez-Martínez, L.; Navas, J. Occurrence of Corynebacterium striatum as an emerging antibiotic-resistant nosocomial pathogen in a Tunisian hospital. Sci. Rep. 2017, 7, 9704. [Google Scholar] [CrossRef] [Green Version]
  44. Abdolmaleki, Z.; Mashak, Z.; Safarpoor Dehkordi, F. Phenotypic and genotypic characterization of antibiotic resistance in the methicillin-resistant Staphylococcus aureus strains isolated from hospital cockroaches. Antimicrob. Resist. Infect. Control 2019, 8, 54. [Google Scholar] [CrossRef] [Green Version]
  45. Versalovic, J.; Koeuth, T.; Lupski, R. Distribution of repetitive DNA sequences in eubacteria and application to finerpriting of bacterial enomes. Nucleic Acids Res. 1991, 19, 6823–6831. [Google Scholar] [CrossRef] [PubMed]
  46. CLSI. Clinical and Laboratory Standards Institute: Performance Standards for Antimicrobial Susceptibility Testing, 30th ed.; CLSI Doc. M100; CLSI: Wayne, PA, USA, 2020. [Google Scholar]
  47. Tambekar, D.; Dhanorkar, D.; Gulhane, S.; Khandelwal, V.; Dudhane, M. Antibacterial susceptibility of some urinary tract pathogens to commonly used antibiotics. Afr. J. Biotechnol. 2006, 5, 1562–1565. [Google Scholar]
  48. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  49. Saitou, N.; Nei, M. The neighbor-joining method: A new method for reconstructing phylogenetic trees. Mol. Biol. Evol. 1987, 4, 406–425. [Google Scholar]
  50. Kimura, M. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. J. Mol. Evol. 1980, 16, 111–120. [Google Scholar] [CrossRef]
  51. Collignon, P.J.; Conly, J.M.; Andremont, A.; McEwen, S.A.; Aidara-Kane, A.; WHO-AGISAR; Agerso, Y.; Andremont, A.; Collignon, P.; Conly, J.; et al. World Health Organization ranking of antimicrobials according to their importance in human medicine: A critical step for developing risk management strategies to control antimicrobial resistance from food animal production. Clin. Infect. Dis. 2016, 63, 1087–1093. [Google Scholar] [CrossRef] [Green Version]
  52. Kusiluka, L.; Kambarage, D. Diseases of small ruminants: A handbook. Common Dis. Sheep Goats Sub-Sahar. Afr. 1996, 35–37. [Google Scholar]
  53. Kumar, J.; Singh, F.; Tripathi, B.N.; Kumar, R.; Dixit, S.K.; Sonawane, G.G. Epidemiological, bacteriological and molecular studies on caseous lymphadenitis in Sirohi goats of Rajasthan, India. Trop. Anim. Health Prod. 2012, 44, 1319–1322. [Google Scholar] [CrossRef]
  54. Yitagesu, E.; Alemnew, E.; Olani, A.; Asfaw, T.; Demis, C. Survival analysis of clinical cases of caseous lymphadenitis of goats in North Shoa, Ethiopia. Vet. Med. Int. 2020, 2020, 8822997. [Google Scholar] [CrossRef]
  55. Sayed, S.M.; El Berbawy, S.M.; Al Habaty, S.H. Sheep caseous lymphadenitis: Causative bacterial agents and their in vitro some antimicrobial susceptibility. Assiut Univ. Bull. Environ. Res. 2012, 15, 65–76. [Google Scholar]
  56. Rizk, A.M.; El-Tawab, A.; Awad, A.; AFIFI, S.E.; Mohamed, S.R. Corynebacterium pseudotuberculosis infection in small ruminant and molecular study of virulence and resistance genes in Beni-Suef Governorate. Benha Vet. Med. J. 2019, 37, 122–127. [Google Scholar] [CrossRef]
  57. Selim, A.M.; Atwa, S.M.; El Gedawy, A.A.; Hegazy, Y.M.; Rizk, M.A.; Younis, E.E. Risk factors associated with the seroprevalence of caseous lymphadenitis in sheep. Comp. Clin. Pathol. 2021, 30, 285–291. [Google Scholar] [CrossRef]
  58. Al-Harbi, K.B. Prevalence and etiology of abscess disease of sheep and goats at Qassim region, Saudi Arabia. Vet. World 2011, 4, 495. [Google Scholar] [CrossRef]
  59. Tripathi, B.; Kumar, J.; Sonawane, G.; Kumar, R.; Dixit, S. Microbiological and molecular investigation of clinically suspected caseous lymphadenitis cases in goats. Agric. Res. 2016, 5, 413–419. [Google Scholar] [CrossRef]
  60. Pathirana, H.N.K.S.; Cho, H.S.; Cho, Y.I.; Kim, C.L.; Wimalasena, S.H.M.P.; Rajapaksha, L.G.T.G.; Gunasekara, C.W.R.; Kim, C.H.; Seo, B.J.; Moon, S.H. Molecular characterization and antimicrobial susceptibility of Corynebacterium pseudotuberculosis isolated from skin abscesses of native Korean goats (Capra hircus coreanae). J. Appl. Microbiol. 2022, 133, 2074–2082. [Google Scholar] [CrossRef]
  61. Hassan, N.; Al-Humiany, A.; Bahobail, A.; Mansour, A. Bacteriological and pathological studies on Caseous lymphadenitis in sheep in Saudi Arabia. Int. J. Microbiol. Res. 2011, 2, 28–37. [Google Scholar]
  62. Robaj, A.; Hamidi, A.; Bytyqi, H.; Sylejmani, D. Frequency and antimicrobial susceptibility of bacterial isolates from caseous lymphadenitis in sheep in Kosovo. Bulg. J. Agri. Sci. 2017, 23, 1033–1036. [Google Scholar]
  63. Guerrero, J.A.V.; de Oca Jiménez, R.M.; Dibarrat, J.A.; León, F.H.; Morales-Erasto, V.; Salazar, H.G.M. Isolation and molecular characterization of Corynebacterium pseudotuberculosis from sheep and goats in Mexico. Microb. Pathog. 2018, 117, 304–309. [Google Scholar] [CrossRef]
  64. Gallardo, A.A.; Toledo, R.A.; González Pasayo, R.A.; Azevedo, V.; Robles, C.; Paolicchi, F.A.; Estevao Belchior, S.G. Corynebacterium pseudotuberculosis biovar Ovis: Evaluación de la sensibilidad antibiótica in vitro. Rev. Argent. Microbiol. 2019, 51, 334–338. [Google Scholar] [CrossRef] [PubMed]
  65. Dorado-García, A.; Bos, M.E.; Graveland, H.; Van Cleef, B.A.; Verstappen, K.M.; Kluytmans, J.A.; Wagenaar, J.A.; Heederik, D.J. Risk factors for persistence of livestock-associated MRSA and environmental exposure in veal calf farmers and their family members: An observational longitudinal study. BMJ Open 2013, 3, e003272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  66. Ruiz, J.C.; D’Afonseca, V.; Silva, A.; Ali, A.; Pinto, A.C.; Santos, A.R.; Rocha, A.A.; Lopes, D.O.; Dorella, F.A.; Pacheco, L.G. Evidence for reductive genome evolution and lateral acquisition of virulence functions in two Corynebacterium pseudotuberculosis strains. PLoS ONE 2011, 6, e18551. [Google Scholar] [CrossRef] [Green Version]
  67. Soares, S.C.; Silva, A.; Trost, E.; Blom, J.; Ramos, R.; Carneiro, A.; Ali, A.; Santos, A.R.; Pinto, A.C.; Diniz, C. The pan-genome of the animal pathogen Corynebacterium pseudotuberculosis reveals differences in genome plasticity between the biovar Ovis and equi strains. PLoS ONE 2013, 8, e53818. [Google Scholar] [CrossRef] [PubMed] [Green Version]
  68. Torky, H.A.; Saad, H.M.; Khaliel, S.A.; Kassih, A.T.; Sabatier, J.-M.; Batiha, G.E.-S.; Hetta, H.F.; Elghazaly, E.M.; De Waard, M. Isolation and Molecular Characterization of Corynebacterium pseudotuberculosis: Association with Proinflammatory Cytokines in Caseous Lymphadenitis Pyogranulomas. Animals 2023, 13, 296. [Google Scholar] [CrossRef]
  69. O’reilly, K.; Green, L.; Malone, F.; Medley, G. Parameter estimation and simulations of a mathematical model of Corynebacterium pseudotuberculosis transmission in sheep. Prev. Vet. Med. 2008, 83, 242–259. [Google Scholar] [CrossRef]
  70. Retamal, P.; Ríos, M.; Cheuquepán, F.; Abalos, P.; Pizarro-Lucero, J.; Borie, C.; Gutierrez, J. Host associated polymorphisms in the Corynebacterium pseudotuberculosis rpoB gene sequence. Vet. Microbiol. 2011, 151, 400–403. [Google Scholar] [CrossRef]
  71. Sellyei, B.; Bányai, K.; Bartha, D.; Hajtós, I.; Fodor, L.; Makrai, L. Multilocus sequencing of Corynebacterium pseudotuberculosis biotype ovis strains. BioMed. Res. Int. 2017, 2017, 1762162. [Google Scholar] [CrossRef] [Green Version]
Animals 13 02337 g001 550
Figure 1. Abscess formation in goats (upper row) and sheep (lower row) occurs in different body locations due to infection with C. pseudotuberculosis.
Figure 1. Abscess formation in goats (upper row) and sheep (lower row) occurs in different body locations due to infection with C. pseudotuberculosis.
Animals 13 02337 g001
Animals 13 02337 g002 550
Figure 2. Multiple Antimicrobial Resistance (MAR) Index of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Figure 2. Multiple Antimicrobial Resistance (MAR) Index of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Animals 13 02337 g002
Animals 13 02337 g003 550
Figure 3. Frequency of virulence genes of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Figure 3. Frequency of virulence genes of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Animals 13 02337 g003
Animals 13 02337 g004 550
Figure 4. Frequency of antimicrobial resistance genes of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Figure 4. Frequency of antimicrobial resistance genes of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Animals 13 02337 g004
Animals 13 02337 g005 550
Figure 5. Dendrogram based on ERIC-PCR genotyping of C. pseudotuberculosis isolates (n = 10) recovered from sheep and goats with caseous lymphadenitis. Different colors corresponded to the three clusters identified.
Figure 5. Dendrogram based on ERIC-PCR genotyping of C. pseudotuberculosis isolates (n = 10) recovered from sheep and goats with caseous lymphadenitis. Different colors corresponded to the three clusters identified.
Animals 13 02337 g005
Animals 13 02337 g006 550
Figure 6. Phylogenetic tree of C. pseudotuberculosis isolated from sheep (*) and goats (**) based on the sequence of 16S rRNA. A phylogenetic tree was generated using the neighbor-joining method and 1000 bootstrap values.
Figure 6. Phylogenetic tree of C. pseudotuberculosis isolated from sheep (*) and goats (**) based on the sequence of 16S rRNA. A phylogenetic tree was generated using the neighbor-joining method and 1000 bootstrap values.
Animals 13 02337 g006
Table
Table 1. Oligonucleotide primer sequences used in this study.
Table 1. Oligonucleotide primer sequences used in this study.
Target GenesNucleotide Sequence (5′→3′)Amplicon Size (bp)Annealing Temperature (°C)Reference
Bacterial identification:
16S rRNAF: ACCGCACTTTAGTGTGTGTG81556[28]
R: TCTCTACGCCGATCTTGTAT
rpoBF: CGTATGAACATCGGCCAGGT44655[29]
R: TCCATTTCGCCGAAGCGCTG
Virulence genes:
PLDF: ATAAGCGTAAGCAGGGAGCA20356[30]
R: ATCAGCGGTGATTGTCTTCCAGG
PIPF: AACTGCGGCTTTCTTTATTC55154[31]
R: GACAAGTGGGAACGGTATCT
FagAF:AGCAAGACCAAGAGACATGC24558[32]
R:AGTCTCAGCCCAACGTACAG
FagBF:GTGAGAAGAACCCCGGTATAAG29155[32]
R: TACCGCACTTATTCTGACACTG
FagCF:GTTTGGCTATCTCCTTGGTATG17360[32]
R: CGACCTTAGTGTTGACATACCC
FagDF:GAGACTATCGACCAGGCAG22661[32]
R: ACTTCTTGGGGAGCAGTTCT
Resistance genes:
ermXF:TCCTTACCAGTGCCCTTATCC39065[33]
R: GAGTTCCAGCGCATCACC
ermCermC-106: ATTGTGGATCGGGCAAATATT44753[34]
ermC-535: TGGAGGGGGAGAAAAATG
vanAF:GGGAAAACGACAATTGC73260[35]
R: GTACAATGCGGCCGTTA
rpoBTbRif1: AG ACG TTG ATC AAC ATC CG30455[36]
TbRif2: TAC GGC GTT TCG ATG AAC
bcrACP-F: GGCAATACCAAGCCGTTGCTTCAT40855[37]
CP-R: TTACGAAGCGATACGGAACAGCCA
qnrAQP1: GATAAAGTTTTTCAGCAAGAGG65757[38]
QP2: ATCCAGATCGGCAAAGGTTA
ermAF: TCCTTACCAGTGCCCTTATCC39065[33]
R: GAGTTCCAGCGCATCACC
aph(3″)-IbF: CTTGGTGATAACGGCAATTC54852[39]
R: CCAATCGCAGATAGAAGGC
aph(3′)-IcF: CGAGCATCAAATGAAACTGC62454[40]
R: GCGTTGCCAATGATGTTACAG
sul1F: CGG CGT GGG CTA CCT GAA CG43350[41]
R: GCC GAT CGC GTG AAG TTC CG
tet (W)F: TTCGATGGTGGCACAGTA23460[42]
R: TTGTTCGGCTGGAACGTA
blaF: CAGTCTAGCCACTTCGCCAAT80855[43]
R: TGACTGCACGGATGGAGATGG
cat1F: AGTTGCTCAATGTACCTATAACC54755[44]
R: TTGTAATTCATTAAGCATTCTGCC
dfrA1F: CTCACGATAAACAAAGAGTCA20150[44]
R: CAATCATTGCTTCGTATAACG
ERIC-PCR:
ERIC-1
ERIC-2		F: ATGTAAGCTCCTGGGGATTCACVariable52[45]
R: AAGTAAGTGACTGGGGTGAGCG
Table
Table 2. Study population demographic characteristics.
Table 2. Study population demographic characteristics.
VariableCategoriesN (%)Number of Examined (%)
SheepGoats
Gender
Female91 (41.4)57 (43.8)34 (37.8)
Male129 (58.6)73 (56.2)56 (62.2)
Age
<1 year40 (18.2)25 (19.2)15 (16.7)
1–2 years83 (37.7)39 (30.0)44 (48.9)
>2 years97 (44.1)66 (50.8)31 (34.4)
Locality
Zagazig90 (40.9)54 (41.5)36 (40.0)
Belbis55 (25.0)34 (26.1)21 (23.3)
Abo-Hammad40 (18.2)18 (13.9)22 (24.4)
Menia ElKamh35 (15.9)24 (18.5)11 (12.3)
Feeding
Concentrates 143 (65.0)83 (63.9)60 (66.7)
Grazing 77 (35.0)47 (36.2)30 (33.3)
Season
Autumn 40 (18.2)22 (16.9)18 (20.0)
Spring 91 (41.4)55 (42.3)36 (40.0)
Summer 33 (15.0)18 (13.9)15 (16.7)
Winter 56 (25.4)35 (26.9)21 (23.3)
Skin lesions
Yes36 (16.4)19 (14.6)17 (18.9)
No 184 (83.6)111 (85.4)73 (81.1)
Enlarged lymph nodes
Yes54 (24.6)24 (18.5)30 (33.3)
No 166 (75.4)106 (81.5)60 (66.7)
Total 22013090
Table
Table 3. Source, antimicrobial resistance profiles, virulence, and resistance genes of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Table 3. Source, antimicrobial resistance profiles, virulence, and resistance genes of C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Isolate SourceAntimicrobial Resistance Profiles 1MAR Index 2Virulence GenesResistance Genes
S1SheepPEN, NB, AMC, AM, OXA, VAN, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, NEO, FFC, ERY, SXT0.88PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, dfrA1, ermC, vanA, bcrA, qnrA
S2SheepPEN, NB, AMC, AM, OXA, VAN, CRO, CXM, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, NEO, FFC, ERY, SXT0.83PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, vanA, bcrA, qnrA
S3SheepPEN, NB, AMC, AM, OXA, BAC, DOX, NAL, STR, NEO, FFC, ERY, SXT0.5PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, tet(W), bla, cat1, dfrA1
S4SheepPEN, NB, AMC, OXA, BAC, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.58PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S5Goat PEN, NB, AMC, OXA, CEP, BAC, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.54PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S6Goat PEN, NB, AMC, OXA, CEP, BAC, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.58PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, ermC, bcrA, qnrA
S7Goat PEN, NB, AMC, OXA, PIP, CEP, BAC, DOX, CLI, NAL, STR, KAN, FFC, ERY, SXT0.54PLD, PIP, FagA, FagB, FagC, FagDsul1, tet(W), bla, cat1, qnrA
S8SheepPEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, FFC, ERY, SXT0.63PLD, PIP, FagA, FagB, FagCaph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, ermC, bcrA, qnrA
S9SheepPEN, NB, AMC, OXA, PIP, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, FFC, ERY, SXT0.63PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, ermC, bcrA
S10Goat PEN, AMC, OXA, PIP, CXM, CEP, BAC, AMP, DOX, CLI, FFC, ERY, SXT0.75PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3′)-Ic, sul1, tet(W), bla, ermC, bcrA, qnrA
S11SheepPEN, NB, AMC, OXA, PIP, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.63PLD, PIP, FagA, FagB, FagC, FagDermX, sul1, bla, dfrA1, ermC, bcrA, qnrA
S12Goat PEN, AMC, OXA, PIP, CEP, BAC, AMP, DOX, STR, KAN, NEO, FFC0.5PLD, PIP, FagA, FagB, FagC, FagDsul1, bla, dfrA1
S13Goat PEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, CLI, STR, KAN, AMK, NEO, FFC, RIF, ERY, SXT0.79PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, bla, rpoB
S14Goat PEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, STR, KAN, AMK, NEO, FFC, RIF, ERY, SXT0.83PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, sul1, tet(W), bla, cat1, dfrA1, ermC, rpoB, bcrA
S15SheepPEN, NB, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, FFC, RIF, ERY, SXT0.71PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, rpoB, bcrA, qnrA
S16SheepPEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, FFC, ERY, SXT0.67PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S17Goat PEN, NB, OXA, PIP, CRO, CXM, CEP, BAC, CLI, NAL, STR, KAN, AMK, NEO, FFC, ERY, SXT0.79PLD, PIP, FagA, FagB, FagC, FagDermX, sul1, bla, cat1, dfrA1, bcrA
S18SheepPEN, AM, OXA, PIP, CRO, CXM, CEP, BAC, STR, KAN, AMK, NEO, FFC, RIF, ERY, SXT0.54PLD, PIP, FagA, FagB, FagC, FagDermX, sul1, bla, cat1, dfrA1, bcrA
S19Goat PEN, PIP, CXM, CEP, BAC, DOX, AMK, FFC, SXT0.79PLD, PIP, FagA, FagB, FagC, FagDsul1, bla, cat1, dfrA1, rpoB
S20SheepPIP, CXM, CEP, BAC, DOX, STR, KAN, FFC, RIF, ERY, SXT0.75PLD, PIP, FagA, FagBermX, aph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, rpoB, bcrA
S21SheepPEN, AMC, CXM, CEP, BAC, AMP, DOX, STR, KAN, FFC, ERY, SXT0.5PLD, PIP, FagA, FagBermX, aph(3″)-Ib, sul1, bla, cat1
S22Goat PEN, PIP, CXM, CEP, BAC, DOX, STR, KAN, NEO, FFC, RIF, ERY, SXT0.71PLD, PIP, FagA, FagBermX, aph(3″)-Ib, aph(3′)-Ic, sul1, bla, cat1, rpoB, bcrA
S23Goat NB, OXA, PIP, CXM, CEP, BAC, STR, KAN, NEO, FFC, RIF, ERY, SXT0.67PLD, PIP, FagA, FagB, FagCermX, aph(3″)-Ib, sul1, bla, cat1, dfrA1, bcrA
S24Goat PEN, NB, PIP, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, NEO, FFC, RIF, ERY, SXT0.38PLD, PIP, FagA, FagCermX, aph(3″)-Ib, sul1, tet(W), bla, dfrA1, ermC, rpoB, bcrA, qnrA
S25Goat PEN, PIP, CXM, CEP, BAC, AMP, DOX, STR, KAN, NEO, FFC, ERY, SXT0.46PLD, PIP, FagA, FagBermX, aph(3″)-Ib, sul1, bla, dfrA1, bcrA
S26Goat PEN, NB, OXA, PIP, CXM, CEP, BAC, AMP, DOX, STR, NEO, FFC, RIF, ERY0.5PLD, PIP, FagA, FagB, FagCermX, aph(3″)-Ib, bla, cat1, rpoB, bcrA
S27Goat PEN, NB, OXA, PIP, CXM, CEP, BAC, AMP, DOX, NAL, NEO, FFC, ERY0.54PLD, PIP, FagA, FagCermX, bla, bcrA, qnrA
S28SheepPEN, NB, AMC, OXA, PIP, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.79PLD, PIP, FagA, FagB, FagC, FagDermX, sul1, bla, dfrA1, ermC, bcrA, qnrA
S29Goat PEN, AMC, OXA, PIP, CEP, BAC, AMP, DOX, STR, KAN, NEO, FFC0.54PLD, PIP, FagA, FagB, FagC, FagDsul1, bla, dfrA1
S30Goat PEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, CLI, STR, KAN, AMK, NEO, FFC, RIF, ERY, SXT0.67PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, bla, rpoB
S31Goat PEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, STR, KAN, AMK, NEO, FFC, RIF, ERY, SXT0.54PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, sul1, tet(W), bla, cat1, dfrA1, ermC, rpoB, bcrA
S32SheepPEN, NB, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, FFC, RIF, ERY, SXT0.83PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, rpoB, bcrA, qnrA
S33SheepPEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, FFC, ERY, SXT0.79PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S34Goat PEN, NB, OXA, PIP, CRO, CXM, CEP, BAC, CLI, NAL, STR, KAN, AMK, NEO, FFC, ERY, SXT0.58PLD, PIP, FagA, FagB, FagC, FagDermX, sul1, bla, cat1, dfrA1, bcrA
S35SheepPEN, AM, OXA, PIP, CRO, CXM, CEP, BAC, STR, KAN, AMK, NEO, FFC, RIF, ERY, SXT0.79PLD, PIP, FagA, FagB, FagC, FagDermX, sul1, bla, cat1, dfrA1, bcrA
S36Goat PEN, PIP, CXM, CEP, BAC, DOX, AMK, FFC, SXT0.54PLD, PIP, FagA, FagB, FagC, FagDsul1, bla, cat1, dfrA1, rpoB
S37SheepPIP, CXM, CEP, BAC, DOX, STR, KAN, FFC, RIF, ERY, SXT0.71PLD, PIP, FagA, FagBermX, aph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, rpoB, bcrA
S38SheepPEN, AMC, CXM, CEP, BAC, AMP, DOX, STR, KAN, FFC, ERY, SXT0.67PLD, PIP, FagA, FagBermX, aph(3″)-Ib, sul1, bla, cat1
S39Goat PEN, PIP, CXM, CEP, BAC, DOX, STR, KAN, NEO, FFC, RIF, ERY, SXT0.88PLD, PIP, FagA, FagBermX, aph(3″)-Ib, aph(3′)-Ic, sul1, bla, cat1, rpoB, bcrA
S40Goat NB, OXA, PIP, CXM, CEP, BAC, STR, KAN, NEO, FFC, RIF, ERY, SXT0.83PLD, PIP, FagA, FagB, FagCermX, aph(3″)-Ib, sul1, bla, cat1, dfrA1, bcrA
S41Goat PEN, NB, PIP, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, NEO, FFC, RIF, ERY, SXT0.5PLD, PIP, FagA, FagCermX, aph(3″)-Ib, sul1, tet(W), bla, dfrA1, ermC, rpoB, bcrA, qnrA
S42Goat PEN, PIP, CXM, CEP, BAC, AMP, DOX, STR, KAN, NEO, FFC, ERY, SXT0.58PLD, PIP, FagA, FagBermX, aph(3″)-Ib, sul1, bla, dfrA1, bcrA
S43Goat PEN, NB, OXA, PIP, CXM, CEP, BAC, AMP, DOX, STR, NEO, FFC, RIF, ERY0.63PLD, PIP, FagA, FagB, FagCermX, aph(3″)-Ib, bla, cat1, rpoB, bcrA
S44Goat PEN, NB, OXA, PIP, CXM, CEP, BAC, AMP, DOX, NAL, NEO, FFC, ERY0.63PLD, PIP, FagA, FagCermX, bla, bcrA, qnrA
S45SheepPEN, NB, AMC, AM, OXA, VAN, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, NEO, FFC, ERY, SXT0.38PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S46SheepPEN, NB, AMC, AM, OXA, VAN, CRO, CXM, BAC, AMP, DOX, CLI, NAL, STR, KAN, AMK, NEO, FFC, ERY, SXT0.46PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S47SheepPEN, NB, AMC, AM, OXA, BAC, DOX, NAL, STR, NEO, FFC, ERY, SXT0.5PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, tet(W), bla, cat1, dfrA1
S48SheepPEN, NB, AMC, OXA, BAC, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.54PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S49Goat PEN, NB, AMC, OXA, CEP, BAC, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.63PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, tet(W), bla, cat1, dfrA1, ermC, bcrA, qnrA
S50Goat PEN, NB, AMC, OXA, CEP, BAC, DOX, CLI, NAL, STR, KAN, NEO, FFC, ERY, SXT0.71PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, ermC, bcrA, qnrA
S51Goat PEN, NB, AMC, OXA, PIP, CEP, BAC, DOX, CLI, NAL, STR, KAN, FFC, ERY, SXT0.05PLD, PIP, FagA, FagB, FagC, FagDsul1, tet(W), bla, cat1, qnrA
S52SheepPEN, NB, AMC, OXA, PIP, CRO, CXM, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, FFC, ERY, SXT0.54PLD, PIP, FagA, FagB, FagCaph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, cat1, ermC, bcrA, qnrA
S53SheepPEN, NB, AMC, OXA, PIP, CEP, BAC, AMP, DOX, CLI, NAL, STR, KAN, FFC, ERY, SXT0.67PLD, PIP, FagA, FagB, FagC, FagDaph(3″)-Ib, aph(3′)-Ic, sul1, tet(W), bla, ermC, bcrA
S54Goat PEN, AMC, OXA, PIP, CXM, CEP, BAC, AMP, DOX, CLI, FFC, ERY, SXT0.54PLD, PIP, FagA, FagB, FagC, FagDermX, aph(3′)-Ic, sul1, tet(W), bla, ermC, bcrA, qnrA
1 PEN: penicillin G; AMC: amoxicillin/clavulanic acid; OXA: oxacillin; SAM: ampicillin/sulbactam; AMP: ampicillin; STR: streptomycin; AMK: amikacin; PIP: piperacillin; CRO: ceftriaxone; CXM: cefuroxime sodium; CEP: cephradine; NAL: nalidixic acid; NOR: norfloxacin; KAN: kanamycin; NEO: neomycin; DOX: doxycycline; CLI: clindamycin; VAN: vancomycin; ERY: erythromycin; SXT: trimethoprim/sulphamethoxazole; FFC: florfenicol; NB: novobiocin; BAC: bacitracin; RIF: rifampin.2 MAR index: multiple antibiotic resistance (MAR) index.
Table
Table 4. Frequency of the antimicrobial resistant C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Table 4. Frequency of the antimicrobial resistant C. pseudotuberculosis isolates recovered from sheep and goats with caseous lymphadenitis.
Rank 1ClassAgent 2No. of Resistant C. pseudotuberculosis Isolates (%)
n = 54Sheep (n = 24)Goats (n = 30)
IAminoglycosides AMK18 (33.3)10 (41.7)8 (26.7)
KAN42 (77.8)22 (91.7)20 (66.7)
NEO36 (66.7)12 (50.0)24 (80.0)
STR48 (88.9)24 (100)24 (80.0)
ICephalosporins CRO18 (33.3)12 (50.0)6 (20.0)
CXM40 (74.1)18 (75.0)22 (73.3)
CEP48 (88.9)18 (75.0)30 (100)
IMacrolidesERY50 (92.6)24 (100)26 (86.7)
IQuinolonesNAL30 (55.6)18 (75.0)12 (40.0)
NOR0 (0.0)0 (0.0)0 (0.0)
IIAminocoumarinsNB38 (70.4)18 (75.0)20 (66.7)
IIGlycopeptidesVAN4 (7.4)4 (16.7)0 (0.0)
LincosamidesCLI32 (59.3)16 (66.7)16 (53.3)
IIPenicillinsPEN50 (92.6)22 (91.7)28 (93.3)
AMC32 (59.3)18 (75.0)14 (46.7)
OXA42 (77.8)20 (83.3)22 (73.3)
SAM8 (14.8)8 (33.3)0 (0.0)
AMP32 (59.3)16 (66.7)16 (53.3)
PIP40 (74.1)14 (58.3)26 (86.7)
IISulfonamides SXT48 (88.9)24 (100)24 (80.0)
IITetracyclinesDOX46 (85.2)22 (91.7)24 (80.0)
AmphenicolsFFC54 (100)24 (100)30 (100)
BacitracinBAC54 (100)24 (100)30 (100)
RifampinRIF18 (33.3)6 (25.0)12 (40.0)
1 Rank I, critically important; rank II, highly important (based on World Health Organization’s categorization [51]).2 PEN: penicillin G; AMC: amoxicillin/clavulanic acid; OXA:oxacillin; SAM: ampicillin/sulbactam; AMP: ampicillin; STR: streptomycin; AMK: amikacin; PIP: piperacillin; CRO:ceftriaxone; CXM: cefuroxime sodium; CEP: cephradine; NAL: nalidixic acid; NOR: norfloxacin; KAN: kanamycin; NEO: neomycin; DOX: doxycycline; CLI: clindamycin; VAN: vancomycin; ERY: erythromycin; SXT: trimethoprim/sulphamethoxazole; FFC: florfenicol; NB: novobiocin; BAC: bacitracin; RIF: rifampin.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

El Damaty, H.M.; El-Demerdash, A.S.; Abd El-Aziz, N.K.; Yousef, S.G.; Hefny, A.A.; Abo Remela, E.M.; Shaker, A.; Elsohaby, I. Molecular Characterization and Antimicrobial Susceptibilities of Corynebacterium pseudotuberculosis Isolated from Caseous Lymphadenitis of Smallholder Sheep and Goats. Animals 2023, 13, 2337. https://doi.org/10.3390/ani13142337

AMA Style

El Damaty HM, El-Demerdash AS, Abd El-Aziz NK, Yousef SG, Hefny AA, Abo Remela EM, Shaker A, Elsohaby I. Molecular Characterization and Antimicrobial Susceptibilities of Corynebacterium pseudotuberculosis Isolated from Caseous Lymphadenitis of Smallholder Sheep and Goats. Animals. 2023; 13(14):2337. https://doi.org/10.3390/ani13142337

Chicago/Turabian Style

El Damaty, Hend M., Azza S. El-Demerdash, Norhan K. Abd El-Aziz, Sarah G. Yousef, Ahmed A. Hefny, Etab M. Abo Remela, Asmaa Shaker, and Ibrahim Elsohaby. 2023. "Molecular Characterization and Antimicrobial Susceptibilities of Corynebacterium pseudotuberculosis Isolated from Caseous Lymphadenitis of Smallholder Sheep and Goats" Animals 13, no. 14: 2337. https://doi.org/10.3390/ani13142337

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop