Molecular Identification of Enteric Viruses in Domestic Animals in Northeastern Gabon, Central Africa
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Sites and Sample Collection
2.2. RNA Extraction and Reverse Transcription
2.3. Enteric Virus Detection
2.4. Phylogenetic Analyses
3. Results
3.1. Detection of Astroviruses, Enteroviruses and Caliciviruses
3.2. Genetic Diversity of Astroviruses, Enteroviruses and Caliciviruses
4. Discussion
4.1. Astroviruses
4.2. Enteroviruses
4.3. Caliciviruses
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Slingenbergh, J.I.; Gilbert, M.; de Balogh, K.I.; Wint, W. Ecological sources of zoonotic diseases. Rev. Sci. Tech. 2004, 23, 467–484. [Google Scholar] [CrossRef] [PubMed]
- Jones, K.E.; Patel, N.G.; Levy, M.A.; Storeygard, A.; Balk, D.; Gittleman, J.L.; Daszak, P. Global trends in emerging infectious diseases. Nature 2008, 451, 990–993. [Google Scholar] [CrossRef] [PubMed]
- Taylor, L.H.; Latham, S.M.; Woolhouse, M.E. Risk factors for human disease emergence. Philos. Trans. R. Soc. London. Ser. B Biol. Sci. 2001, 356, 983–989. [Google Scholar] [CrossRef] [PubMed]
- Chowdhury, S.; Aleem, M.A.; Khan, M.S.I.; Hossain, M.E.; Ghosh, S.; Rahman, M.Z. Major zoonotic diseases of public health importance in Bangladesh. Vet. Med. Sci. 2021, 7, 1199–1210. [Google Scholar] [CrossRef] [PubMed]
- Han, B.A.; Kramer, A.M.; Drake, J.M. Global Patterns of Zoonotic Disease in Mammals. Trends Parasitol. 2016, 32, 565–577. [Google Scholar] [CrossRef]
- Elelu, N.; Aiyedun, J.O.; Mohammed, I.G.; Oludairo, O.O.; Odetokun, I.A.; Mohammed, K.M.; Bale, J.O.; Nuru, S. Neglected zoonotic diseases in Nigeria: Role of the public health veterinarian. Pan. Afr. Med. J. 2019, 32, 36. [Google Scholar] [CrossRef]
- Johnson, P.T.; de Roode, J.C.; Fenton, A. Why infectious disease research needs community ecology. Science 2015, 349, 1259504. [Google Scholar] [CrossRef]
- Morens, D.M.; Fauci, A.S. Emerging Pandemic Diseases: How We Got to COVID-19. Cell 2020, 183, 837. [Google Scholar] [CrossRef]
- Sparrer, M.N.; Hodges, N.F.; Sherman, T.; VandeWoude, S.; Bosco-Lauth, A.M.; Mayo, C.E. Role of Spillover and Spillback in SARS-CoV-2 Transmission and the Importance of One Health in Understanding the Dynamics of the COVID-19 Pandemic. J. Clin. Microbiol. 2023, 61, e01610-22. [Google Scholar] [CrossRef]
- Bosch, A. Human Viruses in Water: Perspectives in Medical Virology; Elsevier: Amsterdam, The Netherlands, 2007. [Google Scholar]
- Horstmann, D.M. Epidemiology of Poliomyelitis and Allied Diseases—1963. Yale J. Biol. Med. 1963, 36, 5–26. [Google Scholar]
- Bank-Wolf, B.R.; Konig, M.; Thiel, H.J. Zoonotic aspects of infections with noroviruses and sapoviruses. Vet. Microbiol. 2010, 140, 204–212. [Google Scholar] [CrossRef]
- Stamelou, E.; Giantsis, I.A.; Papageorgiou, K.V.; Petridou, E.; Davidson, I.; Polizopomicronulou, Z.S.; Papa, A.; Kritas, S.K. First report of canine Astrovirus and Sapovirus in Greece, hosting both asymptomatic and gastroenteritis symptomatic dogs. Virol. J. 2022, 19, 58. [Google Scholar] [CrossRef]
- Appleton, H.; Higgins, P.G. Letter: Viruses and gastroenteritis in infants. Lancet 1975, 1, 1297. [Google Scholar] [CrossRef]
- Bosch, A.; Pinto, R.M.; Guix, S. Human astroviruses. Clin. Microbiol. Rev. 2014, 27, 1048–1074. [Google Scholar] [CrossRef]
- Finkbeiner, S.R.; Allred, A.F.; Tarr, P.I.; Klein, E.J.; Kirkwood, C.D.; Wang, D. Metagenomic analysis of human diarrhea: Viral detection and discovery. PLoS Pathog. 2008, 4, e1000011. [Google Scholar] [CrossRef]
- Finkbeiner, S.R.; Holtz, L.R.; Jiang, Y.; Rajendran, P.; Franz, C.J.; Zhao, G.; Kang, G.; Wang, D. Human stool contains a previously unrecognized diversity of novel astroviruses. Virol. J. 2009, 6, 161. [Google Scholar] [CrossRef]
- Kapoor, A.; Li, L.; Victoria, J.; Oderinde, B.; Mason, C.; Pandey, P.; Zaidi, S.Z.; Delwart, E. Multiple novel astrovirus species in human stool. J. Gen. Virol. 2009, 90 Pt 12, 2965–2972. [Google Scholar] [CrossRef]
- International Committee on Taxonomy of Viruses Executive Committee. The new scope of virus taxonomy: Partitioning the virosphere into 15 hierarchical ranks. Nat. Microbiol. 2020, 5, 668–674. [Google Scholar] [CrossRef]
- Kalter, S.S. Enteric viruses of nonhuman primates. Vet. Pathol. 1982, 7, 33–43. [Google Scholar] [CrossRef]
- Mombo, I.M.; Lukashev, A.N.; Bleicker, T.; Brunink, S.; Berthet, N.; Maganga, G.D.; Durand, P.; Arnathau, C.; Boundenga, L.; Ngoubangoye, B.; et al. African Non-Human Primates Host Diverse Enteroviruses. PLoS ONE 2017, 12, e0169067. [Google Scholar] [CrossRef]
- Nix, W.A.; Jiang, B.; Maher, K.; Strobert, E.; Oberste, M.S. Identification of enteroviruses in naturally infected captive primates. J. Clin. Microbiol. 2008, 46, 2874–2878. [Google Scholar] [CrossRef] [PubMed]
- Oberste, M.S.; Jiang, X.; Maher, K.; Nix, W.A.; Jiang, B. The complete genome sequences for three simian enteroviruses isolated from captive primates. Arch. Virol. 2008, 153, 2117–2122. [Google Scholar] [CrossRef] [PubMed]
- Gür, S.; Gürçay, M.; Seyrek, A. A study regarding bovine enterovirus type 1 infection in domestic animals and humans: An evaluation from the zoonotic aspect. J. Vet. Med. Sci. 2019, 81, 1824–1828. [Google Scholar] [CrossRef] [PubMed]
- Clarke, I.; Estes, M.; Green, K.; Hansman, G.; Knowles, N.; Koopmans, M.; Matson, D.; Meyers, G.; Neill, J.; Radford, A. Caliciviridae, p 977–986. In Virus Taxonomy: Classification and Nomenclature of Viruses: Ninth Report of the International Committee on Taxonomy of Viruses; Elsevier: San Diego, CA, USA, 2012. [Google Scholar]
- Desselberger, U. Caliciviridae Other Than Noroviruses. Viruses 2019, 11, 286. [Google Scholar] [CrossRef]
- Smith, A.W.; Skilling, D.E.; Cherry, N.; Mead, J.H.; Matson, D.O. Calicivirus emergence from ocean reservoirs: Zoonotic and interspecies movements. Emerg. Infect. Dis. 1998, 4, 13–20. [Google Scholar] [CrossRef]
- Mahy, B.W.; Van Regenmortel, M.H. Desk Encyclopedia of Human and Medical Virology; Academic Press: Cambridge, MA, USA, 2010. [Google Scholar]
- Mombo, I.M.; Boundenga, L.; Suquet, E.; Ngoubangoye, B.; Maganga, G.D.; Leroy, E.M.; Charpentier, M.J.; Rougeron, V. Natural infection of free-ranging mandrills (Mandrillus sphinx) by enteroviruses and astroviruses in southern Gabon. Microb. Pathog. 2021, 150, 104659. [Google Scholar] [CrossRef]
- Jiang, X.; Huang, P.W.; Zhong, W.M.; Farkas, T.; Cubitt, D.W.; Matson, D.O. Design and evaluation of a primer pair that detects both Norwalk- and Sapporo-like caliciviruses by RT-PCR. J. Virol. Methods 1999, 83, 145–154. [Google Scholar] [CrossRef]
- Chu, D.K.; Poon, L.L.; Guan, Y.; Peiris, J.S. Novel astroviruses in insectivorous bats. J. Virol. 2008, 82, 9107–9114. [Google Scholar] [CrossRef]
- Nix, W.A.; Oberste, M.S.; Pallansch, M.A. Sensitive, seminested PCR amplification of VP1 sequences for direct identification of all enterovirus serotypes from original clinical specimens. J. Clin. Microbiol. 2006, 44, 2698–2704. [Google Scholar] [CrossRef]
- Oberste, M.S.; Maher, K.; Flemister, M.R.; Marchetti, G.; Kilpatrick, D.R.; Pallansch, M.A. Comparison of classic and molecular approaches for the identification of untypeable enteroviruses. J. Clin. Microbiol. 2000, 38, 1170–1174. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef]
- Dereeper, A.; Guignon, V.; Blanc, G.; Audic, S.; Buffet, S.; Chevenet, F.; Dufayard, J.F.; Guindon, S.; Lefort, V.; Lescot, M.; et al. Phylogeny.fr: Robust phylogenetic analysis for the non-specialist. Nucleic Acids Res. 2008, 36, W465–W469. [Google Scholar] [CrossRef]
- Pfaff, F.; Schlottau, K.; Scholes, S.; Courtenay, A.; Hoffmann, B.; Hoper, D.; Beer, M. A novel astrovirus associated with encephalitis and ganglionitis in domestic sheep. Transbound. Emerg. Dis. 2017, 64, 677–682. [Google Scholar] [CrossRef]
- Ng, T.F.; Kondov, N.O.; Deng, X.; Van Eenennaam, A.; Neibergs, H.L.; Delwart, E. A metagenomics and case-control study to identify viruses associated with bovine respiratory disease. J. Virol. 2015, 89, 5340–5349. [Google Scholar] [CrossRef]
- Weissenbock, H.; Ebinger, A.; Gager, A.M.; Thaller, D.; Hoper, D.; Lichtmannsperger, K.; Weissenbacher-Lang, C.; Matt, J.; Beer, M. A novel enterovirus in lambs with poliomyelitis and brain stem encephalitis. Transbound. Emerg. Dis. 2022, 69, 227–234. [Google Scholar] [CrossRef]
- Binn, L.N.; Norby, E.A.; Marchwicki, R.H.; Jarman, R.G.; Keiser, P.B.; Hang, J. Canine caliciviruses of four serotypes from military and research dogs recovered in 1963-1978 belong to two phylogenetic clades in the Vesivirus genus. Virol. J. 2018, 15, 39. [Google Scholar] [CrossRef]
- Rougeron, V.; Suquet, E.; Maganga, G.D.; Jiolle, D.; Mombo, I.M.; Bourgarel, M.; Motsch, P.; Arnathau, C.; Durand, P.; Drexler, F.; et al. Characterization and phylogenetic analysis of new bat astroviruses detected in Gabon, Central Africa. Acta Virol. 2016, 60, 386–392. [Google Scholar] [CrossRef]
- Mombo, I.M.; Suquet, E.; Boundenga, L.; Mveang-Nzoghe, A.; Maganga-Mboga, C.; Arnathau, C.; Sidobre, C.; Leroy, E.M.; Rougeron, V. Detection of novel astroviruses among rodents of Gabon, Central Africa. Infect. Genet. Evol. 2019, 68, 43–46. [Google Scholar] [CrossRef]
- Wang, J.; Xu, C.; Zeng, M.; Tang, C. Diversity of Astrovirus in Goats in Southwest China and Identification of Two Novel Caprine Astroviruses. Microbiol. Spectr. 2022, 10, e0121822. [Google Scholar] [CrossRef]
- Boros, A.; Pankovics, P.; Knowles, N.J.; Reuter, G. Natural interspecies recombinant bovine/porcine enterovirus in sheep. J. Gen. Virol. 2012, 93, 1941–1951. [Google Scholar] [CrossRef]
- Chang, X.; Lin, Q.; Zhang, Q.; Hu, J.; Tursun, G.; Deng, Y.; Guo, C.; Wang, X. Molecular Analysis of Caprine Enterovirus Circulating in China during 2016–2021: Evolutionary Significance. Viruses 2022, 14, 1051. [Google Scholar] [CrossRef] [PubMed]
- Oberste, M.S.; Maher, K.; Nix, W.A.; Michele, S.M.; Uddin, M.; Schnurr, D.; al-Busaidy, S.; Akoua-Koffi, C.; Pallansch, M.A. Molecular identification of 13 new enterovirus types, EV79-88, EV97, and EV100-101, members of the species Human Enterovirus B. Virus Res. 2007, 128, 34–42. [Google Scholar] [CrossRef] [PubMed]
- Apostol, L.N.; Imagawa, T.; Suzuki, A.; Masago, Y.; Lupisan, S.; Olveda, R.; Saito, M.; Omura, T.; Oshitani, H. Genetic diversity and molecular characterization of enteroviruses from sewage-polluted urban and rural rivers in the Philippines. Virus Genes 2012, 45, 207–217. [Google Scholar] [CrossRef] [PubMed]
- Khetsuriani, N.; Helfand, R.; Pallansch, M.; Kew, O.; Fowlkes, A.; Oberste, M.S.; Tukei, P.; Muli, J.; Makokha, E.; Gary, H. Limited duration of vaccine poliovirus and other enterovirus excretion among human immunodeficiency virus infected children in Kenya. BMC Infect. Dis. 2009, 9, 136. [Google Scholar] [CrossRef]
- Duong, V.; Mey, C.; Eloit, M.; Zhu, H.; Danet, L.; Huang, Z.; Zou, G.; Tarantola, A.; Cheval, J.; Perot, P.; et al. Molecular epidemiology of human enterovirus 71 at the origin of an epidemic of fatal hand, foot and mouth disease cases in Cambodia. Emerg. Microbes Infect. 2016, 5, e104. [Google Scholar] [CrossRef]
- Han, Z.; Zhang, Y.; Huang, K.; Cui, H.; Hong, M.; Tang, H.; Song, Y.; Yang, Q.; Zhu, S.; Yan, D.; et al. Genetic characterization and molecular epidemiological analysis of novel enterovirus EV-B80 in China. Emerg. Microbes Infect. 2018, 7, 193. [Google Scholar] [CrossRef]
- Rao, C.D.; Yergolkar, P.; Shankarappa, K.S. Antigenic diversity of enteroviruses associated with nonpolio acute flaccid paralysis, India, 2007–2009. Emerg. Infect. Dis. 2012, 18, 1833–1840. [Google Scholar] [CrossRef]
- Lundgren, D.L.; Sanchez, A.; Magnuson, M.G.; Clapper, W.E. A survey for human enteroviruses in dogs and man. Enterovirus survey. Arch. Gesamte Virusforsch. 1970, 32, 229–235. [Google Scholar] [CrossRef]
- Waldman, E.A.; Moreira, R.C.; Saez, S.G.; Souza, D.F.; Carmona Rde, C.; Takimoto, S.; Cortes Vde, A. Human enterovirus infection in stray dogs. Some aspects of interest to public health. Rev. Inst. Med. Trop. São Paulo 1996, 38, 157–161. [Google Scholar] [CrossRef]
- Luchs, A.; Leal, E.; Tardy, K.; Milagres, F.A.P.; Komninakis, S.V.; Brustulin, R.; Teles, M.; Lobato, M.; das Chagas, R.T.; Abrao, M.; et al. The rare enterovirus c99 and echovirus 29 strains in Brazil: Potential risks associated to silent circulation. Mem. Inst. Oswaldo Cruz 2019, 114, e190160. [Google Scholar] [CrossRef]
- Bessaud, M.; Joffret, M.L.; Holmblat, B.; Razafindratsimandresy, R.; Delpeyroux, F. Genetic relationship between cocirculating Human enteroviruses species C. PLoS ONE 2011, 6, e24823. [Google Scholar] [CrossRef]
- Mombo, I.M.; Berthet, N.; Lukashev, A.N.; Bleicker, T.; Brunink, S.; Leger, L.; Atencia, R.; Cox, D.; Bouchier, C.; Durand, P.; et al. First Detection of an Enterovirus C99 in a Captive Chimpanzee with Acute Flaccid Paralysis, from the Tchimpounga Chimpanzee Rehabilitation Center, Republic of Congo. PLoS ONE 2015, 10, e0136700. [Google Scholar] [CrossRef]
- Oberste, M.S.; Feeroz, M.M.; Maher, K.; Nix, W.A.; Engel, G.A.; Hasan, K.M.; Begum, S.; Oh, G.; Chowdhury, A.H.; Pallansch, M.A.; et al. Characterizing the picornavirus landscape among synanthropic nonhuman primates in Bangladesh, 2007 to 2008. J. Virol. 2013, 87, 558–571. [Google Scholar] [CrossRef]
- Tao, Z.; Cui, N.; Liu, G.; Chen, P.; Xu, A.; Song, L.; Ji, F.; Wang, H.; Song, Y. Complete genome sequence of an enterovirus 80 strain isolated in China. J. Virol. 2012, 86, 13129–13130. [Google Scholar] [CrossRef][Green Version]
- Sadeuh-Mba, S.A.; Kavunga-Membo, H.; Joffret, M.L.; Yogolelo, R.; Endegue-Zanga, M.C.; Bessaud, M.; Njouom, R.; Muyembe-Tamfu, J.J.; Delpeyroux, F. Genetic landscape and macro-evolution of co-circulating Coxsackieviruses A and Vaccine-derived Polioviruses in the Democratic Republic of Congo, 2008–2013. PLoS Negl. Trop. Dis. 2019, 13, e0007335. [Google Scholar] [CrossRef]
- Evermann, J. Isolation of a calicivirus from a case of canine glossitis. Canine Pract. 1981, 8, 36–39. [Google Scholar]
- Smith, A.W.; Iversen, P.L.; Skilling, D.E.; Stein, D.A.; Bok, K.; Matson, D.O. Vesivirus viremia and seroprevalence in humans. J. Med. Virol. 2006, 78, 693–701. [Google Scholar] [CrossRef]
- Svraka, S.; Duizer, E.; Egberink, H.; Dekkers, J.; Vennema, H.; Koopmans, M. A new generic real-time reverse transcription polymerase chain reaction assay for vesiviruses; vesiviruses were not detected in human samples. J. Virol. Methods 2009, 157, 1–7. [Google Scholar] [CrossRef]




| Target Virus Name | Gene | Primer Name | Primer Sequence (5′-3′) | Size | References |
|---|---|---|---|---|---|
| Astrovirus | RdRp | FWD1 | GARTTYGATTGGRCKCGKTAYGA | 422 bp | [31] |
| FWD2 | GARTTYGATTGGRCKAGGTAYGA | ||||
| RVS1 | GGYTTKACCCACATNCCRAA | ||||
| FWD3 | CGKTAYGATGGKACKATHCC | ||||
| FWD4 | AGGTAYGATGGKACKATHCC | ||||
| Calicivirus | RdRP | P289 | TGACAATGTAATCATCACCATA | 319–331 bp | [30] |
| P290 | GATTACTCCAAGTGGGACTCCAC | ||||
| Enterovirus | VP1 | 222 | CICCIGGIGGIAYRWACAT | 371 bp | [32,33] |
| 224 | GCIATGYTIGGIACICAYRT | ||||
| AN88 | TACTGGACCACCTGGBGGNAYRWACAT | ||||
| AN89 | CCAGCACTGACAGCAGYNGARAYNGG |
| Road | Village | Astroviruses Positive/Tested | Enteroviruses Positive/Tested | Caliciviruses Positive/Tested | ||||||
|---|---|---|---|---|---|---|---|---|---|---|
| Goats | Sheep | Dogs | Goats | Sheep | Dogs | Goats | Sheep | Dogs | ||
| Mekambo - Mazingo | Etakangaye | 2/18 | - | 0/1 | 0/18 | - | 0/1 | 0/18 | - | 0/1 |
| Imbong | 1/16 | 0/5 | 0/13 | 0/16 | 0/5 | 0/13 | 0/16 | 0/5 | 1/13 | |
| Ibéa | - | - | 0/2 | - | - | 0/2 | - | - | 0/2 | |
| Zoula | 5/9 | 0/6 | 0/11 | 0/9 | 0/6 | 1/11 | 0/9 | 0/6 | 0/11 | |
| Grand-Etoumbi | 0/8 | 0/13 | 0/18 | 0/8 | 0/13 | 0/18 | 0/8 | 0/13 | 0/18 | |
| Mekambo - Ekata | Mékouma | - | - | 0/7 | - | - | 0/7 | - | - | 0/7 |
| Ntolo | 4/18 | 0/2 | 0/21 | 0/18 | 2/2 | 0/21 | 0/18 | 0/2 | 0/21 | |
| Mendemba | 3/26 | - | - | 2/26 | - | - | 0/26 | - | - | |
| Ilahounènè | 2/8 | 0/8 | 0/2 | 0/8 | 0/8 | 0/2 | 0/8 | 0/8 | 0/2 | |
| Ekata | 0/20 | 0/7 | 0/1 | 0/20 | 0/7 | 0/1 | 0/20 | 0/7 | 0/1 | |
| Total | 17/123 | 0/41 | 0/76 | 2/123 | 2/41 | 1/76 | 0/123 | 0/41 | 1/76 | |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bohou Kombila, L.; N’dilimabaka, N.; Garcia, D.; Rieu, O.; Engone Ondo, J.D.; Ndong Mebaley, T.; Boundenga, L.; Fritz, M.; Lenguiya, L.H.; Maganga, G.D.; et al. Molecular Identification of Enteric Viruses in Domestic Animals in Northeastern Gabon, Central Africa. Animals 2023, 13, 2512. https://doi.org/10.3390/ani13152512
Bohou Kombila L, N’dilimabaka N, Garcia D, Rieu O, Engone Ondo JD, Ndong Mebaley T, Boundenga L, Fritz M, Lenguiya LH, Maganga GD, et al. Molecular Identification of Enteric Viruses in Domestic Animals in Northeastern Gabon, Central Africa. Animals. 2023; 13(15):2512. https://doi.org/10.3390/ani13152512
Chicago/Turabian StyleBohou Kombila, Linda, Nadine N’dilimabaka, Déborah Garcia, Océane Rieu, Jéordy Dimitri Engone Ondo, Telstar Ndong Mebaley, Larson Boundenga, Matthieu Fritz, Léadisaelle Hosanna Lenguiya, Gael Darren Maganga, and et al. 2023. "Molecular Identification of Enteric Viruses in Domestic Animals in Northeastern Gabon, Central Africa" Animals 13, no. 15: 2512. https://doi.org/10.3390/ani13152512
APA StyleBohou Kombila, L., N’dilimabaka, N., Garcia, D., Rieu, O., Engone Ondo, J. D., Ndong Mebaley, T., Boundenga, L., Fritz, M., Lenguiya, L. H., Maganga, G. D., Leroy, E. M., Becquart, P., & Mombo, I. M. (2023). Molecular Identification of Enteric Viruses in Domestic Animals in Northeastern Gabon, Central Africa. Animals, 13(15), 2512. https://doi.org/10.3390/ani13152512

