Next Article in Journal
Trace Amounts of Ranavirus Detected in Common Musk Turtles (Sternotherus odoratus) at a Site Where the Pathogen Was Previously Common
Next Article in Special Issue
Epidemiology of Bovine Hemorrhagic Bowel Syndrome in Belgium and The Netherlands
Previous Article in Journal
The Functional Roles of Methionine and Arginine in Intestinal and Bone Health of Poultry: Review
Previous Article in Special Issue
The Association between Prepartum Rumination Time, Activity and Dry Matter Intake and Subclinical Hypocalcemia and Hypomagnesemia in the First 3 Days Postpartum in Holstein Dairy Cows
error_outline You can access the new MDPI.com website here. Explore and share your feedback with us.
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

β-Hydroxybutyrate Effects on Bovine Caruncular Epithelial Cells: A Model for Investigating the Peri-Implantation Period Disruption in Ketotic Dairy Cows

by
Carolin Hildebrand
1,
Julia Hollenbach
1,
Bettina Seeger
2 and
Christiane Pfarrer
1,*
1
Institute of Anatomy, University of Veterinary Medicine Hannover Foundation, Bischofsholer Damm 15, 30173 Hanover, Germany
2
Research Group Food Toxicology and Alternative/Complementary Methods to Animal Experiments, Institute for Food Quality and Safety, University of Veterinary Medicine Hannover Foundation, Bischofsholer Damm 15, 30173 Hannover, Germany
*
Author to whom correspondence should be addressed.
Animals 2023, 13(18), 2950; https://doi.org/10.3390/ani13182950
Submission received: 21 August 2023 / Revised: 8 September 2023 / Accepted: 11 September 2023 / Published: 18 September 2023
(This article belongs to the Collection High-Yielding Dairy Cows)

Abstract

:

Simple Summary

In high-yielding dairy cows, the successful establishment of pregnancy is of great economic importance. If a new pregnancy does not occur shortly after parturition, this can mean early culling for the animal. Due to today’s breeding, cattle show higher milk yields, but pregnancy rates continue to decline. In addition to genetic dispositions, metabolic diseases, such as ketosis, are particularly relevant here. In this in vitro study, bovine uterine cells were stimulated with the main ketone body β-Hydroxybutyrate. The influence of β-Hydroxybutyrate on uterine cell function, inflammatory state and important genes for successful implantation was investigated. These genes include cell adhesion molecules and prostaglandins. High concentrations of β-Hydroxybutyrate negatively affected cell function and induced an inflammatory response in the cells. These results provide a possible explanation for the poor reproductive performance of ketotic dairy cows. Due to the reduced cell function as well as inflammatory response, the finely regulated feto-maternal communication during early pregnancy might be disturbed.

Abstract

Ketosis is a metabolic disorder arising from a negative energy balance (NEB). It is characterized by high β-Hydroxybutyrate (BHBA) blood levels and associated with reduced fertility in dairy cows. To investigate the impact of BHBA on bovine caruncular epithelial cells (BCEC) in vitro, these cells were stimulated with different concentrations of BHBA. Cell metabolism and motility were examined using an MTT assay and Live-cell imaging. RT-qPCR was used to examine mRNA expressions of TNF, IL6, RELA, prostaglandin E2 synthase (PTGES2) and receptor (PTGER2) as well as integrin subunits ITGAV, ITGA6, ITGB1 and ITGB3. Stimulation with 1.8 and 2.4 mM of BHBA negatively affected cell metabolism and motility. TNF showed increased mRNA expression related to rising BHBA concentrations. IL6, RELA, ITGAV, ITGA6, ITGB1 and ITGB3 as well as PTGER2 showed no changes in mRNA expression. Stimulation with 0.6 and 1.2 mM of BHBA significantly increased the mRNA expression of PTGES2. This does not indicate a negative effect on reproductive performance because low BHBA concentrations are found in steady-state conditions. However, the results of the study show negative effects of high BHBA concentrations on the function of BCECs as well as an inflammatory response. This could negatively affect the feto-maternal communication during the peri-implantation period in ketotic dairy cows.

1. Introduction

In high-yielding dairy cows, a negative energy balance (NEB) often appears during the transition period, spanning from three weeks pre calving until three weeks post calving [1]. Late gestation, parturition, and the onset of lactogenesis require a high amount of energy, with a simultaneous reduction in feed intake [2,3]. During this time, many metabolic adaptions are required, and genetic dispositions as well as environmental factors and infections can lead to a metabolic imbalance [4]. A very common disease resulting from maladaptation to NEB is ketosis [3,5]. It is characterized by increased blood levels of ketone bodies, whereas β-Hydroxybutyrate (BHBA) is the most frequent one [6,7,8]. BHBA is synthesized from acetyl-CoA in the mitochondria of the liver during high rates of lipolysis [9]. Depending on the literature, the threshold value of BHBA blood concentration for ketosis is between >1.2 mM and ≥1.4 mM [7,8,10]. Cattle affected by NEB and elevated BHBA blood concentrations show an increased prevalence of mastitis, lameness, metritis, reduced milk yield and poor reproductive performance [11,12,13,14].
BHBA is a versatile molecule [15,16]. In the organism, it can be used as an alternative energy source by many tissues (reviewed by [15,16]). For cells, various effects of BHBA are described in the literature. On the one hand, BHBA promotes cell viability and cell metabolism, and on the other hand, it promotes the expression of anti-proliferative and proapoptotic genes via inhibition of histone deacetylation [16,17,18,19,20]. This mechanism is also called the “butyrate paradoxon” (reviewed by [21]), which, after Donohoe et al. [20], can be explained by the “Warburg effect”. In cancer cells that obtain their energy mainly by aerobic glycolysis and not by oxidative metabolism, BHBA is metabolized inefficiently and accumulates in the nucleus. This results in an increased inhibition of histone deacetylation and may inhibit cell proliferation. In contrast, BHBA has a growth-promoting effect when used as an oxidative energy source in normal cells [20]. Furthermore, in bovine hepatocytes and endometrial cells, BHBA causes an inflammatory response by inducing oxidative stress and activation of the nuclear factor-kappa B (NF-κB) signalling pathway in vitro. The expression of cytokines such as interleukin-6 (IL6) and tumour necrosis factor α (TNF) is increased in these cells [22,23]. In addition, in vivo studies also observed an inflammatory response in ketotic cows. Affected animals show elevated blood levels of proinflammatory factors and increased expression of Toll-like receptors 2 and 4 as well as increased phosphorylation levels of NF-kb p65 in neutrophil granulocytes [24,25,26,27]. At the same time, the likelihood of pregnancy is significantly reduced in cows diagnosed with ketosis compared to healthy animals [11].
Although poor reproductive performance in cows suffering from ketosis may affect all stages of the reproductive cycle, early pregnancy is a well-known critical period [28]. It is defined as the period until day 28 post insemination and is characterized by embryonic maturation from the blastocyst through the elongation stage up to implantation [28,29]. During this time, 70–80% of the abortions take place [30], and the main reasons are genetic abnormalities, premature luteolysis and asynchronous feto-maternal communication [31,32,33]. In cows, the semiplacenta multiplex seu cotyledonaria consists of fetal cotyledons interdigitating with maternal caruncles. The caruncles are located in the lumen, coated by caruncular epithelial cells and represent the glandless surface for feto-maternal exchange [34]. For successful pregnancy establishment, a precise regulation of gene expression in cells involved in the implantation process is of great importance. The cytokine Interferon-τ is the pregnancy recognition signal of the ruminants [35], but also, other cytokines like IL6, IL1 and the leukemia inhibitory factor (LIF) are involved in the implantation process of mammals and promote embryonic development [36]. In addition to cytokines, the prostaglandin F2α (PGF2α) and prostaglandin E2 (PGE2) are important regulators during early pregnancy. While PGF2α activates luteolysis, PGE2 promotes the secretion of gonadotropins, which support the formation and maintenance of the corpus luteum [37,38,39]. Furthermore, PGE2 supports the hatching of the blastocyst from the zona pellucida, and it is involved in ovulation and early implantation [40,41]. Besides playing an important role in reproductive mechanisms, prostaglandins are also involved in inflammatory processes [42].
Other key players during implantation are transmembrane proteins called integrins. Through their cell-to-cell as well as cell-to-extracellular matrix binding, they act as mediators of cell communication and are important for the maintenance of physiological cell functions [43]. In sheep, which like cattle have a synepitheliochorial placenta, the integrin αvβ3 plays a crucial role in implantation. Here, the progesterone-mediated extracellular matrix protein osteopontin acts as a binding partner for the integrin αvβ3 and promotes the adhesion and migration of the trophoblast to the uterine luminal epithelium [44]. In other species, the integrin subunits αv and β3 are important requirements for implantation in the endometrium [45,46,47]. In cattle, these integrin subunits were also detected at the endometrium [48]. A cycle-dependent and implantation-associated change in the expression pattern of integrins was also observed in the bovine uterus [49,50]. During the implantation window, mainly the subunits α1, α3 and α6 are expressed [50]. In a study of trophoblast giant cell migration, the feto-maternal connection is assumed to be mediated through laminin and the integrin α6β1 [48]. Another in vitro study on bovine endometrial cells pointed out that laminin and the integrin α6β1 are expressed in placentomes of cattle [51].
The hypothesis of the present study is that BHBA, as a marker of ketosis, disrupts bovine caruncular epithelial cell (BCEC) physiology and gene expression patterns, and thereby, impairs the sensitively regulated peri-implantation period. To test this hypothesis, BCECs were stimulated with different concentrations of BHBA, and the viability of the cells was examined by analysing motility and metabolism. Furthermore, the influence of BHBA on the mRNA expression of inflammatory markers (IL6, TNF and RELA (gene encoding for NF-κB p65)), the prostaglandin E2 synthase (PTGES2) and receptor (PTGER2) and different integrin subunits (ITGAV, ITGA6, ITGB1 and ITGB3) was examined. The results may elucidate pathomechanisms to explain poor reproductive performance associated with NEB in high-yielding dairy cows.

2. Materials and Methods

2.1. Cell Culture

The established and characterized BCEC line [52] was used in the study. BCECs were isolated from maternal placentomes of a pregnant cow [52]. Cells were stored in cryotubes at −150 °C at the Institute for Anatomy, University of Veterinary Medicine Hannover, Foundation, Germany. For cultivation, cells were thawed and seeded into T75 flasks (TPP Techno Plastic Products AG, Transadingen, Switzerland) filled with Dulbecco’s Modified Eagle Medium (DMEM)/Ham’s F12 (Sigma-Aldrich® Chemie GmbH, Taufkirchen, Germany). DMEM was supplemented with 10% fetal calf serum (FCS) (Biochrom, Berlin, Germany), Penicillin (100 µU/mL, PAA, Coelbe, Germany), Streptomycin (2 µg/mL, PAA, Coelbe, Germany) and L-Glutamine (2 mM, PAA, Coelbe, Germany). This culture medium will be called full medium (FM) in the following. Cells were cultivated in an incubator at 5% CO2 and 37 °C, and culture medium was replaced every other day. Subculturing was performed at 90% confluency via trypsinisation for 5 min at 5% CO2 and 37 °C using 0.5% Trypsin (Sigma-Aldrich® Chemie GmbH, Taufkirchen, Germany) in PEM (EDTA 2 mM in phosphate-buffered saline (PBS)). For the experiments, cells were prepared individually. More detailed information will follow in the respective chapters. Cells between cell passage 18 and 32 were used in the experiments.

2.2. Stimulation of BCECs with BHBA

Stimulation was started when the cells reached a confluence of about 70%. FM was replaced by serum-reduced medium (SR), with 1% FCS and the same amount of Penicillin, Streptomycin and L-Glutamine added to the DMEM, as in FM, and incubated for 3 h before stimulation with different BHBA concentrations. To prepare a 20 mM BHBA stock solution, 63.045 mg of BHBA powder (Sigma-Aldrich® Chemie GmbH, Taufkirchen, Germany) was dissolved in 25 mL of distilled water. Subsequently, the stock solution was sterile filtered and stored at −20 °C. For the stimulation experiments, the stock solution was diluted in SR. The following concentrations were used: 0.6, 1.2, 1.8 and 2.4 mM of BHBA and stimulations were carried out for 24 or 36 h (cell metabolism).

2.3. Cell Metabolism (MTT Assay)

Cell metabolism was examined via MTT assay according to Mossman [53]. In this process, a water-soluble yellow dye is converted by the cells into violet crystals, the formazan salt. These crystals cannot pass the cell membrane and stay intracellular. BCECs were seeded into a 96-well plate (TPP Techno Plastic Products AG, Transadingen, Switzerland) at a cell number of 1 × 104 cells/well and cultured in FM for 24 h. After stimulation of BCECs for 24 and 36 h, 5 mg of MTT (3-(4,5-dimethylthiazol-2-yl)-2.5-diphenyltetrazoliumbromid; Carl Roth GmbH, Karlsruhe, Germany)-reagent was dissolved in 5 mL of PBS. This solution was diluted 1:10 in SR and applied to the cells. After 2.5 h of incubation, MTT-reagent was removed and Dimethylsulfoxide (DMSO, Carl Roth GmbH, Karlsruhe, Germany) was added to the BCECs. Subsequently, the optical density was determined using an ELISA-Reader (Thermo Fisher Scientific, Waltham, MA, USA). The extinction was measured at 550 nm (sample absorbance) and 690 nm (background absorbance). The experiment was repeated fourteen times, and for each stimulation group, between 177 and 199 values were captured, whereby values of wells were eradicated if BCECs detached during stimulation. During the MTT run for 36 h, between 181 and 198 values were collected for each stimulation group.

2.4. Cell Motility (Live-Cell Imaging)

Cell motility was examined via Live-cell imaging. For this purpose, 8 × 104 cells/well were seeded into a 12-well plate (Sarstedt AG& Co. KG, Nürnbrecht, Germany) and cultured in FM for 24 h. After cultivation, BHBA was added to the BCECs, and the cells were transferred to the incubation chamber of a Cell Observer System (Zeiss, Jena, Germany). A picture of the BCECs was taken every 20 min at two representative areas of each well during the 24 h of stimulation period. The analysis of the accumulated distance was carried out through manual tracking of 20 cells per determined area using the chemotaxis tool of the ImageJ program [54]. The experiment was repeated four times, and for each stimulation group, 320 distances were determined.

2.5. RNA Isolation, cDNA Synthesis and Quantitative Real-Time PCR

For the BHBA stimulation, 5.5 × 105 cells/mL were seeded in 6 mm cell culture dishes (TPP Techno Plastic Products AG, Transadingen, Switzerland) and grew to a confluence of 60–70%. After stimulation with BHBA, cells were harvested, and RNA was extracted using the NucleoSpin® RNA and Protein purification kit (Macherey-Nagel GmbH & Co., KG, Düren, Germany) according to the supplier’s manual. The RNA concentration was analysed by determining the optical density with a spectrophotometer (DeNovix® DS-11 Spectrophotometer, DeNovix Inc., Wilmington, NC, USA) at 260 nm. Additionally, the purity of the RNA samples was determined by the absorption quotients of 260/280 nm and 260/230 nm. Only samples with an ideal ratio at 2.0–2.2, respectively [55], were used in the further experiments. For cDNA synthesis, the GoScript™ Reverse Transcriptase System (Promega GmbH, Mannheim, Germany) was used according to the manufacture’s introductions. For a cDNA concentration of 50 ng/µL, 1 µg of total RNA in a 20 µL reaction volume was used. The success of cDNA synthesis was confirmed with a conventional standard PCR using primers of the reference genes ACTB or GAPDH. Afterwards, the expression levels of the mRNA were quantified using quantitative Real-Time PCR (RT-qPCR). Primers were designed with the PrimerBLAST software from the National Center for Biotechnology Information (NCBI) (accessed on 3 and 19 January 2022) and purchased from Microsynth AG (Balgach, Switzerland) or are already published in the previous literature. Before use in RT-qPCR, the most appropriate master mix for each primer pair was chosen. The different master mix compositions are shown in Table 1. Afterwards, the efficiency of each primer pair was determined using the standard curve method with seven dilution steps of a 1:2 dilution series. Only primers with an amplification efficiency between 90–110% were used in the RT-qPCR. Detailed information of the primers is shown in Table 2. For the preparation of the reaction mix, cDNA was diluted with nuclease-free water to a final concentration of 5 ng/µL, and 4 µL of the cDNA was mixed with the reaction components containing SYBR® Green as the fluorescent dye (Applied biosystems, Waltham, MA, USA) (Table 1). For each primer pair, a negative control was implemented, containing nuclease-free water instead of cDNA. A Stratagene Mx3000P (Aglient Technologies, Waldbronn, Germany) RT-qPCR cycler with the following cycling program was used: first, it was heated to 95 °C for polymerase activation; second, there were 40 cycles for amplification, whereby each cycle consisted of 15 s of 95 °C (denaturation) and 60 s of 60 °C (annealing and extension), with fluorescence detection during the annealing and extension step. Subsequently, a melting curve analysis consisting of 15 s of 95 °C, a 60 min temperature increase up to 95 °C in 0.3 °C steps and lastly holding for 15 min at 95 °C were conducted. Each stimulation experiment was repeated six times with all samples analysed in duplicates. The ΔΔCt method was used for relative mRNA quantification using ACTB and GAPDH as reference genes and the control group SR as the untreated sample.

2.6. Statistical Analysis

Statistical analysis was performed using “The R Project for Statistical Computing” (version 4.2.0). For the statistical analysis, the arithmetic mean values and standard deviations were first determined using descriptive statistics. Subsequently, the Shapiro–Wilk-test was performed to test whether the data were normally distributed. If the data were not normally distributed, the non-parametric Kruskall–Wallis test was used. In case of significant results, the Dunn test with Bonferroni correction was performed as a post hoc test. For normally distributed data, a one-way ANOVA was used, followed by Tukey’s HSD test with Bonferroni correction. In cases of inhomogeneous variance, the Games–Howell test was used instead. The level of significance was set at 5%.

3. Results

3.1. Effects of BHBA on the Metabolism and Motility of the BCEC

As illustrated in Figure 1a, the 24 h BHBA stimulation period affected the metabolism of the BCEC significantly. The metabolism was significantly reduced in the 2.4 mM BHBA stimulation group by an average of 5.82% compared to the control group (p = 0.044). Extension of the stimulation time up to 36 h significantly reduced cell metabolism by 8.47% in the 2.4 mM BHBA stimulation group compared to the control group (p = 0.024, Figure 1b).
As shown in Figure 1c, motility in BCEC was significantly reduced by 26.59% during 24 h of stimulation with 2.4 mM of BHBA (p < 0.001). The 24 h stimulation with 1.8 mM of BHBA also showed a significant decrease in cell motility by 26.85% (p < 0.001).

3.2. Effects of BHBA on the Gene Expression of IL6, RELA and TNF

The data of the mRNA expression of the cytokines are illustrated in Figure 2. The mRNA expressions of IL6 and RELA were not altered by BHBA stimulation (Figure 2a,b). In contrast, TNF showed a significant increase in mRNA expression related to higher BHBA concentrations (Figure 2c). The experimental group stimulated with 0.6 mM of BHBA showed an increased TNF mRNA expression of 101% compared to the control group (p = 0.033). The stimulation with 1.2 mM of BHBA increased the mRNA expression by 382% (p ≤ 0.001), the stimulation with 1.8 mM of BHBA increased the mRNA expression by 1515% (p = 0.004) and the stimulation with 2.4 mM of BHBA increased the mRNA expression by 2188% (p ≤ 0.001), compared to the control group.

3.3. Effects of BHBA on the Gene Expression of PTGER2 and PTGES2

As shown in Figure 3a, PTGER2 was not altered by BHBA stimulation. The PTGES2 mRNA expression was significantly increased by 37% (p = 0.013) after stimulation with 0.6 mM of BHBA and by 34% (p = 0.032) after stimulation with 1.2 mM of BHBA, compared to the control group (Figure 3b).

3.4. Effects of BHBA on the Gene Expression of the Integrin Subunits ITGAV, ITGA6, ITGB1 and ITGB3

The mRNA expression of the integrins is illustrated in Figure 4. The integrin subunits ITGAV, ITGA6, ITGB1 and ITGB3 did not show significant alterations following the stimulation with BHBA compared to the control group.

4. Discussion

To our knowledge, the effects of BHBA as a marker of ketosis on BCECs in vitro were investigated for the first time. In the present study, BHBA affected the cell viability, the gene expression of inflammatory markers and prostaglandin synthase, but it did not affect the integrin gene expression.
Dairy cows frequently suffer from pregnancy losses during early pregnancy [28]. Ketosis is one possible cause and is characterized by high BHBA blood levels [6,7,8]. In this context, the impact of high BHBA concentrations on fertility and especially on the function of placental cells has not yet been clarified. As mentioned before, a NEB with high levels of BHBA often occurs three weeks before and after calving [1]. And even if first insemination after calving takes place until well after that period, the damages in the endometrium caused by BHBA might nevertheless influence the establishment of a new pregnancy. There are studies about voluntary waiting periods up to 200 days, which might give the endometrium the possibility of recovering from these damages. However, very long voluntary waiting periods lead to extended lactation periods, which in turn lead to other problems like lower milk production, greater body condition score and an increased risk of metabolic disorders after calving [58].
In the present in vitro study, BCECs, the superficial epithelial layer of maternal placentomes, were stimulated with different BHBA concentrations (0.6, 1.2, 1.8 and 2.4 mM), according to the BHBA blood concentrations measured in affected animals [7,8,10,11,59,60]. The results indicate that high concentrations of BHBA (1.8 and 2.4 mM of BHBA for 24 and 36 h) affect cell metabolism and motility negatively. Comparable results have been reported in other studies [22,61,62,63,64,65,66,67]. The negative effect of BHBA on cell metabolism was primarily observed in cancerogenic cells, which are incapable of using BHBA as an energy source [61,62,63,68]. BHBA accumulates in these cells and inhibits the histone deacetylation, whereby pro-apoptotic and anti-proliferative genes are mainly coded [16,20]. In most non-cancerogenic cells, BHBA can be used as an alternative energy source, promoting proliferation and growth [20,69]. Although the BCEC of the present study are not cancerogenic, they may have transformed spontaneously during cultivation. Through a transformation, cells can change their properties and become, for instance, immortal. This has been described in other cell lines [70,71,72]. It is possible that cultivated BCECs are incapable of using BHBA as an energy source, as is observed in cancerogenic cells. However, a negative impact of BHBA and non-esterified free fatty acids (NEFA), a precursor of BHBA, on cell viability is also described in non-cancerogenic cells of the kidney, liver and endometrium [18,22,64,66,67,73]. In bovine hepatocytes and endometrial cells, cell viability was reduced by BHBA due to increased rates of apoptosis. The latter was induced by oxidative stress. Oxidative stress activates the NF-κB signalling pathway and induces an inflammatory response to BHBA, which includes high expression levels of cytokines like TNF, IL6 and IL1B [22,23,66,74,75]. In the present study, BHBA likely induces an inflammatory response of the BCEC, since the cytokine TNF showed increased expression levels with rising BHBA concentrations. In contrast to the aforementioned studies, IL6 and RELA (gene encoding for NF-κB p65) were not altered by BHBA stimulation in the BCEC. This might be explained by the fact that different cells were used for the experiments. Two of the previously mentioned studies used hepatocytes and not cells of the endometrium, and even the studies on bovine endometrial cells did not use exclusively caruncular cells of a pregnant cow like in the present study. It is well known that the immune response changes in pregnant cows, and therefore the origin of the BCEC from a pregnant animal, may also have led to the different results [36,76]. However, the assumption that BHBA induces an inflammatory response in the BCEC is supported by the ability of TNF to induce apoptosis in cells [77,78]. An increased apoptosis rate might explain the reduced cell metabolism of the BCEC.
Aside from the induction of apoptosis, increased TNF expression levels can have various effects on reproductive performance [79,80,81]. Studies on bovine embryos showed an inhibiting effect of TNF on blastocyst maturation in vitro [82]. In an in vivo study in cattle, a high dose of TNF directly infused into the blood circulation increased progesterone as well as the PGE2 concentration in the peripheral blood and resulted in an extended maintenance of the corpus luteum [83]. In other studies, TNF could induce the PGF2α production of stromal endometrial cells [84,85,86], and this might cause premature regression of the corpus luteum. Since the corpus luteum controls the oestrus cycle, increased TNF levels might lead to variable oestrus cycle intervals. Those findings and the reduction in cell metabolism and motility could explain the poor reproductive performance of dairy cows suffering from ketosis.
Like TNF, prostaglandins are mediators of the inflammatory response, but they are important regulators in the reproductive process as well [41,42,87]. In contrast to PGF2α, PGE2 promotes the maintenance of the corpus luteum [37,38,39]. In addition, PGE2 is important for the ovulation, hatching of the blastocyst and implantation [40,41]. Stimulation with 0.6 mM and 1.2 mM of BHBA increased the mRNA expression of PTGES2 significantly compared to SR, but higher BHBA concentrations did not alter the PTGES2 expression. BHBA did not affect the mRNA expression of PTGER2 in the BCEC. A comparable in vitro study showed an effect of high concentrations of NEFA on prostaglandin synthesis in bovine endometrial cells with increased mRNA expression of PTGES2 and PTGER2 but with reduced PGE2 concentration in the cell supernatant. Negative feedback of PGE2 on the expression of its synthase and receptor is assumed. In contrast to the present study, a low concentration of NEFA had no effect [73]. This contradictory result might be due to the different stimulants. Unlike BHBA, fatty acids as part of the lipid metabolism affect prostaglandin synthesis by competitive inhibition of the synthesis of prostaglandins from arachidonic acid [88]. The fact that only low concentrations of BHBA affected the PTGES2 expression does not indicate a negative impact of BHBA on the PGE2 synthesis. Blood concentrations of 0.6 mM of BHBA are physiological in cows and often show a positive effect, for instance, in the viability of bovine endometrial cells [11,13,22,60,66]. However, in some publications, blood concentrations of 1.2 mM of BHBA are the limit value of the diagnosis of ketosis in dairy cows [8,12], but the fact that higher BHBA concentrations did not affect PTGES2 expression does not give any indications of a negative influence of BHBA on PGE2 synthesis. TNF mRNA expression equally increased at low BHBA concentrations but continued to increase at high BHBA concentrations.
The highest rates of pregnancy loss in high-yielding dairy cows are observed in early pregnancy [28]. During this time, crucial aspects are the maturation of the embryo and its implantation, whereby integrins play an important role [29,44,48]. In sheep, the integrin αvβ3 is the binding partner of osteopontin during implantation and enables migration and adhesion of the trophoblast to the maternal luminal epithelium [44]. In the bovine endometrium, the expression patterns of integrins indicate a trophoblast giant cell migration mediated by the integrin α6β1 and the ligand laminin [48]. In the present study, stimulation with different concentrations of BHBA over 24 h did not alter mRNA expression of the integrin subunits ITGAV, ITGA6, ITGB1 and ITGB3. Apart from the present study, there are only a few studies investigating the influence of BHBA or NEFA on integrin expression [89,90]. In mononuclear blood cells, the influence of high NEFA concentrations on gene expression was investigated using a transcriptome analysis in cows during early lactation. Interestingly, genes involved in cellular adhesion like integrins showed an altered expression. Animals with high NEFA blood concentrations showed an increased expression of the integrin subunit ITGA4 but a decreased mRNA expression for integrin subunits ITGAD and ITGA6 [89]. Besides the impact of integrins’ cell-to-cell binding on reproduction, they are also important for diapedesis of leukocytes and are thus essential for the immune defence against pathogens [89]. A study with human monocytes showed increased protein levels of the integrin lymphocyte function-associated antigen-1 after stimulation with BHBA concentrations between 0 and 10 mM in vitro. Therefore, it is assumed that hyperketonemia is involved in the devolvement of cardiovascular diseases [90]. To our knowledge, the present study is the first one that investigated the influence of BHBA on integrin expression in bovine endometrial cells. No significant effect of BHBA was observed. This might be due to methodical or biological reasons. The given experimental conditions might not be suitable, and the BHBA concentrations or the stimulation period could be modified. However, it is also possible that the expression pattern of the integrins was changed or that other integrins are affected by BHBA stimulation without showing changes in the expression level of the examined integrins itself. So far, it appears that the integrin mRNA expression of BCECs is not affected by BHBA.

5. Conclusions

The present study demonstrates that high concentrations of BHBA affect the physiology of BCECs by decreasing cell motility and metabolism. Additionally, an inflammatory response to BHBA stimulation was observed in the BCEC. The mRNA expression of TNF increased concomitantly with rising BHBA concentrations. An explanatory approach for these results is, on the one hand, an energy deficiency, since the BCEC possibly cannot use BHBA as an energy source, and on the other hand, the induction of an inflammatory process. Both might lead to higher apoptosis rates and negatively affect the functionality of maternal caruncles. This could lead to an impaired feto-maternal communication and explain the reduced reproductive performance during the peri-implantation period of ketotic cows. In addition, PTGES2 expression was increased by stimulation with low BHBA concentrations, whereas high BHBA concentrations had no effect. The lowest BHBA concentration of 0.6 mM induced the strongest increase in PTGES2 expression. This BHBA concentration is physiological, and therefore, this change is unlikely to have any negative effects.

Author Contributions

Conceptualization, J.H. and C.P.; Formal analysis, C.H.; Investigation, C.H.; Methodology, B.S.; Project administration, J.H.; Resources, B.S. and C.P.; Supervision, J.H. and C.P.; Validation, C.H.; Visualization, C.H.; Writing—original draft, C.H.; Writing—review and editing, J.H., B.S. and C.P. All authors have read and agreed to the published version of the manuscript.

Funding

This study was not sponsored by commercial or not-for-profit sectors.

Institutional Review Board Statement

No ethical approval was required. No live animals were part of this study.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Acknowledgments

We would like to thank Ines Blume, Gudrun Wirth, Alexander Krybus and Stefanie Lehner for the excellent assistance. Furthermore, the authors wish to thank the native speakers Nicole Schroth and Ellen Medlock for proofreading the manuscript.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Grummer, R.R. Impact of changes in organic nutrient metabolism on feeding the transition dairy cow. J. Anim. Sci. 1995, 73, 2820–2833. [Google Scholar] [CrossRef]
  2. Goff, J.P.; Horst, R.L. Physiological changes at parturition and their relationship to metabolic disorders. J. Dairy. Sci. 1997, 80, 1260–1268. [Google Scholar] [CrossRef]
  3. Bell, A.W. Regulation of organic nutrient metabolism during transition from late pregnancy to early lactation. J. Anim. Sci. 1995, 73, 2804–2819. [Google Scholar] [CrossRef] [PubMed]
  4. Drackley, J.K. Advances in transition cow biology: New frontiers in production diseases. In Production Diseases in Farm Animals, Proceedings of the 12th International Conference on Production Diseases in Farm Animals, East Lansing, MI, USA, 19–22 July 2004; Joshi, N.P., Herdt, T.H., Eds.; Wageningen Academic Publishers: Wageningen, The Netherlands, 2006. [Google Scholar]
  5. Gulinski, P. Ketone bodies—Causes and effects of their increased presence in cows’ body fluids: A review. Vet. World 2021, 14, 1492–1503. [Google Scholar] [CrossRef]
  6. Duffield, T. Subclinical Ketosis in Lactating Dairy Cattle. Vet. Clin. North. Am. Food Anim. 2000, 16, 231–253. [Google Scholar] [CrossRef]
  7. Iwersen, M.; Falkenberg, U.; Voigtsberger, R.; Forderung, D.; Heuwieser, W. Evaluation of an electronic cowside test to detect subclinical ketosis in dairy cows. J. Dairy. Sci. 2009, 92, 2618–2624. [Google Scholar] [CrossRef]
  8. LeBlanc, S. Monitoring metabolic health of dairy cattle in the transition period. J. Reprod. Dev. 2010, 56, S29–S35. [Google Scholar] [CrossRef]
  9. Rossi, F.; Righi, F.; Romanelli, S.; Quarantelli, A. Reproductive efficiency of dairy cows under negative energy balance conditions. Ann. Della Fac. Di Med. Vet. Univ. Di Parma 2008, 28, 173–180. [Google Scholar]
  10. Benedet, A.; Manuelian, C.L.; Zidi, A.; Penasa, M.; De Marchi, M. Invited review: Beta-hydroxybutyrate concentration in blood and milk and its associations with cow performance. Animal 2019, 13, 1676–1689. [Google Scholar] [CrossRef]
  11. Walsh, R.B.; Walton, J.S.; Kelton, D.F.; LeBlanc, S.J.; Leslie, K.E.; Duffield, T.F. The effect of subclinical ketosis in early lactation on reproductive performance of postpartum dairy cows. J. Dairy. Sci. 2007, 90, 2788–2796. [Google Scholar] [CrossRef]
  12. Suthar, V.S.; Canelas-Raposo, J.; Deniz, A.; Heuwieser, W. Prevalence of subclinical ketosis and relationships with postpartum diseases in European dairy cows. J. Dairy. Sci. 2013, 96, 2925–2938. [Google Scholar] [CrossRef]
  13. Duffield, T.F.; Lissemore, K.D.; McBride, B.W.; Leslie, K.E. Impact of hyperketonemia in early lactation dairy cows on health and production. J. Dairy. Sci. 2009, 92, 571–580. [Google Scholar] [CrossRef]
  14. Berge, A.C.; Vertenten, G. A field study to determine the prevalence, dairy herd management systems, and fresh cow clinical conditions associated with ketosis in western European dairy herds. J. Dairy. Sci. 2014, 97, 2145–2154. [Google Scholar] [CrossRef]
  15. Newman, J.C.; Verdin, E. beta-Hydroxybutyrate: A Signaling Metabolite. Annu. Rev. Nutr. 2017, 37, 51–76. [Google Scholar] [CrossRef]
  16. Mierziak, J.; Burgberger, M.; Wojtasik, W. 3-Hydroxybutyrate as a Metabolite and a Signal Molecule Regulating Processes of Living Organisms. Biomolecules 2021, 11, 402. [Google Scholar] [CrossRef]
  17. Bonuccelli, G.; Tsirigos, A.; Whitaker-Menezes, D.; Pavlides, S.; Pestell, R.G.; Chiavarina, B.; Frank, P.G.; Flomenberg, N.; Howell, A.; Martinez-Outschoorn, U.E.; et al. Ketones and lactate “fuel” tumor growth and metastasis: Evidence that epithelial cancer cells use oxidative mitochondrial metabolism. Cell Cycle 2010, 9, 3506–3514. [Google Scholar] [CrossRef]
  18. Gouirand, V.; Gicquel, T.; Lien, E.C.; Jaune-Pons, E.; Da Costa, Q.; Finetti, P.; Metay, E.; Duluc, C.; Mayers, J.R.; Audebert, S.; et al. Ketogenic HMG-CoA lyase and its product beta-hydroxybutyrate promote pancreatic cancer progression. EMBO J. 2022, 41, e110466. [Google Scholar] [CrossRef]
  19. Huang, D.; Li, T.; Wang, L.; Zhang, L.; Yan, R.; Li, K.; Xing, S.; Wu, G.; Hu, L.; Jia, W.; et al. Hepatocellular carcinoma redirects to ketolysis for progression under nutrition deprivation stress. Cell Res. 2016, 26, 1112–1130. [Google Scholar] [CrossRef]
  20. Donohoe, D.R.; Collins, L.B.; Wali, A.; Bigler, R.; Sun, W.; Bultman, S.J. The Warburg effect dictates the mechanism of butyrate-mediated histone acetylation and cell proliferation. Mol. Cell 2012, 48, 612–626. [Google Scholar] [CrossRef]
  21. Lupton, J.R. Microbial degradation products influence colon cancer risk: The butyrate controversy. J. Nutr. 2004, 134, 479–482. [Google Scholar] [CrossRef] [PubMed]
  22. Li, P.; Li, L.; Zhang, C.; Cheng, X.; Zhang, Y.; Guo, Y.; Long, M.; Yang, S.; He, J. Palmitic Acid and beta-Hydroxybutyrate Induce Inflammatory Responses in Bovine Endometrial Cells by Activating Oxidative Stress-Mediated NF-kappaB Signaling. Molecules 2019, 24, 2421. [Google Scholar] [CrossRef]
  23. Shi, X.; Li, X.; Li, D.; Li, Y.; Song, Y.; Deng, Q.; Wang, J.; Zhang, Y.; Ding, H.; Yin, L.; et al. beta-Hydroxybutyrate activates the NF-kappaB signaling pathway to promote the expression of pro-inflammatory factors in calf hepatocytes. Cell Physiol. Biochem. 2014, 33, 920–932. [Google Scholar] [CrossRef]
  24. Zhang, Y.; Li, X.; Zhang, H.; Zhao, Z.; Peng, Z.; Wang, Z.; Liu, G.; Li, X. Non-Esterified Fatty Acids Over-Activate the TLR2/4-NF-Kappab Signaling Pathway to Increase Inflammatory Cytokine Synthesis in Neutrophils from Ketotic Cows. Cell Physiol. Biochem. 2018, 48, 827–837. [Google Scholar] [CrossRef]
  25. Abuajamieh, M.; Kvidera, S.K.; Fernandez, M.V.; Nayeri, A.; Upah, N.C.; Nolan, E.A.; Lei, S.M.; DeFrain, J.M.; Green, H.B.; Schoenberg, K.M.; et al. Inflammatory biomarkers are associated with ketosis in periparturient Holstein cows. Res. Vet. Sci. 2016, 109, 81–85. [Google Scholar] [CrossRef]
  26. El-Deeb, W.M.; El-Bahr, S.M. Biomarkers of ketosis in dairy cows at postparturient period: Acute phase proteins and pro-inflammatory cytokines. Vet. Arh. 2017, 87, 431–440. [Google Scholar] [CrossRef]
  27. Shen, T.; Li, X.; Loor, J.J.; Zhu, Y.; Du, X.; Wang, X.; Xing, D.; Shi, Z.; Fang, Z.; Li, X.; et al. Hepatic nuclear factor kappa B signaling pathway and NLR family pyrin domain containing 3 inflammasome is over-activated in ketotic dairy cows. J. Dairy. Sci. 2019, 102, 10554–10563. [Google Scholar] [CrossRef]
  28. Diskin, M.G.; Parr, M.H.; Morris, D.G. Embryo death in cattle: An update. Reprod. Fertil. Dev. 2012, 24, 244–251. [Google Scholar] [CrossRef]
  29. Lonergan, P.; Forde, N. Maternal-embryo interaction leading up to the initiation of implantation of pregnancy in cattle. Animal 2014, 8 (Suppl. S1), 64–69. [Google Scholar] [CrossRef]
  30. Spencer, T.E. Early pregnancy: Concepts, challenges, and potential solutions. Anim. Front. 2013, 3, 48–55. [Google Scholar] [CrossRef]
  31. Bridges, G.A.; Day, M.L.; Geary, T.W.; Cruppe, L.H. Triennial Reproduction Symposium: Deficiencies in the uterine environment and failure to support embryonic development. J. Anim. Sci. 2013, 91, 3002–3013. [Google Scholar] [CrossRef]
  32. Diskin, M.G.; Morris, D.G. Embryonic and early foetal losses in cattle and other ruminants. Reprod. Domest. Anim. 2008, 43 (Suppl. S2), 260–267. [Google Scholar] [CrossRef]
  33. Forde, N.; Bazer, F.W.; Spencer, T.E.; Lonergan, P. ‘Conceptualizing’ the Endometrium: Identification of Conceptus-Derived Proteins During Early Pregnancy in Cattle. Biol. Reprod. 2015, 92, 156. [Google Scholar] [CrossRef]
  34. Atkinson, B.A.; King, G.J.; Amoroso, E.C. Development of the caruncular and intercaruncular regions in the bovine endometrium. Biol. Reprod. 1984, 30, 763–774. [Google Scholar] [CrossRef]
  35. Roberts, R.M. Interferon-tau, a Type 1 interferon involved in maternal recognition of pregnancy. Cytokine Growth Factor Rev. 2007, 18, 403–408. [Google Scholar] [CrossRef]
  36. Griffith, O.W.; Chavan, A.R.; Protopapas, S.; Maziarz, J.; Romero, R.; Wagner, G.P. Embryo implantation evolved from an ancestral inflammatory attachment reaction. Proc. Natl. Acad. Sci. USA 2017, 114, E6566–E6575. [Google Scholar] [CrossRef]
  37. Ristimaki, A.; Jaatinen, R.; Ritvos, O. Regulation of prostaglandin F2 alpha receptor expression in cultured human granulosa-luteal cells. Endocrinology 1997, 138, 191–195. [Google Scholar] [CrossRef]
  38. Ojeda, S.R.; Campbell, W.B. An increase in hypothalamic capacity to synthesize prostaglandin E2 precedes the first preovulatory surge of gonadotropins. Endocrinology 1982, 111, 1031–1037. [Google Scholar] [CrossRef]
  39. Arosh, J.A.; Banu, S.K.; McCracken, J.A. Novel concepts on the role of prostaglandins on luteal maintenance and maternal recognition and establishment of pregnancy in ruminants. J. Dairy. Sci. 2016, 99, 5926–5940. [Google Scholar] [CrossRef]
  40. Chan, S.Y. Effects of prostaglandin E2 and F2α on peri-implantation development of mouse embryos in vitro. Prostaglandins 1991, 42, 321–336. [Google Scholar] [CrossRef]
  41. Niringiyumukiza, J.D.; Cai, H.; Xiang, W. Prostaglandin E2 involvement in mammalian female fertility: Ovulation, fertilization, embryo development and early implantation. Reprod. Biol. Endocrinol. 2018, 16, 43. [Google Scholar] [CrossRef]
  42. Funk, C.D. Prostaglandins and leukotrienes: Advances in eicosanoid biology. Science 2001, 294, 1871–1875. [Google Scholar] [CrossRef]
  43. Longhurst, C.M.; Jennings, L.K. Integrin-mediated signal transduction. Cell Mol. Life Sci. 1998, 54, 514–526. [Google Scholar] [CrossRef] [PubMed]
  44. Johnson, G.A.; Bazer, F.W.; Jaeger, L.A.; Ka, H.; Garlow, J.E.; Pfarrer, C.; Spencer, T.E.; Burghardt, R.C. Muc-1, integrin, and osteopontin expression during the implantation cascade in sheep. Biol. Reprod. 2001, 65, 820–828. [Google Scholar] [CrossRef]
  45. Bowen, J.A.; Bazer, F.W.; Burghardt, R.C. Spatial and temporal analyses of integrin and Muc-1 expression in porcine uterine epithelium and trophectoderm in vivo. Biol. Reprod. 1996, 55, 1098–1106. [Google Scholar] [CrossRef] [PubMed]
  46. Sutherland, A.E.; Calarco, P.G.; Damsky, C.H. Developmental regulation of integrin expression at the time of implantation in the mouse embryo. Development 1993, 119, 1175–1186. [Google Scholar] [CrossRef]
  47. Erikson, D.W.; Burghardt, R.C.; Bayless, K.J.; Johnson, G.A. Secreted phosphoprotein 1 (SPP1, osteopontin) binds to integrin alpha v beta 6 on porcine trophectoderm cells and integrin alpha v beta 3 on uterine luminal epithelial cells, and promotes trophectoderm cell adhesion and migration. Biol. Reprod. 2009, 81, 814–825. [Google Scholar] [CrossRef]
  48. Pfarrer, C.; Hirsch, P.; Guillomot, M.; Leiser, R. Interaction of Integrin Receptors with Extracellular Matrix is Involved in Trophoblast Giant Cell Migration in Bovine Placentomes. Placenta 2003, 24, 588–597. [Google Scholar] [CrossRef]
  49. Kimmins, S.; MacLaren, L.A. Cyclic modulation of integrin expression in bovine endometrium. Biol. Reprod. 1999, 61, 1267–1274. [Google Scholar] [CrossRef]
  50. MacIntyre, D.M.; Lim, H.C.; Ryan, K.; Kimmins, S.; Small, J.A.; MacLaren, L.A. Implantation-associated changes in bovine uterine expression of integrins and extracellular matrix. Biol. Reprod. 2002, 66, 1430–1436. [Google Scholar] [CrossRef]
  51. Zeiler, M.; Leiser, R.; Johnson, G.A.; Tinneberg, H.R.; Pfarrer, C. Development of an in vitro model for bovine placentation: A comparison of the in vivo and in vitro expression of integrins and components of extracellular matrix in bovine placental cells. Cells Tissues Organs 2007, 186, 229–242. [Google Scholar] [CrossRef]
  52. Bridger, P.S.; Menge, C.; Leiser, R.; Tinneberg, H.R.; Pfarrer, C.D. Bovine caruncular epithelial cell line (BCEC-1) isolated from the placenta forms a functional epithelial barrier in a polarised cell culture model. Placenta 2007, 28, 1110–1117. [Google Scholar] [CrossRef]
  53. Mossman, H.W. Classics revisited: Comparative morphogenesis of the fetal membranes and accessory uterine structures. Placenta 1991, 12, 1–5. [Google Scholar] [CrossRef] [PubMed]
  54. Dilly, M.; Hambruch, N.; Haeger, J.D.; Pfarrer, C. Epidermal growth factor (EGF) induces motility and upregulates MMP-9 and TIMP-1 in bovine trophoblast cells. Mol. Reprod. Dev. 2010, 77, 622–629. [Google Scholar] [CrossRef]
  55. Wilfinger, W.W.; Mackey, K.; Chomczynski, P. Effect of pH and ionic strength on the spectrophotometric assessment of nucleic acid purity. Biotechniques 1997, 22, 474–476, 478–481. [Google Scholar] [CrossRef] [PubMed]
  56. Filor, V.; Seeger, B.; de Buhr, N.; von Kockritz-Blickwede, M.; Kietzmann, M.; Oltmanns, H.; Meissner, J. Investigation of the pathophysiology of bacterial mastitis using precision-cut bovine udder slices. J. Dairy. Sci. 2022, 105, 7705–7718. [Google Scholar] [CrossRef] [PubMed]
  57. Piechotta, M.; Kedves, K.; Araujo, M.G.; Hoeflich, A.; Metzger, F.; Heppelmann, M.; Muscher-Banse, A.; Wrenzycki, C.; Pfarrer, C.; Schuberth, H.J.; et al. Hepatic mRNA expression of acid labile subunit and deiodinase 1 differs between cows selected for high versus low concentrations of insulin-like growth factor 1 in late pregnancy. J. Dairy. Sci. 2013, 96, 3737–3749. [Google Scholar] [CrossRef]
  58. Burgers, E.E.A.; Goselink, R.M.A.; Bruckmaier, R.M.; Gross, J.J.; Jorritsma, R.; Kemp, B.; Kok, A.; van Knegsel, A.T. Effect of voluntary waiting period on metabolism of dairy cows during different phases of the lactation. J. Anim. Sci. 2023, 101, skad194. [Google Scholar] [CrossRef]
  59. Liboreiro, D.N.; Machado, K.S.; Silva, P.R.; Maturana, M.M.; Nishimura, T.K.; Brandao, A.P.; Endres, M.I.; Chebel, R.C. Characterization of peripartum rumination and activity of cows diagnosed with metabolic and uterine diseases. J. Dairy. Sci. 2015, 98, 6812–6827. [Google Scholar] [CrossRef]
  60. Vanholder, T.; Papen, J.; Bemers, R.; Vertenten, G.; Berge, A.C. Risk factors for subclinical and clinical ketosis and association with production parameters in dairy cows in the Netherlands. J. Dairy. Sci. 2015, 98, 880–888. [Google Scholar] [CrossRef]
  61. Dmitrieva-Posocco, O.; Wong, A.C.; Lundgren, P.; Golos, A.M.; Descamps, H.C.; Dohnalova, L.; Cramer, Z.; Tian, Y.; Yueh, B.; Eskiocak, O.; et al. beta-Hydroxybutyrate suppresses colorectal cancer. Nature 2022, 605, 160–165. [Google Scholar] [CrossRef]
  62. Shukla, S.K.; Gebregiworgis, T.; Purohit, V.; Chaika, N.V.; Gunda, V.; Radhakrishnan, P.; Mehla, K.; Pipinos, I.I.; Powers, R.; Yu, F.; et al. Metabolic reprogramming induced by ketone bodies diminishes pancreatic cancer cachexia. Cancer Metab. 2014, 2, 18. [Google Scholar] [CrossRef] [PubMed]
  63. Skinner, R.; Trujillo, A.; Ma, X.; Beierle, E.A. Ketone bodies inhibit the viability of human neuroblastoma cells. J. Pediatr. Surg. 2009, 44, 212–216, 212–216; discussion 216. [Google Scholar] [CrossRef] [PubMed]
  64. Suriyasathaporn, W.; Daemen, A.J.; Noordhuizen-Stassen, E.N.; Dieleman, S.J.; Nielen, M.; Schukken, Y.H. Beta-hydroxybutyrate levels in peripheral blood and ketone bodies supplemented in culture media affect the in vitro chemotaxis of bovine leukocytes. Vet. Immunol. Immunopathol. 1999, 68, 177–186. [Google Scholar] [CrossRef]
  65. Shang, S.; Wang, L.; Zhang, Y.; Lu, H.; Lu, X. The Beta-Hydroxybutyrate Suppresses the Migration of Glioma Cells by Inhibition of NLRP3 Inflammasome. Cell Mol. Neurobiol. 2018, 38, 1479–1489. [Google Scholar] [CrossRef]
  66. Cheng, X.; Yang, S.; Xu, C.; Li, L.; Zhang, Y.; Guo, Y.; Zhang, C.; Li, P.; Long, M.; He, J. Proanthocyanidins Protect against beta-Hydroxybutyrate-Induced Oxidative Damage in Bovine Endometrial Cells. Molecules 2019, 24, 400. [Google Scholar] [CrossRef]
  67. Guh, J.Y.; Chuang, T.D.; Chen, H.C.; Hung, W.C.; Lai, Y.H.; Shin, S.J.; Chuang, L.Y. Beta-hydroxybutyrate-induced growth inhibition and collagen production in HK-2 cells are dependent on TGF-beta and Smad3. Kidney Int. 2003, 64, 2041–2051. [Google Scholar] [CrossRef]
  68. Klement, R.J.; Kammerer, U. Is there a role for carbohydrate restriction in the treatment and prevention of cancer? Nutr. Metab. 2011, 8, 75. [Google Scholar] [CrossRef]
  69. Veech, R.L. The therapeutic implications of ketone bodies: The effects of ketone bodies in pathological conditions: Ketosis, ketogenic diet, redox states, insulin resistance, and mitochondrial metabolism. Prostaglandins Leukot. Essent. Fat. Acids 2004, 70, 309–319. [Google Scholar] [CrossRef]
  70. Takahashi, K.; Sawasaki, Y.; Hata, J.; Mukai, K.; Goto, T. Spontaneous transformation and immortalization of human endothelial cells. Vitr. Cell. Dev. Biol. 1990, 26, 265–274. [Google Scholar] [CrossRef]
  71. Rubin, A.L.; Yao, A.; Rubin, H. Relation of spontaneous transformation in cell culture to adaptive growth and clonal heterogeneity. Proc. Natl. Acad. Sci. USA 1990, 87, 482–486. [Google Scholar] [CrossRef]
  72. Walen, K.H. Spontaneous cell transformation: Karyoplasts derived from multinucleated cells produce new cell growth in senescent human epithelial cell cultures. Vitr. Cell. Dev. Biol. Anim. 2004, 40, 150–158. [Google Scholar] [CrossRef]
  73. Qin, X.; Yang, S.; Zhang, Y.; Li, L.; Li, P.; Long, M.; Guo, Y. Effects of non-esterified fatty acids on relative abundance of prostaglandin E(2) and F(2alpha) synthesis-related mRNA transcripts and protein in endometrial cells of cattle in vitro. Anim. Reprod. Sci. 2020, 221, 106549. [Google Scholar] [CrossRef]
  74. Li, Y.; Ding, H.; Wang, X.; Liu, L.; Huang, D.; Zhang, R.; Guo, L.; Wang, Z.; Li, X.; Liu, G.; et al. High levels of acetoacetate and glucose increase expression of cytokines in bovine hepatocytes, through activation of the NF-kappaB signalling pathway. J. Dairy. Res. 2016, 83, 51–57. [Google Scholar] [CrossRef]
  75. Song, Y.; Li, N.; Gu, J.; Fu, S.; Peng, Z.; Zhao, C.; Zhang, Y.; Li, X.; Wang, Z.; Li, X.; et al. beta-Hydroxybutyrate induces bovine hepatocyte apoptosis via an ROS-p38 signaling pathway. J. Dairy. Sci. 2016, 99, 9184–9198. [Google Scholar] [CrossRef]
  76. Yockey, L.J.; Iwasaki, A. Interferons and Proinflammatory Cytokines in Pregnancy and Fetal Development. Immunity 2018, 49, 397–412. [Google Scholar] [CrossRef] [PubMed]
  77. Hsu, H.; Xiong, J.; Goeddel, D.V. The TNF receptor 1-associated protein TRADD signals cell death and NF-kappa B activation. Cell 1995, 81, 495–504. [Google Scholar] [CrossRef]
  78. Aggarwal, B.B.; Gupta, S.C.; Kim, J.H. Historical perspectives on tumor necrosis factor and its superfamily: 25 years later, a golden journey. Blood 2012, 119, 651–665. [Google Scholar] [CrossRef]
  79. Carpentier, P.A.; Dingman, A.L.; Palmer, T.D. Placental TNF-alpha signaling in illness-induced complications of pregnancy. Am. J. Pathol. 2011, 178, 2802–2810. [Google Scholar] [CrossRef] [PubMed]
  80. Sadowsky, D.W.; Adams, K.M.; Gravett, M.G.; Witkin, S.S.; Novy, M.J. Preterm labor is induced by intraamniotic infusions of interleukin-1beta and tumor necrosis factor-alpha but not by interleukin-6 or interleukin-8 in a nonhuman primate model. Am. J. Obs. Gynecol. 2006, 195, 1578–1589. [Google Scholar] [CrossRef]
  81. Thaxton, J.E.; Nevers, T.; Lippe, E.O.; Blois, S.M.; Saito, S.; Sharma, S. NKG2D blockade inhibits poly(I:C)-triggered fetal loss in wild type but not in IL-10-/- mice. J. Immunol. 2013, 190, 3639–3647. [Google Scholar] [CrossRef]
  82. Jackson, L.R.; Farin, C.E.; Whisnant, S. Tumor necrosis factor alpha inhibits in vitro bovine embryo development through a prostaglandin mediated mechanism. J. Anim. Sci. Biotechnol. 2012, 3, 7. [Google Scholar] [CrossRef]
  83. Skarzynski, D.J.; Woclawek-Potocka, I.; Korzekwa, A.; Bah, M.M.; Piotrowska, K.; Barszczewska, B.; Okuda, K. Infusion of exogenous tumor necrosis factor dose dependently alters the length of the luteal phase in cattle: Differential responses to treatment with indomethacin and L-NAME, a nitric oxide synthase inhibitor. Biol. Reprod. 2007, 76, 619–627. [Google Scholar] [CrossRef]
  84. Sanchez, J.M.; Mathew, D.J.; Passaro, C.; Fair, T.; Lonergan, P. Embryonic maternal interaction in cattle and its relationship with fertility. Reprod. Domest. Anim. 2018, 53 (Suppl. S2), 20–27. [Google Scholar] [CrossRef]
  85. Skarzynski, D.J.; Miyamoto, Y.; Okuda, K. Production of prostaglandin f(2alpha) by cultured bovine endometrial cells in response to tumor necrosis factor alpha: Cell type specificity and intracellular mechanisms. Biol. Reprod. 2000, 62, 1116–1120. [Google Scholar] [CrossRef]
  86. Miyamoto, Y.; Skarzynski, D.J.; Okuda, K. Is tumor necrosis factor alpha a trigger for the initiation of endometrial prostaglandin F(2alpha) release at luteolysis in cattle? Biol. Reprod. 2000, 62, 1109–1115. [Google Scholar] [CrossRef]
  87. Tanabe, T.; Tohnai, N. Cyclooxygenase isozymes and their gene structures and expression. Prostaglandins Other Lipid Mediat. 2002, 68–69, 95–114. [Google Scholar] [CrossRef]
  88. Wathes, D.C.; Abayasekara, D.R.; Aitken, R.J. Polyunsaturated fatty acids in male and female reproduction. Biol. Reprod. 2007, 77, 190–201. [Google Scholar] [CrossRef]
  89. Cheng, Z.; Wylie, A.; Ferris, C.; Ingvartsen, K.L.; Wathes, D.C.; Gplus, E.C. Effect of diet and nonesterified fatty acid levels on global transcriptomic profiles in circulating peripheral blood mononuclear cells in early lactation dairy cows. J. Dairy. Sci. 2021, 104, 10059–10075. [Google Scholar] [CrossRef]
  90. Rains, J.L.; Jain, S.K. Hyperketonemia increases monocyte adhesion to endothelial cells and is mediated by LFA-1 expression in monocytes and ICAM-1 expression in endothelial cells. Am. J. Physiol. Endocrinol. Metab. 2011, 301, E298–E306. [Google Scholar] [CrossRef]
Figure 1. Cell metabolism and cell motility of BCEC after BHBA stimulation. (a) Cell metabolism was significantly reduced after 24 h stimulation with 2.4 mM of BHBA compared to the SR control group. The experiment was repeated 14 times and per group n = 177–199 extinctions were analysed; (b) cell metabolism was significantly reduced after 36 h stimulation with 2.4 mM of BHBA compared to SR control group. The experiment was repeated 14 times and per group n = 181–198 extinctions were analysed; (c) cell motility was significantly reduced after 24 h stimulation with 1.8 and 2.4 mM of BHBA compared to the SR control group. The experiment was repeated 4 times and per group n = 320 distances were analysed. (ac): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The serum reduced control group (SR) is outlined in red. Statistical analysis was performed using Kruskall–Wallis test followed by the Dunn test with Bonferroni correction. The groups that differ significantly from the SR control group are marked with asterisks (* p ≤ 0.05 and *** p ≤ 0.001); BHBA: β-Hydroxybutyrate.
Figure 1. Cell metabolism and cell motility of BCEC after BHBA stimulation. (a) Cell metabolism was significantly reduced after 24 h stimulation with 2.4 mM of BHBA compared to the SR control group. The experiment was repeated 14 times and per group n = 177–199 extinctions were analysed; (b) cell metabolism was significantly reduced after 36 h stimulation with 2.4 mM of BHBA compared to SR control group. The experiment was repeated 14 times and per group n = 181–198 extinctions were analysed; (c) cell motility was significantly reduced after 24 h stimulation with 1.8 and 2.4 mM of BHBA compared to the SR control group. The experiment was repeated 4 times and per group n = 320 distances were analysed. (ac): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The serum reduced control group (SR) is outlined in red. Statistical analysis was performed using Kruskall–Wallis test followed by the Dunn test with Bonferroni correction. The groups that differ significantly from the SR control group are marked with asterisks (* p ≤ 0.05 and *** p ≤ 0.001); BHBA: β-Hydroxybutyrate.
Animals 13 02950 g001
Figure 2. mRNA expression of IL6, RELA and TNF. (a) IL6 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. Statistical analysis was performed using ANOVA; (b) RELA (gene encoding for NF-κB p65) mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. Statistical analysis was performed using Kruskall–Wallis test; (c) TNF mRNA expression was significantly increased after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM BHBA compared to the SR control group. Serum reduced media (SR) served as control. Statistical analysis was performed using ANOVA followed by Games–Howell test. (ac): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The experiment was repeated six times. The serum reduced control group (SR) is outlined in red. The groups that differ significantly from the SR control group are marked with asterisks (* p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001); BHBA: β-Hydroxybutyrate.
Figure 2. mRNA expression of IL6, RELA and TNF. (a) IL6 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. Statistical analysis was performed using ANOVA; (b) RELA (gene encoding for NF-κB p65) mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. Statistical analysis was performed using Kruskall–Wallis test; (c) TNF mRNA expression was significantly increased after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM BHBA compared to the SR control group. Serum reduced media (SR) served as control. Statistical analysis was performed using ANOVA followed by Games–Howell test. (ac): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The experiment was repeated six times. The serum reduced control group (SR) is outlined in red. The groups that differ significantly from the SR control group are marked with asterisks (* p ≤ 0.05, ** p ≤ 0.01 and *** p ≤ 0.001); BHBA: β-Hydroxybutyrate.
Animals 13 02950 g002
Figure 3. mRNA expression of PTGER2 and PTGES2. (a) PTGER2 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. Statistical analysis was performed using ANOVA; (b) PTGES2 mRNA expression was significantly increased after 24 h stimulation with 0.6 and 1.2 mM of BHBA compared to SR control group. Statistical analysis was performed using ANOVA followed by Tukey’s HSD test. (a,b): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The experiment was repeated six times. The serum reduced control group (SR) is outlined in red. The groups that differ significantly from the SR control group are marked with asterisks (* p ≤ 0.05); BHBA: β-Hydroxybutyrate.
Figure 3. mRNA expression of PTGER2 and PTGES2. (a) PTGER2 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. Statistical analysis was performed using ANOVA; (b) PTGES2 mRNA expression was significantly increased after 24 h stimulation with 0.6 and 1.2 mM of BHBA compared to SR control group. Statistical analysis was performed using ANOVA followed by Tukey’s HSD test. (a,b): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The experiment was repeated six times. The serum reduced control group (SR) is outlined in red. The groups that differ significantly from the SR control group are marked with asterisks (* p ≤ 0.05); BHBA: β-Hydroxybutyrate.
Animals 13 02950 g003
Figure 4. mRNA expression of integrin subunits ITGAV, ITGA6, ITGB1 and ITGB3. (a) ITGAV mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group; (b) ITGA6 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group; (c) ITGB1 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group; (d) ITGB3 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. (ad): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The experiment was repeated six times. The serum reduced control group (SR) is outlined in red. Statistical analysis was performed using ANOVA. BHBA: β-Hydroxybutyrate.
Figure 4. mRNA expression of integrin subunits ITGAV, ITGA6, ITGB1 and ITGB3. (a) ITGAV mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group; (b) ITGA6 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group; (c) ITGB1 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group; (d) ITGB3 mRNA expression was not altered after 24 h stimulation with 0.6, 1.2, 1.8 and 2.4 mM of BHBA compared to the SR control group. (ad): The data are presented as boxplots with the box representing the interquartile range. The interquartile range describes the range of values between the 75% and 25% quartile. The horizontal line indicates the median. The ends of the whiskers mark the minimum and maximum value. Outliers are shown with dots. The experiment was repeated six times. The serum reduced control group (SR) is outlined in red. Statistical analysis was performed using ANOVA. BHBA: β-Hydroxybutyrate.
Animals 13 02950 g004
Table 1. Master mixes for RT-qPCR.
Table 1. Master mixes for RT-qPCR.
Master MixMix 1 in µLMix 2 in µLMix 3 in µL
SYBR Green101010
Nuclease-free H2O430
Primer forward1.51.51.5
Primer reverse0.51.54.5
cDNA (5 ng/µL)444
Total202020
Table 2. Primers used in RT-qPCR.
Table 2. Primers used in RT-qPCR.
GeneSequence (5′-3′)
Forward
Reverse
MixProduct LengthAccession No.References
ACTBGATCAAGATCATCGCGCCCC
ACAGTCCGCCTAGAAGCATT
1160 bpNM_173979.3[56]
GAPDHCAACATCAAGTGGGGTGATG
GGCATTGCTGACAATCTTGA
2202 bpNM_001034034.2[57]
TNFGGTTCAAACACTCAGGTCCTCT
CGGAGAGTTGATGTCGGCTA
279 bpNM_173966.3[56]
IL6AAGCGCATGGTCGACAAAAT
AAGCAAATCGCCTGATTGAACC
3164 bpNM_173923.2[56]
PTGES2CTATCTGGTGTCAGGGCAACC
GGTGTACCAACCAGTCGTCC
2212 bpNM_001166554.1PrimerBlast
(NCBI)
PTGER2CCTTGCCTTTCACGATTTTTGC
CTCAGGATGGCAAAGACCCA
3127 bpNM_174588.2PrimerBlast
(NCBI)
ITGA6TGCCACATATCACAAGGCTGA
CTTACAGCGTGGTATCGGGG
2151 bpNM_001109981.2PrimerBlast
(NCBI)
ITGAVAGCGCGTCTTCGATGTTTC
TGTTGCCTGTGGCATCAAAC
3145 bpNM_174367.1PrimerBlast
(NCBI)
ITGB3GAAGCAGAGTGTGTCACGGA
ATGGGTCTTGGCATCAGTGG
2142 bpNM_001206490PrimerBlast
(NCBI)
ITGB1TAGAGACTCCAGAGTGCCCC
CCGTGTCCCATTTGGCATTC
3180 bpNM_174368.3PrimerBlast
(NCBI)
RELA (NF-kb p65)TTTCAATGGACCCACCGACC
TGATGGTGCTGAGAGATGGC
1125 bpNM_001080242.2PrimerBlast
(NCBI)
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Hildebrand, C.; Hollenbach, J.; Seeger, B.; Pfarrer, C. β-Hydroxybutyrate Effects on Bovine Caruncular Epithelial Cells: A Model for Investigating the Peri-Implantation Period Disruption in Ketotic Dairy Cows. Animals 2023, 13, 2950. https://doi.org/10.3390/ani13182950

AMA Style

Hildebrand C, Hollenbach J, Seeger B, Pfarrer C. β-Hydroxybutyrate Effects on Bovine Caruncular Epithelial Cells: A Model for Investigating the Peri-Implantation Period Disruption in Ketotic Dairy Cows. Animals. 2023; 13(18):2950. https://doi.org/10.3390/ani13182950

Chicago/Turabian Style

Hildebrand, Carolin, Julia Hollenbach, Bettina Seeger, and Christiane Pfarrer. 2023. "β-Hydroxybutyrate Effects on Bovine Caruncular Epithelial Cells: A Model for Investigating the Peri-Implantation Period Disruption in Ketotic Dairy Cows" Animals 13, no. 18: 2950. https://doi.org/10.3390/ani13182950

APA Style

Hildebrand, C., Hollenbach, J., Seeger, B., & Pfarrer, C. (2023). β-Hydroxybutyrate Effects on Bovine Caruncular Epithelial Cells: A Model for Investigating the Peri-Implantation Period Disruption in Ketotic Dairy Cows. Animals, 13(18), 2950. https://doi.org/10.3390/ani13182950

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop