Correction: Cai et al. Sex Reversal Induced by Dietary Supplementation with 17α-Methyltestosterone during the Critical Period of Sex Differentiation in Oriental River Prawn (Macrobrachium nipponense). Animals 2023, 13, 1369
Error in Table
Reference
- Cai, P.; Yuan, H.; Gao, Z.; Daka, P.; Qiao, H.; Zhang, W.; Jiang, S.; Xiong, Y.; Gong, Y.; Wu, Y.; et al. Sex Reversal Induced by Dietary Supplementation with 17α-Methyltestosterone during the Critical Period of Sex Differentiation in Oriental River Prawn (Macrobrachium nipponense). Animals 2023, 13, 1369. [Google Scholar] [CrossRef] [PubMed]
| Primer Name | Sequence (5′ → 3′) | Description |
|---|---|---|
| EIF-F | CATGGATGTACCTGTGGTGAAAC | FWD primer for EIF expression |
| EIF-R | CTGTCAGCAGAAGGTCCTCATTA | RVS primer for EIF expression |
| Vg-F | GAAGTTAGCGGAGATCTGAGGT | FWD primer for Vg expression |
| Vg-R | CCTCGTTGACCAATCTTGAGAG | RVS primer for Vg expression |
| Vgr-F | ACCACTCGGATGAGGACGACT | FWD primer for Vgr expression |
| Vgr-R | CCATCTTTGCACTGGTAGTGGT | RVS primer for Vgr expression |
| IAG-F | CGCCTCCGTCTGCCTGAGATAC | FWD primer for IAG expression |
| IAG-R | CCTCCTCCTCCACCTTCAATGC | RVS primer for IAG expression |
| SG-F | ACCCTAGCCCCAGTACGTGTT | FWD primer for SG expression |
| SG-R | AGAGGTGGTGAAGCTGTCTCTCA | RVS primer for SG expression |
| DMRT-F | ACGACCTTAGTAGGATGGACAGT | FWD primer for DMRT expression |
| DMRT-R | GAGTGGAGGCAATAGAATGGGTA | RVS primer for DMRT expression |
| Foxl2-F | AAATCCCTGTACGACCACATCG | FWD primer for Foxl2 expression |
| Foxl2-R | CTTCGTCGGGTAGAGCATCTCC | RVS primer for Foxl2 expression |
| SoxE-F | ACATAGATCGCGCAGAAATGAAC | FWD primer for SoxE expression |
| SoxE-R | CCAAGGAAGGAAGACTTGTGAGT | RVS primer for SoxE expression |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cai, P.; Yuan, H.; Gao, Z.; Daka, P.; Qiao, H.; Zhang, W.; Jiang, S.; Xiong, Y.; Gong, Y.; Wu, Y.; et al. Correction: Cai et al. Sex Reversal Induced by Dietary Supplementation with 17α-Methyltestosterone during the Critical Period of Sex Differentiation in Oriental River Prawn (Macrobrachium nipponense). Animals 2023, 13, 1369. Animals 2023, 13, 2489. https://doi.org/10.3390/ani13152489
Cai P, Yuan H, Gao Z, Daka P, Qiao H, Zhang W, Jiang S, Xiong Y, Gong Y, Wu Y, et al. Correction: Cai et al. Sex Reversal Induced by Dietary Supplementation with 17α-Methyltestosterone during the Critical Period of Sex Differentiation in Oriental River Prawn (Macrobrachium nipponense). Animals 2023, 13, 1369. Animals. 2023; 13(15):2489. https://doi.org/10.3390/ani13152489
Chicago/Turabian StyleCai, Pengfei, Huwei Yuan, Zijian Gao, Peter Daka, Hui Qiao, Wenyi Zhang, Sufei Jiang, Yiwei Xiong, Yongsheng Gong, Yan Wu, and et al. 2023. "Correction: Cai et al. Sex Reversal Induced by Dietary Supplementation with 17α-Methyltestosterone during the Critical Period of Sex Differentiation in Oriental River Prawn (Macrobrachium nipponense). Animals 2023, 13, 1369" Animals 13, no. 15: 2489. https://doi.org/10.3390/ani13152489
APA StyleCai, P., Yuan, H., Gao, Z., Daka, P., Qiao, H., Zhang, W., Jiang, S., Xiong, Y., Gong, Y., Wu, Y., Jin, S., & Fu, H. (2023). Correction: Cai et al. Sex Reversal Induced by Dietary Supplementation with 17α-Methyltestosterone during the Critical Period of Sex Differentiation in Oriental River Prawn (Macrobrachium nipponense). Animals 2023, 13, 1369. Animals, 13(15), 2489. https://doi.org/10.3390/ani13152489

