First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Methods
2.2.1. Design of N. caninum qPCR Assay
2.2.2. Validation and Calibration of qPCR
2.2.3. DNA Extraction from Animal Feces
3. Results
3.1. Validation and Calibration of qPCR
3.2. N. caninum in Fecal Samples from Grey Wolfs and Golden Jackals
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Reichel, M.P.; Ayanegui-Alcérreca, M.A.; Gondim, L.F.; Ellis, J.T. What is the global economic impact of Neospora caninum in cattle—The billion dollar question. Int. J. Parasitol. 2013, 43, 133–142. [Google Scholar] [CrossRef] [PubMed]
- Bjerkås, I.; Mohn, S.F.; Presthus, J. Unidentified cyst-forming sporozoon causing encephalomyelitis and myositis in dogs. Z. Parasitenkd. 1984, 70, 271–274. [Google Scholar] [CrossRef]
- Dubey, J.P.; Carpenter, J.L.; Speer, C.A.; Topper, M.J.; Uggla, A. Newly recognized fatal protozoan disease of dogs. J. Am. Vet. Med. Assoc. 1988, 192, 1269–1285. Available online: https://pubmed.ncbi.nlm.nih.gov/3391851/ (accessed on 28 September 2023).
- Barber, J.S.; Gasser, R.B.; Ellis, J.; Reichel, M.P.; McMillan, D.; Trees, A.J. Prevalence of antibodies to Neospora caninum in different canid populations. J. Parasitol. 1997, 83, 1056–1058. Available online: https://pubmed.ncbi.nlm.nih.gov/9406778/ (accessed on 28 September 2023).
- Gondim, L.F.P.; McAllister, M.M.; Pitt, W.C.; Zemlicka, D.E. Coyotes (Canis latrans) are definitive hosts of Neospora caninum. Int. J. Parasitol. 2004, 34, 159–161. [Google Scholar] [CrossRef] [PubMed]
- Dubey, J.P.; Jenkins, M.C.; Rajendran, C.; Miska, K.; Ferreira, L.R.; Martins, J.; Kwok, O.C.H.; Choudhary, S. Gray wolf (Canis lupus) is a natural definitive host for Neospora caninum. Vet. Parasitol. 2011, 181, 382–387. [Google Scholar] [CrossRef] [PubMed]
- Almería, S. Neospora caninum and wildlife. ISRN Parasitol. 2013, 24, 947347. [Google Scholar] [CrossRef]
- Barber, J.S.; Payne-Johnson, C.E.; Trees, A.J. Distribution of Neospora caninum within the central nervous system and other tissues of six dogs with clinical neosporosis. J. Small Anim. Pract. 1996, 37, 568–574. [Google Scholar] [CrossRef] [PubMed]
- Sager, H.; Fischer, I.; Furrer, K.; Strasser, M.; Waldvogel, A.; Boerlin, P.; Audigé, L.; Gottstein, B. A Swiss case-control study to assess Neospora caninum-associated bovine abortions by PCR, histopathology and serology. Vet. Parasitol. 2001, 102, 1–15. [Google Scholar] [CrossRef]
- Reichel, M.P.; McAllister, M.M.; Pomroy, W.E.; Campero, C.; Ortega-Mora, L.M.; Ellis, J.T. Control options for Neospora caninum—Is there anything new or are we going backwards? Parasitology 2014, 141, 1455–1470. [Google Scholar] [CrossRef] [PubMed]
- Nayeri, T.; Moosazadeh, M.; Sarvi, S.; Daryani, A. Neospora caninum infection in aborting bovines and lost fetuses: A systematic review and meta-analysis. PLoS ONE. 2022, 17, e0268903. [Google Scholar] [CrossRef]
- Nayeri, T.; Sarvi, S.; Moosazadeh, M.; Daryani, A. The global prevalence of Neospora caninum infection in sheep and goats that had an abortion and aborted fetuses: A systematic review and meta-analysis. Front. Vet. Sci. 2022, 26, 870904. [Google Scholar] [CrossRef]
- Zanet, S.; Poncina, M.; Ferroglio, E. Congenital transmission of Neospora caninum in wild ungulates and foxes. Front. Vet. Sci. 2023, 10, 1109986. [Google Scholar] [CrossRef] [PubMed]
- Klein, C.; Barua, S.; Liccioli, S.; Massolo, A. Neospora caninum DNA in coyote fecal samples collected in an urban environment. J. Wildl. Dis. 2019, 55, 196–199. [Google Scholar] [CrossRef] [PubMed]
- King, J.S.; Šlapeta, J.; Jenkins, D.J.; Al-Qassab, S.E.; Ellis, J.T.; Windsor, P.A. Australian dingoes are definitive hosts of Neospora caninum. Int. J. Parasitol. 2010, 40, 945–950. [Google Scholar] [CrossRef]
- Davidson, M.J.; Huaman, J.L.; Pacioni, C.; Stephens, D.; Hitchen, Y.; Carvalho, T.G. Active shedding of Neospora caninum detected in Australian wild canids in a nonexperimental context. Transbound. Emerg. Dis. 2022, 69, 1862–1871. [Google Scholar] [CrossRef] [PubMed]
- Wapenaar, W.; Jenkins, M.C.; O’Handley, R.M.; Barkema, H.W. Neospora caninum-like oocysts observed in feces of free-ranging red foxes (Vulpes vulpes) and coyotes (Canis latrans). J. Parasitol. 2006, 92, 1270–1274. [Google Scholar] [CrossRef] [PubMed]
- Almería, S.; Ferrer, D.; Pabón, M.; Castellà, J.; Mañas, S. Red foxes (Vulpes vulpes) are a natural intermediate host of Neospora caninum. Vet. Parasitol. 2002, 107, 287–294. [Google Scholar] [CrossRef]
- Schares, G.; Heydorn, A.; Cüppers, A.; Mehlhorn, H.; Geue, L.; Peters, M.; Conraths, F. In contrast to dogs, red foxes (Vulpes vulpes) did not shed Neospora caninum upon feeding of intermediate host tissues. Parasitol. Res. 2002, 88, 44–52. [Google Scholar] [CrossRef]
- Erol, U.; Danyer, E.; Ütük, A.E. First molecular detection of Neospora caninum in red fox (Vulpes vulpes) brain sample in Turkey. Ankara Univ. Vet. Fak. Derg. 2022, 70, 465–468. [Google Scholar] [CrossRef]
- Schollmayer, H. Die jagd auf krainer karste. Schwarz-, Roth- und Raubwild im Besonderen. Waid-mans Heil. 1889, 109, 123. [Google Scholar]
- Boitani, L.; Kaczensky, P.; Alvares, F.; Andrén, H.; Balys, V.; Blanco, J.C.; Chapron, G.; Chiriac, S.; Cirovic, D.; Drouet-Houguet, N.; et al. Assessment of the conservation status of the Wolf (Canis lupus) in Europe. In Proceedings of the Berne Convention on the Conservation of European Wildlife and Natural Habitats and the Council of Europe, Berne, Switzerland, 28 November–2 December 2022. 25p. [Google Scholar]
- Arnold, J.; Humer, A.; Heltai, M.; Murariu, D.; Spassov, N.; Hackländer, K. Current status and distribution of golden jackals Canis aureus in Europe. Mammal Rev. 2012, 42, 1–11. [Google Scholar] [CrossRef]
- Trouwborst, A.; Krofel, M.; Linnell, J.D.C. Legal implications of range expansions in a terrestrial carnivore: The case of the glden jackal (Canis aureus) in Europe. Biodivers. Conserv. 2015, 24, 2593–2610. [Google Scholar] [CrossRef]
- Krofel, M. Confirmed presence of territorial groups of golden jackals (Canis aureus) in Slovenia. Nat. Slov. 2009, 11, 65–68. Available online: http://web.bf.uni-lj.si/bi/NATURA-SLOVENIAE/pdf/NatSlo_11_1_4.pdf (accessed on 12 July 2023).
- Bandelj, P.; Blagus, R.; Vengušt, G.; Žele Vengušt, D. Wild carnivore survey of Echinococcus species in Slovenia. Animals 2022, 12, 2223. [Google Scholar] [CrossRef] [PubMed]
- Steinman, A.; Shpigel, N.Y.; Mazar, S.; King, R.; Baneth, G.; Savitsky, I.; Shkap, V. Low seroprevalence of antibodies to Neospora caninum in wild canids in Israel. Vet. Parasitol. 2006, 137, 155–158. [Google Scholar] [CrossRef] [PubMed]
- Mazuz, M.L.; Alvarez-García, G.; King, R.; Savisky, I.; Shkap, V.; Ortega-Mora, L.M.; Gutiérrez-Expósito, D. Exposure to Neospora spp. and Besnoitia spp. in wildlife from Israel. Int.J. Parasitol. Parasites Wildl. 2018, 7, 317–321. [Google Scholar] [CrossRef] [PubMed]
- McAllister, M.M.; Dubey, J.P.; Lindsay, D.S.; Jolley, W.R.; Wills, R.A.; McGuire, A.M. Rapid communication: Dogs are definitive hosts of Neospora caninum. Int. J. Parasitol. 1998, 28, 1473–1479. [Google Scholar] [CrossRef]
- Kaufmann, H.; Yamage, M.; Roditi, I.; Dobbelaere, D.; Dubey, J.P.; Holmdahl, O.J.; Trees, A.; Gottstein, B. Discrimination of Neospora caninum from Toxoplasma gondii and other apicomplexan parasites by hybridization and PCR. Mol. Cell. Probes 1996, 10, 289–297. [Google Scholar] [CrossRef] [PubMed]
- Donahoe, S.L.; Lindsay, S.A.; Krockenberger, M.; Phalen, D.; Šlapeta, J. A review of neosporosis and pathologic findings of Neospora caninum infection in wildlife. Int. J. Parasitol. Parasites Wildl. 2015, 4, 216–238. [Google Scholar] [CrossRef]
- Barry, R.; Nissly, R.H.; Feria, W.; Thirumalapura, N.; Tewari, D.; Jayarao, B.M.; Kuchipudi, S.V. A probe-based real-time PCR assay for the detection of Neospora caninum in clinical samples from cattle. Vet. Parasitol. 2019, 269, 2–6. [Google Scholar] [CrossRef] [PubMed]
- Yamage, M.; Flechtner, O.; Gottstein, B. Neospora caninum: Specific oligonucleotide primers for the detection of brain “cyst” DNA of experimentally infected nude mice by the polymerase chain reaction (PCR). J. Parasitol. 1996, 82, 272–279. [Google Scholar] [CrossRef] [PubMed]
- Vaerman, J.L.; Saussoy, P.; Ingargiola, I. Evaluation of real-time PCR data. J. Biol. Regul. Homeost. Agents 2004, 18, 212–214. Available online: https://www.gene-quantification.de/vaerman-qpcr-data-analysis-2006.pdf (accessed on 12 July 2023).
- Berdal, K.G.; Holst-Jensen, A. Roundup Ready® soybean event-specific real-time quantitative PCR assay and estimation of the practical detection and quantification limits in GMO analyses. Eur. Food Res. Technol. 2001, 213, 432–438. [Google Scholar] [CrossRef]
- Mehle, N.; Nikoli, P.; Gruden, K.; Ravnikar, M.; Dermastia, M. Real-time PCR for specific detection of three phytoplasmas from the apple proliferation group. In Phytoplasma. Methods in Molecular Biology (Methods and Protocols); Dickinson, M., Hodgetts, J., Eds.; Humana Press: Totowa, NJ, USA, 2012; Volume 938, pp. 269–281. ISBN 978-1-62703-089-2. [Google Scholar] [CrossRef]
- Bandelj, P.; Logar, K.; Usenik, A.M.; Vengust, M.; Ocepek, M. An improved qPCR protocol for rapid detection and quantification of Clostridium difficile in cattle feces. FEMS Microbiol. Lett. 2013, 341, 115–121. [Google Scholar] [CrossRef] [PubMed]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
- Cardoso, J.M.; Amaku, M.; Araújo, A.J.; Gennari, S.M. A longitudinal study of Neospora caninum infection on three dairy farms in Brazil. Vet. Parasitol. 2012, 187, 553–557. [Google Scholar] [CrossRef] [PubMed]
- Dubey, J.P.; Schares, G. Diagnosis of bovine neosporosis. Vet. Parasitol. 2006, 140, 1–34. [Google Scholar] [CrossRef]
- Wilson, D.J.; Orsel, K.; Waddington, J.; Rajeev, M.; Sweeny, A.R.; Joseph, T.; Grigg, M.E.; Raverty, S.A. Neospora caninum is the leading cause of bovine fetal loss in British Columbia, Canada. Vet. Parasitol. 2016, 218, 46–51. [Google Scholar] [CrossRef] [PubMed]
- Dubey, J.P.; Schares, G.; Ortega-Mora, L.M. Epidemiology and control of neosporosis and Neospora caninum. Clin. Microbiol. Rev. 2007, 20, 323–367. [Google Scholar] [CrossRef]
- Perrucci, S.; Maestrini, M.; Coppola, F.; Di Marco, M.; Di Rosso, A.; Pacini, M.I.; Zintu, P.; Felicioli, A. Gray wolf (Canis lupus italicus) and red fox (Vulpes vulpes) parasite survey in anthropized and natural areas of central Italy. Vet. Sci. 2023, 10, 108. [Google Scholar] [CrossRef]
- Hermosilla, S.; Kleinertz, S.; Silva, L.M.; Hirzmann, J.; Huber, D.; Kusak, J.; Taubert, A. Protozoan and helminth parasite fauna of free-living Croatian wild wolves (Canis lupus) analyzed by scat collection. Vet. Parasitol. 2017, 233, 14–19. [Google Scholar] [CrossRef]
- Bartol, M.; Černe, R.; Črtalič, J.; Hanc, Ž.; Hočevar, L.; Hočevar, Š.; Jelenčič, M.; Kljun, F.; Konec, M.; Kos, I.; et al. Monitoring of Conservation Status of Wolves in Slovenia in 2020–2021 Season—Final Report Summary; Technical Report; University of Ljubljana: Ljubljana, Slovenia, 2021. [Google Scholar] [CrossRef]
- Van Liere, D.; Dwyer, C.; Jordan, D.; Premik-Banič, A.; Valenčič, A.; Kompan, D.; Siard, N. Farm characteristics in Slovene wolf habitat related to attacks on sheep. Appl. Anim. Behav. Sci. 2013, 144, 46–56. [Google Scholar] [CrossRef]
- Krofel, M.; Kos, I. Analiza vsebine iztrebkov volka (Canis lupus) v Sloveniji [Scat analysis of gray wolves (Canis lupus) in Slovenia]. Zb. Gozdarstva Lesar. 2010, 91, 85–88. [Google Scholar]
- Spassov, N.; Acosta-Pankov, I. Dispersal history of the golden jackal (Canis aureus moreoticus Geoffroy, 1835) in Europe and possible causes of its recent population explosion. Biodivers. Data J. 2019, 9, 34825. [Google Scholar] [CrossRef] [PubMed]
- Lange, P.N.A.M.J.G.; Lelieveld, G.; De Knegt, H.J. Diet composition of the golden jackal Canis aureus in south-east Europe—A review. Mammal Rev. 2021, 51, 207–213. [Google Scholar] [CrossRef]
- Müller, N.; Sager, H.; Hemphill, A.; Mehlhorn, H.; Heydorn, A.O.; Gottstein, B. Comparative molecular investigation of Nc5-PCR amplicons from Neospora caninum NC-1 and Hammondia heydorni-Berlin-1996. Parasitol. Res. 2001, 87, 883–885. [Google Scholar] [CrossRef] [PubMed]
- Ćirović, D.; Penezić, A.; Krofel, M. Jackals as cleaners: Ecosystem services provided by a mesocarnivore in human-dominated landscapes. Biol. Conserv. 2016, 199, 51–55. [Google Scholar] [CrossRef]
- Gondim, L.F.; McAllister, M.M.; Mateus-Pinilla, N.E.; Pitt, W.C.; Mech, L.D.; Nelson, M.E. Transmission of Neospora caninum between wild and domestic animals. J. Parasitol. 2004, 90, 1351–1355. [Google Scholar] [CrossRef]
Primer/Probe | Oligonucleotide Sequences (5′–3′) |
---|---|
NC forward primer | GGAGGACATCGCTCACTGAC |
NC reverse primer | GCTCCACCAACAATGCTTCG |
NC probe | [FAM]–AGGCACGCTGAACACCGTATGTC–[TAMRA] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bandelj, P.; Kušar, D.; Šimenc, L.; Jamnikar-Ciglenečki, U.; Vengušt, G.; Vengušt, D.Ž. First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia. Animals 2023, 13, 3089. https://doi.org/10.3390/ani13193089
Bandelj P, Kušar D, Šimenc L, Jamnikar-Ciglenečki U, Vengušt G, Vengušt DŽ. First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia. Animals. 2023; 13(19):3089. https://doi.org/10.3390/ani13193089
Chicago/Turabian StyleBandelj, Petra, Darja Kušar, Laura Šimenc, Urška Jamnikar-Ciglenečki, Gorazd Vengušt, and Diana Žele Vengušt. 2023. "First Molecular Detection of Neospora caninum in Feces of Grey Wolf (Canis lupus) and Golden Jackal (Canis aureus) Populations in Slovenia" Animals 13, no. 19: 3089. https://doi.org/10.3390/ani13193089