Next Article in Journal
Insights into Canadians’ Perceptions of Service Dogs in Public Spaces
Previous Article in Journal
Effect of Dietary Soy Protein Source on Effluent Water Quality and Growth Performance of Rainbow Trout Reared in a Serial Reuse Water System
Previous Article in Special Issue
Occurrence of Borrelia sp. among Wild Living Invasive and Native Mesocarnivores in Poland
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 13
Issue 19
10.3390/ani13193089
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia

by
Petra Bandelj
1,
Darja Kušar
1,
Laura Šimenc
1,
Urška Jamnikar-Ciglenečki
2,
Gorazd Vengušt
3 and
Diana Žele Vengušt
3,*
1
Institute of Microbiology and Parasitology, Veterinary Faculty, University of Ljubljana, Gerbičeva ulica 60, 1115 Ljubljana, Slovenia
2
Institute of Food Safety, Feed and Environment, Veterinary Faculty, University of Ljubljana, Gerbičeva ulica 60, 1115 Ljubljana, Slovenia
3
Institute of Pathology, Wild Animals, Fish and Bees, Veterinary Faculty, University of Ljubljana, Gerbičeva ulica 60, 1115 Ljubljana, Slovenia
*
Author to whom correspondence should be addressed.
Animals 2023, 13(19), 3089; https://doi.org/10.3390/ani13193089
Submission received: 17 August 2023 / Revised: 27 September 2023 / Accepted: 29 September 2023 / Published: 3 October 2023
(This article belongs to the Special Issue Wildlife as a Source of Infectious Agents Involved in Zoonoses and Domestic Animal Infections)
Browse Figures
Review Reports Versions Notes

Abstract

:

Simple Summary

Neospora caninum is an intracellular parasite that is the leading cause of reproductive failure in cattle worldwide and can also cause severe neuromuscular disease in dogs. The parasite circulates between herbivorous intermediate hosts (domestic and wild ruminants) and canine definitive hosts (e.g., dogs and wolves). The population of wild canids may play an important role in disease outbreaks in domestic ruminants, but it is poorly understood. Only definitive hosts shed the parasite in feces, thus samples from grey wolves and golden jackals were tested for the presence of N. caninum using a validated molecular method. The study confirmed a prevalence of 7.1% (3/42) in wolves and 2.6% (1/39) in golden jackals in Slovenia. This is the first molecular detection of the parasite in the population of grey wolves in Slovenia and the first detection in golden jackals. We suggest the golden jackal as a possible definitive host that may influence the spread of N. caninum in livestock.

Abstract

Neospora caninum is an obligate intracellular parasite that causes reproductive disorders and major economic losses in cattle, and induces neuromuscular disorders in canids. Exogenous infections are becoming increasingly important due to disease outbreaks. The sylvatic life cycle of N. caninum interferes with the domestic dog-ruminant life cycle, but understanding of it is scarce. The population of wild canids may play an important role in parasite dispersion. Feces from 42 grey wolves (Canis lupus) and 39 golden jackals (Canis aureus) were analyzed for the N. caninum Nc5 gene using a novel real-time PCR (qPCR) with a detection limit of 5 targets/µL in clinical samples. Three wolves (3/42; 7.1%) and one golden jackal (1/39; 2.6%) tested positive, which is the first detection of N. caninum in the population of grey wolves in Slovenia and the first detection of N. caninum DNA in the feces of a golden jackal. In addition to the grey wolf, we propose the golden jackal as a potential definitive host with hypothetical epidemiological importance for the sylvatic-domestic life cycle of N. caninum, due to its proximity to human habitats and its rapid expansion throughout Europe.

1. Introduction

Neospora caninum is an obligate intracellular parasite from the Sarcocystidae family with domestic and wild canids as definitive hosts. Many warm-blooded animals, most commonly ruminants, are its intermediate hosts [1]. N. caninum was first observed in Norwegian dogs in 1984 [2] and described in 1988 as a new species distinct from Toxoplasma gondii or Hammondia heydorni, whose oocysts are morphologically identical [3]. In the domestic cycle, the parasite mainly circulates between domestic ruminants (cattle, small ruminants) and dogs, while in the sylvatic cycle it circulates between prey animals and mainly wolves. However, both cycles may be intertwined where livestock and wildlife share the same resources [4,5,6,7].
In canids, although rarely, N. caninum can cause neurological symptoms and death, especially in congenitally infected puppies, where it can form cysts in the central nervous system [8]. Infection occurs horizontally by ingestion of oocysts or vertically from the infected dam to the fetus. In cattle, the infection is of great clinical and economic importance, as N. caninum is considered as one of the most common etiological causes of failed pregnancies and stillbirths [9,10]. Birth of asymptomatically infected animals and congenital transmission play an important role in the persistence of the parasite within the infected herd [11,12]. A recent study reported transplacental transmission in 87.5% of N. caninum-infected free-ranging pregnant roe deer, wild boar and red fox [13]. Nevertheless, it remains questionable which species within the wildlife population play a significant role as definitive or intermediate hosts. Grey wolves (Canis lupus), coyotes (Canis latrans) from North America [5,14] and Australian wild dogs (Canis lupus dingo) [15,16] were confirmed as definitive hosts, and their prevalence ranges from 2.2% to 10% [6,14]. Red foxes (Vulpes vulpes) were suggested as possible definitive hosts [17], but research results are more consistent with their role as intermediate hosts [18,19,20]. Grey wolves in Slovenia are an indigenous species that was almost exterminated due to human persecution at the end of the 19th century [21]. Currently, the population of grey wolves is increasing and is part of the Dinaric Balkan population, which is known for its large size (about 5000–5500 individuals) and wide distribution [22]. Meanwhile, the greatest increase in population size and geographic distribution among carnivores in Europe has been observed in the golden jackal (Canis aureus) [23,24]. In Slovenia, golden jackals were first reported in the 1950s [24], with regular sightings since 2008 [25]. A broad home range, territorial mobility, a highly unselective diet and behavioral features predispose golden jackals to many infectious agents, including parasites. As noted with Echinococcus multilocularis [26], golden jackals may play a significant role in the dissemination of clinically important parasites, which warrants more extensive investigation. There is no report on the presence of N. caninum in their feces, although seropositive golden jackals were reported from Israel [27,28]. Sexual replication of N. caninum occurs in the gut of definitive hosts and oocysts are shed in their feces for a short period of time [29]. Thus, the use of a sensitive and specific real-time PCR (qPCR) assay to detect N. caninum is of paramount importance for epidemiological studies, especially in wildlife.
The aim of this study was to use a validated qPCR method calibrated with digital PCR (dPCR) to assess the prevalence of N. caninum in fecal samples from grey wolf and golden jackal populations in Slovenia, and to determine the role of the golden jackal in the life cycle of N. caninum.

2. Materials and Methods

2.1. Samples

Fecal samples from 42 grey wolves (C. lupus) and 39 golden jackals (C. aureus) were collected at the Institute of Pathology, Wild Animals, Fish and Bees (Veterinary faculty, University of Ljubljana, Slovenia). Animal carcasses of grey wolves and golden jackals were collected in 5 and 7, respectively, of 12 statistical regions in Slovenia (Figure 1 and Figure 2 in the Section 3) as part of the regular annual hunting bag or from road kills throughout the Slovenian territory from 2013 to 2020. All samples were stored at −80 °C for at least one month prior to processing and DNA extraction to avoid human exposure to viable parasite eggs of zoonotic importance. All samples were collected postmortem, thus ethics committee/welfare authority approval was not required.

2.2. Methods

2.2.1. Design of N. caninum qPCR Assay

For qPCR, we selected the repetitive Nc5 gene for N. caninum [30]. It is highly specific and is one of the two most common markers used for routine PCR-based N. caninum detection [31]. Since we were aiming for a calibrated qPCR for absolute quantification and also confirmation of amplicon identity after qPCR by Sanger sequencing, we constructed a novel TaqMan assay targeting a similar but longer Nc5 region than previously reported [32]. The primers and probe were designed using the Primer Express v3.0.1 software (Applied Biosystems by Thermo Fisher Scientific, Waltham, MA, USA). Nc5 gene sequence alignment was performed using the Nc5 hybridization probe region from strain NC-1 (GenBank accession number X84238.1) as a template [33]. Primer specificity was tested with the NCBI Primer BLAST tool (http://www.ncbi.nlm.nih.gov/tools/primer-blast/, accessed on 11 July 2023) using the standard nr nucleotide database. The N. caninum specific TaqMan assay (Table 1) generated a 102 bp amplicon.

2.2.2. Validation and Calibration of qPCR

The qPCR reaction mix contained 300 nM of both primers and 100 nM of the probe (Table 1). When implementing the qPCR protocol, the optimal total volume of DNA/PCR mix was set at 2/25 µL. During validation, the Maxima Probe qPCR Master Mix (2×) with separately added 1:10 ROX solution (Thermo Fisher Scientific, USA) showed better performance and no inhibition compared to the FastStart Universal Probe Master (Rox) (Roche, Basel, Switzerland). qPCR was performed on the QuantStudio 5 Real-Time PCR System (Applied Biosystems by Thermo Fisher Scientific, USA) with thermal cycling conditions consisting of a preheating step at 50 °C for 2 min, followed by 95 °C for 10 min and 45 cycles of denaturation at 95 °C for 15 s, with annealing and extension at 60 °C for 1 min. After validation, the threshold line was set at 0.1 for all samples. Positive and negative (PCR-grade water) controls were included in each qPCR run. Results were expressed in quantification cycle (Cq) values.
Positive control for N. caninum was provided by the Portugal National Institute (Instituto Nacional de Investigação Agrária e Veterinária, I.P.). To detect and quantify the N. caninum Nc5 genomic target, linear regression of a standard curve was performed to validate qPCR. The positive control was diluted in DNA extracted from N. caninum-negative animal feces in a 5-fold series to mimic the N. caninum-positive feces with decreasing amounts of N. caninum; this was used to prepare the qPCR dilution series to account for the impact of PCR inhibitors that may be present in the animal feces. Each dilution was qPCR tested in three technical replicates. For the calculation of a linear regression equation, only data within the linear dynamic range (LDR) were considered. This is defined as dilutions with the coefficient of variation (CV) not exceeding 33%, since CV markedly increases below the limit of quantification (LOQ) [34], which indicated the lower limit of LDR. The limit of detection (LOD) was determined accordingly, being 5- to 10-times lower than LOQ in complex samples [35]. For determination of the Cq cut-off value, the last standard dilution where both positive and negative results were observed was considered; here, the highest Cq value was rounded up to the next half value and increased by 0.5 [36]. The qPCR amplification efficiency was calculated according to the equation E = 10−1/slope − 1 [34].
For calibration of qPCR with dPCR, the same TaqMan assay and the prepared DNA dilution series were employed as for qPCR. The reaction mix contained 7.5 µL of 2× QuantStudio 3D Digital PCR Master Mix v2 (Applied Biosystems by Thermo Fisher Scientific, USA), 300 nM of both primers and 100 nM of the probe, 3 µL of DNA, and PCR-grade water to a final volume of 15 µL. The prepared dPCR reactions were loaded onto QuantStudio 3D Digital PCR 20K Chips v2 (consisting of 20,000 reaction wells per chip) and amplification was performed on a ProFlex 2× Flat PCR System (Applied Biosystems by Thermo Fisher Scientific, USA) according to the manufacturer’s instructions; the same number of cycles and annealing temperature was used as for qPCR. Chip imaging was performed with the QuantStudio 3D Digital PCR Instrument and results were analyzed using the QuantStudio 3D AnalysisSuite v3.1.6 Cloud Software. Results of dPCR quantification were expressed in copies of Nc5 per µL of the extracted DNA and were used for calibration of qPCR; by analyzing the same samples (DNA dilution series) by dPCR and qPCR, Cq values from qPCR validation could be translated into absolute quantification values and validation parameters of qPCR determined.

2.2.3. DNA Extraction from Animal Feces

DNA extraction from fecal samples was performed using the iHelix kit (Institute of Metagenomic and Microbial Technologies, Slovenia; https://www.ihelix.eu/, accessed on 11 July 2023) according to the manufacturer’s instructions and as previously described [37]. Prior to extraction, each fecal sample was diluted (approx. 0.5 g of fecal sample with 1 mL of sterile saline solution) in the provided 2-mL screw cap tubes and vortexed to obtain a homogenized solution. The extraction protocol included bead-beating (45 s at 6400 rpm) three times using a tissue homogenizer (MagNA Lyser Instrument; Roche, Switzerland), combined with enzymatic and heat-induced lysis between mechanical shearing. DNA was eluted to a final volume of 100 µL and stored at −20 °C till qPCR analysis. DNA from all samples was diluted (1:10) and retested to rule out possible inhibition.

3. Results

3.1. Validation and Calibration of qPCR

qPCR for the detection of N. caninum Nc5 genomic target in animal fecal samples showed good performance with a LOQ of 8 targets per µL of the extracted DNA and a LOD of 5 targets per µL, reaching the reported theoretical limit of three target copies per PCR [38]. The equation for the linear regression curve was y = −3.0978x + 37.313 with a regression coefficient R2 of 0.9984. The efficiency of qPCR was 110.3%. The Cq cut-off value was set at 41.0.

3.2. N. caninum in Fecal Samples from Grey Wolfs and Golden Jackals

Of 42 grey wolf and 39 golden jackal fecal samples, three grey wolves (3/42; 7.1%) and one golden jackal (1/39; 2.6%) tested positive for N. caninum DNA by the newly developed and validated qPCR. The Cq values of N. caninum-positive animals were 38.1, 38.2 and 39.3 for grey wolves (one female, two males; 1, 5 and 8 years old) and 40.1 for the golden jackal (female, juvenile less than 1 year old). Positive results were confirmed with Sanger sequencing; all sequences were most closely related to the sequence N. caninum Liverpool complete genome, chromosome II (GenBank accession number FR823382.1).
Two of 25 (8.0%) samples from grey wolves collected in the Slovenian region R3 and one of six (16.7%) from region R6 were positive for N. caninum (Figure 1). One of 9 (11.1%) samples from golden jackals in region R7 was also positive (Figure 2).
Animals 13 03089 g001
Figure 1. Molecular prevalence of Neospora caninum in the population of grey wolf (Canis lupus) in Slovenian regions. Regions (R): R1, obalno–kraška; R2, goriška; R3, primorsko–notranjska; R4, osrednjeslovenska; R5, gorenjska; R6, jugovzhodna Slovenija; R7, posavska; R8, zasavska; R9, savinjska; R10, podravska; R11, pomurska; R12, koroška. N. caninum sampling regions: positive in blue, negative in green, without samples in grey.
Figure 1. Molecular prevalence of Neospora caninum in the population of grey wolf (Canis lupus) in Slovenian regions. Regions (R): R1, obalno–kraška; R2, goriška; R3, primorsko–notranjska; R4, osrednjeslovenska; R5, gorenjska; R6, jugovzhodna Slovenija; R7, posavska; R8, zasavska; R9, savinjska; R10, podravska; R11, pomurska; R12, koroška. N. caninum sampling regions: positive in blue, negative in green, without samples in grey.
Animals 13 03089 g001
Animals 13 03089 g002
Figure 2. Molecular prevalence of Neospora caninum in the population of golden jackal (Canis aureus) in Slovenian regions. For region designation and color legend, see Figure 1.
Figure 2. Molecular prevalence of Neospora caninum in the population of golden jackal (Canis aureus) in Slovenian regions. For region designation and color legend, see Figure 1.
Animals 13 03089 g002

4. Discussion

N. caninum is a major cause of economic losses in the cattle industry due to reproductive failure in dams [2,9,10]. The parasite can transmit vertically, which plays an important role in its persistence within the herd [13,39]. However, exogenous exposure to oocysts is also important, especially in disease outbreaks [40,41]. The sylvatic life cycle of N. caninum occurs in parallel with the domestic dog-ruminant life cycle, but understanding of it is scarce [1]. In this study, we determined the molecular prevalence of N. caninum in the Slovenian grey wolf population and for the first time detected N. caninum DNA in the feces of golden jackals.
The confirmed definitive hosts of N. caninum in the sylvatic cycle are grey wolves [6], coyotes [14] and Australian wild dogs [15,16]. The reported seroprevalence in grey wolves ranged from 3.2% to 39.0% [42], while a study from the United States found a molecular prevalence of 4.1% in wolf feces [6]. The prevalence observed in our study was similar, with 7.1% N. caninum positive grey wolves. In neighboring countries, there are no molecular data available for the presence of N. caninum in grey wolves. A recent study from Italy reported the presence of Neospora/Hammondia spp. oocysts in only one fecal sample (1.3%) [43], while in Croatia their presence was confirmed for 2.6% fecal samples using non-molecular coprological methods [44]. Both studies could benefit from the use of molecular methods to determine the prevalence of N. caninum in their samples. Recent data indicate that the Slovenian grey wolf population has increased from 34–42 in 2010/2011 to 120 (106–147) individuals in 2020/2021 and an expansion of its territory has been observed, which is to be expected as the grey wolf in Slovenia is part of a large and viable Dinaric Balkan population. [22,45,46]. As expected, all N. caninum-positive grey wolves in our study originated from the Dinaric karst region or its vicinity (regions R3 and R6 in this study, Figure 1), where the highest grey wolf population densities in Slovenia have been recorded [45]. The occurrence of wolf-dog hybrids is also of concern [45], as the animals may be less cautious and approach human habitats, favoring parasite dispersion. In addition, cases of predators attacking small ruminants and even cattle are increasing [45]. Although wolves rarely prey on adult cattle [45], they could still defecate on grasslands and pastures where grass or eventually hay would be eaten by ruminants. Even a low prevalence of N. caninum must be considered, since N. caninum oocysts are extremely resistant in the environment and a small number of oocysts have been shown to be sufficient to infect an intermediate host [41,42]. Globally, the pooled molecular prevalence of N. caninum-aborted fetuses was reported to be 15% in small domestic ruminants [12] and 43% in cattle [11]. In Italy, Zanet and colleagues reported a prevalence of N. caninum-positive fetuses of 31% in roe deer and 25% in wild boars [13]. Studies in wildlife have often focused on intermediate hosts and their role in the life cycle of N. caninum [13,47]. However, there is still no clear evidence of the impact of N. caninum infection on the health of individual animals or wildlife populations [47].
On the other hand, the rapidly growing population of the golden jackal in Slovenia and in Europe should be taken into consideration when investigating their role in the life cycle of N. caninum [24,48]. Due to the expansion and the nature of their behavior, they come close to the rural habitat of humans and often prey on small domestic animals in addition to rodents [49]. The seroprevalence of N. caninum in golden jackals has been reported to range from 1.7% to 3.2% in Israel [27,28], suggesting that golden jackals are exposed to the parasite. Because only seroprevalence data are available, no assumptions could be made on the role of golden jackals in the life cycle of the parasite. In this study, we report for the first time the presence of N. caninum DNA in the feces of a golden jackal. With a prevalence of 2.6%, it is in close concordance with the Israeli study, although a comparison should not be made due to differences in methodology [14]. However, a report from a Canadian study showed agreement with the 10–18% seroprevalence in coyotes from the USA studies and a 10% molecular detection of oocysts in the feces of Canadian coyotes [14,42]. Both species of wild carnivores included in our study showed a low prevalence, which may suggest that neither play an important role in the epidemiology of N. caninum. However, based on the recent Italian study and considering the increase in presence and density observed for both species in Slovenia over the last decade [23,24,45,48], their role may still be evolving [13]. What should also be considered is that canids presumably spread N. caninum only from day 5 and up to day 30 post infection [42]. Thus, it is challenging to find positive wild animals that actively shed N. caninum oocysts in their feces. For this reason, we used a very sensitive and specific molecular tool to optimize and possibly expand the three-week shedding window of N. caninum.
The obtained LOD value of the constructed qPCR assay (5 Nc5 copies per µL of extracted DNA) indicates that the assay can detect down to 500 Nc5 targets per 0.5 g of animal feces. However, this does not correlate directly to the number of N. caninum, as the Nc5-type sequences have a high redundancy within the genome of the parasite [50]. The good performance of the constructed and validated qPCR enabled us to identify positive animals even at the extreme end of the reliable detection limit of the method. On the other hand, the amount of N. caninum DNA in positive samples was not sufficient for sequencing larger DNA segments for strain typing or attempting to determine the viability of the oocysts. Counting the N. caninum oocysts would have enhanced the scientific value of the study, but it was not possible due to the lack of sample material and storage at −80 °C to prevent zoonotic infections with Echinococcus sp. Due to these shortcomings, we can only speculate that golden jackals may be definitive hosts of N. caninum. However, since golden jackals are considered functional “cleaners” in human-dominated landscapes by consuming discarded animal waste [51], they could acquire N. caninum from discarded aborted fetuses. This, in turn, would mean that the potential role of golden jackals as definitive hosts, with their rapid population increase and expansion throughout Europe, could increase the risk of infection for livestock animals raised at the interface with free-ranging wildlife. Previous findings from North America confirmed horizontal transmission of N. caninum infection between wild and domestic animals, where naturally infected deer transmitted N. caninum to domestic dogs after dogs were fed infected deer tissue and subsequently shed oocysts [52]. In this study, we report the confirmed presence of N. caninum in two common species of wild canids. To date, there are no data on the occurrence of this parasite in domestic dogs or livestock in Slovenia. However, it is a common hunting practice in Slovenia that wild ruminants, e.g., roe deer and red deer, are field dressed and the offal is left exposed not only to wild canids but also to domestic dogs (e.g., sheepdogs and hunting dogs) in the wild, which poses a potential risk of the transmission of N. caninum to livestock. This should encourage further studies focused on defining the relevant players in the N. caninum sylvatic-domestic life cycle.

5. Conclusions

In conclusion, N. caninum is present in the feces of the Slovenian population of grey wolves and golden jackals. This is the first report on molecular detection of N. caninum DNA in the feces of a golden jackal, supporting its role as a possible definitive host of the parasite. The newly described qPCR is specific and sensitive enough to be used in epidemiological studies for N. caninum. Further studies are needed to determine the exact role of the definitive and intermediate hosts in the sylvatic-domestic life cycle of N. caninum.

Author Contributions

Conceptualization: G.V., D.Ž.V., P.B. and U.J.-C.; Methodology: P.B., L.Š., U.J.-C. and D.K.; Software: P.B. and D.K.; Validation: P.B., L.Š., U.J.-C. and D.K.; Formal Analysis: P.B. and L.Š.; Investigation: G.V., D.Ž.V. and P.B.; Resources: G.V. and D.Ž.V.; Data Curation: P.B., L.Š., D.K. and D.Ž.V.; Writing—Original Draft Preparation: P.B. and D.K.; Writing—Review and Editing: P.B., D.K., D.Ž.V., G.V., L.Š. and U.J.-C.; Visualization: G.V., P.B. and D.Ž.V.; Supervision: G.V.; Project Administration: P.B. and D.Ž.V.; Funding Acquisition: G.V. and P.B. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Slovenian Research Agency (research core funding No. P4-0092) and by the Administration of the Republic of Slovenia for Food Safety, Veterinary Service and Plant Protection.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding author.

Acknowledgments

The authors thank the Slovenian hunters and the Slovenian Hunting Association for their valuable help in collecting the samples. We thank Alenka Magdalena Usenik and Maja Kavalič for their help in processing the samples. We would like to thank Helga Waap for providing positive controls.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Reichel, M.P.; Ayanegui-Alcérreca, M.A.; Gondim, L.F.; Ellis, J.T. What is the global economic impact of Neospora caninum in cattle—The billion dollar question. Int. J. Parasitol. 2013, 43, 133–142. [Google Scholar] [CrossRef] [PubMed]
  2. Bjerkås, I.; Mohn, S.F.; Presthus, J. Unidentified cyst-forming sporozoon causing encephalomyelitis and myositis in dogs. Z. Parasitenkd. 1984, 70, 271–274. [Google Scholar] [CrossRef]
  3. Dubey, J.P.; Carpenter, J.L.; Speer, C.A.; Topper, M.J.; Uggla, A. Newly recognized fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc. 1988, 192, 1269–1285. Available online: https://pubmed.ncbi.nlm.nih.gov/3391851/ (accessed on 28 September 2023).
  4. Barber, J.S.; Gasser, R.B.; Ellis, J.; Reichel, M.P.; McMillan, D.; Trees, A.J. Prevalence of antibodies to Neospora caninum in different canid populations. J. Parasitol. 1997, 83, 1056–1058. Available online: https://pubmed.ncbi.nlm.nih.gov/9406778/ (accessed on 28 September 2023).
  5. Gondim, L.F.P.; McAllister, M.M.; Pitt, W.C.; Zemlicka, D.E. Coyotes (Canis latrans) are definitive hosts of Neospora caninum. Int. J. Parasitol. 2004, 34, 159–161. [Google Scholar] [CrossRef] [PubMed]
  6. Dubey, J.P.; Jenkins, M.C.; Rajendran, C.; Miska, K.; Ferreira, L.R.; Martins, J.; Kwok, O.C.H.; Choudhary, S. Gray wolf (Canis lupus) is a natural definitive host for Neospora caninum. Vet. Parasitol. 2011, 181, 382–387. [Google Scholar] [CrossRef] [PubMed]
  7. Almería, S. Neospora caninum and wildlife. ISRN Parasitol. 2013, 24, 947347. [Google Scholar] [CrossRef]
  8. Barber, J.S.; Payne-Johnson, C.E.; Trees, A.J. Distribution of Neospora caninum within the central nervous system and other tissues of six dogs with clinical neosporosis. J. Small Anim. Pract. 1996, 37, 568–574. [Google Scholar] [CrossRef] [PubMed]
  9. Sager, H.; Fischer, I.; Furrer, K.; Strasser, M.; Waldvogel, A.; Boerlin, P.; Audigé, L.; Gottstein, B. A Swiss case-control study to assess Neospora caninum-associated bovine abortions by PCR, histopathology and serology. Vet. Parasitol. 2001, 102, 1–15. [Google Scholar] [CrossRef]
  10. Reichel, M.P.; McAllister, M.M.; Pomroy, W.E.; Campero, C.; Ortega-Mora, L.M.; Ellis, J.T. Control options for Neospora caninum—Is there anything new or are we going backwards? Parasitology 2014, 141, 1455–1470. [Google Scholar] [CrossRef] [PubMed]
  11. Nayeri, T.; Moosazadeh, M.; Sarvi, S.; Daryani, A. Neospora caninum infection in aborting bovines and lost fetuses: A systematic review and meta-analysis. PLoS ONE. 2022, 17, e0268903. [Google Scholar] [CrossRef]
  12. Nayeri, T.; Sarvi, S.; Moosazadeh, M.; Daryani, A. The global prevalence of Neospora caninum infection in sheep and goats that had an abortion and aborted fetuses: A systematic review and meta-analysis. Front. Vet. Sci. 2022, 26, 870904. [Google Scholar] [CrossRef]
  13. Zanet, S.; Poncina, M.; Ferroglio, E. Congenital transmission of Neospora caninum in wild ungulates and foxes. Front. Vet. Sci. 2023, 10, 1109986. [Google Scholar] [CrossRef] [PubMed]
  14. Klein, C.; Barua, S.; Liccioli, S.; Massolo, A. Neospora caninum DNA in coyote fecal samples collected in an urban environment. J. Wildl. Dis. 2019, 55, 196–199. [Google Scholar] [CrossRef] [PubMed]
  15. King, J.S.; Šlapeta, J.; Jenkins, D.J.; Al-Qassab, S.E.; Ellis, J.T.; Windsor, P.A. Australian dingoes are definitive hosts of Neospora caninum. Int. J. Parasitol. 2010, 40, 945–950. [Google Scholar] [CrossRef]
  16. Davidson, M.J.; Huaman, J.L.; Pacioni, C.; Stephens, D.; Hitchen, Y.; Carvalho, T.G. Active shedding of Neospora caninum detected in Australian wild canids in a nonexperimental context. Transbound. Emerg. Dis. 2022, 69, 1862–1871. [Google Scholar] [CrossRef] [PubMed]
  17. Wapenaar, W.; Jenkins, M.C.; O’Handley, R.M.; Barkema, H.W. Neospora caninum-like oocysts observed in feces of free-ranging red foxes (Vulpes vulpes) and coyotes (Canis latrans). J. Parasitol. 2006, 92, 1270–1274. [Google Scholar] [CrossRef] [PubMed]
  18. Almería, S.; Ferrer, D.; Pabón, M.; Castellà, J.; Mañas, S. Red foxes (Vulpes vulpes) are a natural intermediate host of Neospora caninum. Vet. Parasitol. 2002, 107, 287–294. [Google Scholar] [CrossRef]
  19. Schares, G.; Heydorn, A.; Cüppers, A.; Mehlhorn, H.; Geue, L.; Peters, M.; Conraths, F. In contrast to dogs, red foxes (Vulpes vulpes) did not shed Neospora caninum upon feeding of intermediate host tissues. Parasitol. Res. 2002, 88, 44–52. [Google Scholar] [CrossRef]
  20. Erol, U.; Danyer, E.; Ütük, A.E. First molecular detection of Neospora caninum in red fox (Vulpes vulpes) brain sample in Turkey. Ankara Univ. Vet. Fak. Derg. 2022, 70, 465–468. [Google Scholar] [CrossRef]
  21. Schollmayer, H. Die jagd auf krainer karste. Schwarz-, Roth- und Raubwild im Besonderen. Waid-mans Heil. 1889, 109, 123. [Google Scholar]
  22. Boitani, L.; Kaczensky, P.; Alvares, F.; Andrén, H.; Balys, V.; Blanco, J.C.; Chapron, G.; Chiriac, S.; Cirovic, D.; Drouet-Houguet, N.; et al. Assessment of the conservation status of the Wolf (Canis lupus) in Europe. In Proceedings of the Berne Convention on the Conservation of European Wildlife and Natural Habitats and the Council of Europe, Berne, Switzerland, 28 November–2 December 2022. 25p. [Google Scholar]
  23. Arnold, J.; Humer, A.; Heltai, M.; Murariu, D.; Spassov, N.; Hackländer, K. Current status and distribution of golden jackals Canis aureus in Europe. Mammal Rev. 2012, 42, 1–11. [Google Scholar] [CrossRef]
  24. Trouwborst, A.; Krofel, M.; Linnell, J.D.C. Legal implications of range expansions in a terrestrial carnivore: The case of the glden jackal (Canis aureus) in Europe. Biodivers. Conserv. 2015, 24, 2593–2610. [Google Scholar] [CrossRef]
  25. Krofel, M. Confirmed presence of territorial groups of golden jackals (Canis aureus) in Slovenia. Nat. Slov. 2009, 11, 65–68. Available online: http://web.bf.uni-lj.si/bi/NATURA-SLOVENIAE/pdf/NatSlo_11_1_4.pdf (accessed on 12 July 2023).
  26. Bandelj, P.; Blagus, R.; Vengušt, G.; Žele Vengušt, D. Wild carnivore survey of Echinococcus species in Slovenia. Animals 2022, 12, 2223. [Google Scholar] [CrossRef] [PubMed]
  27. Steinman, A.; Shpigel, N.Y.; Mazar, S.; King, R.; Baneth, G.; Savitsky, I.; Shkap, V. Low seroprevalence of antibodies to Neospora caninum in wild canids in Israel. Vet. Parasitol. 2006, 137, 155–158. [Google Scholar] [CrossRef] [PubMed]
  28. Mazuz, M.L.; Alvarez-García, G.; King, R.; Savisky, I.; Shkap, V.; Ortega-Mora, L.M.; Gutiérrez-Expósito, D. Exposure to Neospora spp. and Besnoitia spp. in wildlife from Israel. Int.J. Parasitol. Parasites Wildl. 2018, 7, 317–321. [Google Scholar] [CrossRef] [PubMed]
  29. McAllister, M.M.; Dubey, J.P.; Lindsay, D.S.; Jolley, W.R.; Wills, R.A.; McGuire, A.M. Rapid communication: Dogs are definitive hosts of Neospora caninum. Int. J. Parasitol. 1998, 28, 1473–1479. [Google Scholar] [CrossRef]
  30. Kaufmann, H.; Yamage, M.; Roditi, I.; Dobbelaere, D.; Dubey, J.P.; Holmdahl, O.J.; Trees, A.; Gottstein, B. Discrimination of Neospora caninum from Toxoplasma gondii and other apicomplexan parasites by hybridization and PCR. Mol. Cell. Probes 1996, 10, 289–297. [Google Scholar] [CrossRef] [PubMed]
  31. Donahoe, S.L.; Lindsay, S.A.; Krockenberger, M.; Phalen, D.; Šlapeta, J. A review of neosporosis and pathologic findings of Neospora caninum infection in wildlife. Int. J. Parasitol. Parasites Wildl. 2015, 4, 216–238. [Google Scholar] [CrossRef]
  32. Barry, R.; Nissly, R.H.; Feria, W.; Thirumalapura, N.; Tewari, D.; Jayarao, B.M.; Kuchipudi, S.V. A probe-based real-time PCR assay for the detection of Neospora caninum in clinical samples from cattle. Vet. Parasitol. 2019, 269, 2–6. [Google Scholar] [CrossRef] [PubMed]
  33. Yamage, M.; Flechtner, O.; Gottstein, B. Neospora caninum: Specific oligonucleotide primers for the detection of brain “cyst” DNA of experimentally infected nude mice by the polymerase chain reaction (PCR). J. Parasitol. 1996, 82, 272–279. [Google Scholar] [CrossRef] [PubMed]
  34. Vaerman, J.L.; Saussoy, P.; Ingargiola, I. Evaluation of real-time PCR data. J. Biol. Regul. Homeost. Agents 2004, 18, 212–214. Available online: https://www.gene-quantification.de/vaerman-qpcr-data-analysis-2006.pdf (accessed on 12 July 2023).
  35. Berdal, K.G.; Holst-Jensen, A. Roundup Ready® soybean event-specific real-time quantitative PCR assay and estimation of the practical detection and quantification limits in GMO analyses. Eur. Food Res. Technol. 2001, 213, 432–438. [Google Scholar] [CrossRef]
  36. Mehle, N.; Nikoli, P.; Gruden, K.; Ravnikar, M.; Dermastia, M. Real-time PCR for specific detection of three phytoplasmas from the apple proliferation group. In Phytoplasma. Methods in Molecular Biology (Methods and Protocols); Dickinson, M., Hodgetts, J., Eds.; Humana Press: Totowa, NJ, USA, 2012; Volume 938, pp. 269–281. ISBN 978-1-62703-089-2. [Google Scholar] [CrossRef]
  37. Bandelj, P.; Logar, K.; Usenik, A.M.; Vengust, M.; Ocepek, M. An improved qPCR protocol for rapid detection and quantification of Clostridium difficile in cattle feces. FEMS Microbiol. Lett. 2013, 341, 115–121. [Google Scholar] [CrossRef] [PubMed]
  38. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
  39. Cardoso, J.M.; Amaku, M.; Araújo, A.J.; Gennari, S.M. A longitudinal study of Neospora caninum infection on three dairy farms in Brazil. Vet. Parasitol. 2012, 187, 553–557. [Google Scholar] [CrossRef] [PubMed]
  40. Dubey, J.P.; Schares, G. Diagnosis of bovine neosporosis. Vet. Parasitol. 2006, 140, 1–34. [Google Scholar] [CrossRef]
  41. Wilson, D.J.; Orsel, K.; Waddington, J.; Rajeev, M.; Sweeny, A.R.; Joseph, T.; Grigg, M.E.; Raverty, S.A. Neospora caninum is the leading cause of bovine fetal loss in British Columbia, Canada. Vet. Parasitol. 2016, 218, 46–51. [Google Scholar] [CrossRef] [PubMed]
  42. Dubey, J.P.; Schares, G.; Ortega-Mora, L.M. Epidemiology and control of neosporosis and Neospora caninum. Clin. Microbiol. Rev. 2007, 20, 323–367. [Google Scholar] [CrossRef]
  43. Perrucci, S.; Maestrini, M.; Coppola, F.; Di Marco, M.; Di Rosso, A.; Pacini, M.I.; Zintu, P.; Felicioli, A. Gray wolf (Canis lupus italicus) and red fox (Vulpes vulpes) parasite survey in anthropized and natural areas of central Italy. Vet. Sci. 2023, 10, 108. [Google Scholar] [CrossRef]
  44. Hermosilla, S.; Kleinertz, S.; Silva, L.M.; Hirzmann, J.; Huber, D.; Kusak, J.; Taubert, A. Protozoan and helminth parasite fauna of free-living Croatian wild wolves (Canis lupus) analyzed by scat collection. Vet. Parasitol. 2017, 233, 14–19. [Google Scholar] [CrossRef]
  45. Bartol, M.; Černe, R.; Črtalič, J.; Hanc, Ž.; Hočevar, L.; Hočevar, Š.; Jelenčič, M.; Kljun, F.; Konec, M.; Kos, I.; et al. Monitoring of Conservation Status of Wolves in Slovenia in 2020–2021 Season—Final Report Summary; Technical Report; University of Ljubljana: Ljubljana, Slovenia, 2021. [Google Scholar] [CrossRef]
  46. Van Liere, D.; Dwyer, C.; Jordan, D.; Premik-Banič, A.; Valenčič, A.; Kompan, D.; Siard, N. Farm characteristics in Slovene wolf habitat related to attacks on sheep. Appl. Anim. Behav. Sci. 2013, 144, 46–56. [Google Scholar] [CrossRef]
  47. Krofel, M.; Kos, I. Analiza vsebine iztrebkov volka (Canis lupus) v Sloveniji [Scat analysis of gray wolves (Canis lupus) in Slovenia]. Zb. Gozdarstva Lesar. 2010, 91, 85–88. [Google Scholar]
  48. Spassov, N.; Acosta-Pankov, I. Dispersal history of the golden jackal (Canis aureus moreoticus Geoffroy, 1835) in Europe and possible causes of its recent population explosion. Biodivers. Data J. 2019, 9, 34825. [Google Scholar] [CrossRef] [PubMed]
  49. Lange, P.N.A.M.J.G.; Lelieveld, G.; De Knegt, H.J. Diet composition of the golden jackal Canis aureus in south-east Europe—A review. Mammal Rev. 2021, 51, 207–213. [Google Scholar] [CrossRef]
  50. Müller, N.; Sager, H.; Hemphill, A.; Mehlhorn, H.; Heydorn, A.O.; Gottstein, B. Comparative molecular investigation of Nc5-PCR amplicons from Neospora caninum NC-1 and Hammondia heydorni-Berlin-1996. Parasitol. Res. 2001, 87, 883–885. [Google Scholar] [CrossRef] [PubMed]
  51. Ćirović, D.; Penezić, A.; Krofel, M. Jackals as cleaners: Ecosystem services provided by a mesocarnivore in human-dominated landscapes. Biol. Conserv. 2016, 199, 51–55. [Google Scholar] [CrossRef]
  52. Gondim, L.F.; McAllister, M.M.; Mateus-Pinilla, N.E.; Pitt, W.C.; Mech, L.D.; Nelson, M.E. Transmission of Neospora caninum between wild and domestic animals. J. Parasitol. 2004, 90, 1351–1355. [Google Scholar] [CrossRef]
Table 1. Neospora caninum TaqMan assay used in this study.
Table 1. Neospora caninum TaqMan assay used in this study.
Primer/ProbeOligonucleotide Sequences (5′–3′)
NC forward primerGGAGGACATCGCTCACTGAC
NC reverse primerGCTCCACCAACAATGCTTCG
NC probe[FAM]–AGGCACGCTGAACACCGTATGTC–[TAMRA]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Bandelj, P.; Kušar, D.; Šimenc, L.; Jamnikar-Ciglenečki, U.; Vengušt, G.; Vengušt, D.Ž. First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia. Animals 2023, 13, 3089. https://doi.org/10.3390/ani13193089

AMA Style

Bandelj P, Kušar D, Šimenc L, Jamnikar-Ciglenečki U, Vengušt G, Vengušt DŽ. First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia. Animals. 2023; 13(19):3089. https://doi.org/10.3390/ani13193089

Chicago/Turabian Style

Bandelj, Petra, Darja Kušar, Laura Šimenc, Urška Jamnikar-Ciglenečki, Gorazd Vengušt, and Diana Žele Vengušt. 2023. "First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia" Animals 13, no. 19: 3089. https://doi.org/10.3390/ani13193089

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop