Association of Metabolic and Endocrine Disorders with Bovine Ovarian Follicular Cysts
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Collection of Ovaries
2.2. Collection of Follicular Fluid and Theca Interna
2.3. Measurement of Hormone Concentration
2.4. Quantitative Reverse Transcription Polymerase Chain Reaction (RT-qPCR)
2.5. RNA Extraction, Library Preparation, Sequencing and Bioinformatics Analysis
2.6. Statistical Analysis
3. Results
3.1. Hormonal and Metabolic Profile of Follicular Fluid
3.2. Relative mRNA Levels of Corresponding Hormone Receptors
3.3. Transcriptome Analysis of Ovarian Follicular Cysts
3.4. Clustering Analysis of DEGs
3.5. Pathway Enrichment Analysis of DEGs
3.6. Functions of DEGs via Pathways Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Peter, A.T. An update on cystic ovarian degeneration in cattle. Reprod. Domest. Anim. 2004, 39, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Ortega, H.H.; Marelli, B.E.; Rey, F.; Amweg, A.N.; Díaz, P.U.; Stangaferro, M.L.; Salvetti, N.R. Molecular aspects of bovine cystic ovarian disease pathogenesis. Reproduction 2015, 149, R251–R264. [Google Scholar] [CrossRef] [PubMed]
- Yimer, N.; Haron, A.W.; Yusoff, R. Determination of ovarian cysts in cattle with poor reproductive performance using ultrasound and plasma progesterone profile. Vet. Med. Open. J. 2018, 3, 1–9. [Google Scholar] [CrossRef]
- Silvia, W.J.; Hatler, T.B.; Nugent, A.M.; Laranja da Fonseca, L.F. Ovarian follicular cysts in dairy cows: An abnormality in folliculogenesis. Domest. Anim. Endocrinol. 2002, 23, 167–177. [Google Scholar] [CrossRef]
- Kesler, D.J.; Garverick, H.A. Ovarian cysts in dairy cattle: A review. J. Anim. Sci. 1982, 55, 1147–1159. [Google Scholar] [CrossRef]
- BorŞ, S.I.; BorŞ, A. Ovarian cysts, an anovulatory condition in dairy cattle. J. Vet. Med. Sci. 2020, 82, 1515–1522. [Google Scholar] [CrossRef] [PubMed]
- Brito, L.F.C.; Palmer, C.W. Cystic ovarian disease in cattle. Large Anim. Vet. Rounds 2004, 4, 1–6. [Google Scholar]
- Garverick, H.A. Ovarian follicular cysts in dairy cows. J. Dairy Sci. 1997, 80, 995–1004. [Google Scholar] [CrossRef] [PubMed]
- Cattaneo, L.; Signorini, M.L.; Bertoli, J.; Bartolomé, J.A.; Gareis, N.C.; Díaz, P.U.; Bó, G.A.; Ortega, H.H. Epidemiological description of cystic ovarian disease in argentine dairy herds: Risk factors and effects on the reproductive performance of lactating cows. Reprod. Domest. Anim. 2014, 49, 1028–1033. [Google Scholar] [CrossRef]
- Cook, D.L.; Parfet, J.R.; Smith, C.A.; Moss, G.E.; Youngquist, R.S.; Garverick, H.A. Secretory patterns of LH and FSH during development and hypothalamic and hypophysial characteristics following development of steroid-induced ovarian follicular cysts in dairy cattle. J. Reprod. Fertil. 1991, 91, 19–28. [Google Scholar] [CrossRef]
- Vanholder, T.; Opsomer, G.; de Kruif, A. Aetiology and pathogenesis of cystic ovarian follicles in dairy cattle: A review. Reprod. Nutr. Dev. 2006, 46, 105–119. [Google Scholar] [CrossRef]
- Hamilton, S.A.; Garverick, H.A.; Keisler, D.H.; Xu, Z.Z.; Loos, K.; Youngquist, R.S.; Salfen, B.E. Characterization of ovarian follicular cysts and associated endocrine profiles in dairy cows. Biol. Reprod. 1995, 53, 890–898. [Google Scholar] [CrossRef] [PubMed]
- Yoshioka, K.; Iwamura, S.; Kamomae, H. Ultrasonic observations on the turnover of ovarian follicular cysts and associated changes of plasma LH, FSH, progesterone and oestradiol-17 beta in cows. Res. Vet. Sci. 1996, 61, 240–244. [Google Scholar] [CrossRef] [PubMed]
- Lima, F.S.; Acosta, D.A.V.; Egan, T.R.; Skenandore, C.; Sulzberger, S.; French, D.D.; Cardoso, F.C. Steroidogenic, metabolic, and immunological markers in dairy cows diagnosed with cystic ovarian follicles at early and mid-late lactation. Front. Vet. Sci. 2019, 6, 324. [Google Scholar] [CrossRef]
- Hatler, T.B.; Hayes, S.H.; Laranja da Fonseca, L.F.; Silvia, W.J. Relationship between endogenous progesterone and follicular dynamics in lactating dairy cows with ovarian follicular cysts. Biol. Reprod. 2003, 69, 218–223. [Google Scholar] [CrossRef]
- Salvetti, N.R.; Stangaferro, M.L.; Palomar, M.M.; Alfaro, N.S.; Rey, F.; Gimeno, E.J.; Ortega, H.H. Cell proliferation and survival mechanisms underlying the abnormal persistence of follicular cysts in bovines with cystic ovarian disease induced by ACTH. Anim. Reprod. Sci. 2010, 122, 98–110. [Google Scholar] [CrossRef] [PubMed]
- Marelli, B.E.; Diaz, P.U.; Salvetti, N.R.; Rey, F.; Ortega, H.H. mRNA expression pattern of gonadotropin receptors in bovine follicular cysts. Reprod. Biol. 2014, 14, 276–281. [Google Scholar] [CrossRef] [PubMed]
- Phuong, H.N.; Blavy, P.; Martin, O.; Schmidely, P.; Friggens, N.C. Modelling impacts of performance on the probability of reproducing, and thereby on productive lifespan, allow prediction of lifetime efficiency in dairy cows. Animal 2016, 10, 106–116. [Google Scholar] [CrossRef]
- Beam, S.W.; Butler, W.R. Effects of energy balance on follicular development and first ovulation in postpartum dairy cows. J. Reprod. Fertil. Suppl. 1999, 54, 411–424. [Google Scholar] [CrossRef]
- Opsomer, G.; Gröhn, Y.T.; Hertl, J.; Coryn, M.; Deluyker, H.; de Kruif, A. Risk factors for post partum ovarian dysfunction in high producing dairy cows in Belgium: A field study. Theriogenology 2000, 53, 841–857. [Google Scholar] [CrossRef]
- Block, S.S.; Butler, W.R.; Ehrhardt, R.A.; Bell, A.W.; Van Amburgh, M.E.; Boisclair, Y.R. Decreased concentration of plasma leptin in periparturient dairy cows is caused by negative energy balance. J. Endocrinol. 2001, 171, 339–348. [Google Scholar] [CrossRef] [PubMed]
- Liefers, S.C.; Veerkamp, R.F.; te Pas, M.F.W.; Delavaud, C.; Chilliard, Y.; van der Lende, T. Leptin concentrations in relation to energy balance, milk yield, intake, live weight, and estrus in dairy cows. J. Dairy Sci. 2003, 86, 799–807. [Google Scholar] [CrossRef]
- Zulu, V.C.; Sawamukai, Y.; Nakada, K.; Kida, K.; Moriyoshi, M. Relationship among insulin-like growth factor-I, blood metabolites and post partum ovarian function in dairy cows. J. Vet. Med. Sci. 2002, 64, 879–885. [Google Scholar] [CrossRef] [PubMed]
- Vanholder, T.; Leroy, J.L.; Dewulf, J.; Duchateau, L.; Coryn, M.; de Kruif, A.; Opsomer, G. Hormonal and metabolic profiles of high-yielding dairy cows prior to ovarian cyst formation or first ovulation post partum. Reprod. Domest. Anim. 2005, 40, 460–467. [Google Scholar] [CrossRef] [PubMed]
- Spicer, L.J. Leptin, A possible metabolic signal affecting reproduction. Domest. Anim. Endocrinol. 2001, 21, 251–270. [Google Scholar] [CrossRef]
- Qin, Y.S.; Bai, J.H.; Dai, J.G.; Zhou, J.H.; Zhang, T.P.; Zhang, S.; Xu, X.L.; Liu, Y. Alterations of cortisol and melatonin production by the theca interna cells of porcine cystic ovarian follicles. Animals 2022, 12, 357. [Google Scholar] [CrossRef]
- Hopkinson, B.M.; Klitgaard, M.C.; Petersen, O.W.; Villadsen, R.; Rønnov-Jessen, L.; Kim, J. Establishment of a normal-derived estrogen receptor-positive cell line comparable to the prevailing human breast cancer subtype. Oncotarget 2017, 8, 10580–10593. [Google Scholar] [CrossRef]
- Manchon, L.; Chebli, K.; Papon, L.; Paul, C.; Garcel, A.; Campos, N.; Scherrer, D.; Ehrlich, H.; Hahne, M.; Tazi, J. RNA sequencing analysis of activated macrophages treated with the anti-HIV ABX464 in intestinal inflammation. Sci. Data 2017, 4, 170150. [Google Scholar] [CrossRef] [PubMed]
- Li, B.; Dewey, C.N. RSEM: Accurate transcript quantification from RNA-Seq data with or without a reference genome. BMC Bioinform. 2011, 12, 323. [Google Scholar] [CrossRef]
- Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
- Jaiswal, R.S.; Singh, J.; Adams, G.P. Developmental pattern of small antral follicles in the bovine ovary. Biol. Reprod. 2004, 71, 1244–1251. [Google Scholar] [CrossRef] [PubMed]
- Richards, J.S.; Pangas, S.A. The ovary: Basic biology and clinical implications. J. Clin. Investig. 2010, 120, 963–972. [Google Scholar] [CrossRef]
- Vanholder, T.; Opsomer, G.; Govaere, J.L.; Coryn, M.; de Kruif, A. Cystic ovarian disease in dairy cattle: Aetiology, pathogenesis, and risk factors. Tijdschr. Voor Diergeneeskd. 2002, 127, 146–155. [Google Scholar]
- Braw-Tal, R.; Pen, S.; Roth, Z. Ovarian cysts in high-yielding dairy cows. Theriogenology 2009, 72, 690–698. [Google Scholar] [CrossRef] [PubMed]
- Grado-Ahuir, J.A.; Aad, P.Y.; Spicer, L.J. New insights into the pathogenesis of cystic follicles in cattle: Microarray analysis of gene expression in granulosa cells. J. Anim. Sci. 2011, 89, 1769–1786. [Google Scholar] [CrossRef] [PubMed]
- Amweg, A.N.; Salvetti, N.R.; Stangaferro, M.L.; Paredes, A.H.; Lara, H.H.; Rodríguez, F.M.; Ortega, H.H. Ovarian localization of 11β-hydroxysteroid dehydrogenase (11βHSD): Effects of ACTH stimulation and its relationship with bovine cystic ovarian disease. Domest. Anim. Endocrinol. 2013, 45, 126–140. [Google Scholar] [CrossRef]
- Diskin, M.G.; Mackey, D.R.; Roche, J.F.; Sreenan, J.M. Effect of nutrition and metabolic status on circulating hormones and ovarian follicle development in cattle. Anim. Reprod. Sci. 2003, 78, 345–370. [Google Scholar] [CrossRef]
- Webb, R.; Garnsworthy, P.C.; Gong, J.G.; Armstrong, D.G. Control of follicular growth: Local interactions and nutritional influences. J. Anim. Sci. 2004, 82 (Suppl. S13), E63–E74. [Google Scholar] [CrossRef]
- Kawashima, C.; Fukihara, S.; Maeda, M.; Kaneko, E.; Montoya, C.A.; Matsui, M. Relationship between metabolic hormones and ovulation of dominant follicle during the first follicular wave post-partum in high-producing dairy cows. J. Reprod. Dev. 2012, 58, 10–16. [Google Scholar] [CrossRef]
- Spicer, L.J.; Chamberlain, C.S.; Maciel, S.M. Influence of gonadotropins on insulin- and insulin-like growth factor-I (IGF-I)-induced steroid production by bovine granulosa cells. Domest. Anim. Endocrinol. 2002, 22, 237–254. [Google Scholar] [CrossRef]
- Simpson, R.B.; Chase, C.C.; Spicer, L.J.; Vernon, R.K.; Hammond, A.C.; Rae, D.O. Effect of exogenous insulin on plasma and follicular insulin-like growth factor I, insulin-like growth factor binding protein activity, follicular oestradiol and progesterone, and follicular growth in superovulated Angus and Brahman cows. J. Reprod. Fertil. 1994, 102, 483–492. [Google Scholar] [CrossRef] [PubMed]
- Kojima, M.; Hosoda, H.; Date, Y.; Nakazato, M.; Matsuo, H.; Kangawa, K. Ghrelin is a growth-hormone-releasing acylated peptide from stomach. Nature 1999, 402, 656–660. [Google Scholar] [CrossRef]
- Fernández-Fernández, R.; Tena-Sempere, M.; Navarro, V.M.; Barreiro, M.L.; Castellano, J.M.; Aguilar, E.; Pinilla, L. Effects of ghrelin upon gonadotropin-releasing hormone and gonadotropin secretion in adult female rats: In vivo and in vitro studies. Neuroendocrinology 2005, 82, 245–255. [Google Scholar] [CrossRef]
- Bradford, B.J.; Allen, M.S. Negative energy balance increases periprandial ghrelin and growth hormone concentrations in lactating dairy cows. Domest. Anim. Endocrinol. 2008, 34, 196–203. [Google Scholar] [CrossRef] [PubMed]
- D’Occhio, M.J.; Baruselli, P.S.; Campanile, G. Influence of nutrition, body condition, and metabolic status on reproduction in female beef cattle: A review. Theriogenology 2019, 125, 277–284. [Google Scholar] [CrossRef] [PubMed]
- Amweg, A.N.; Paredes, A.; Salvetti, N.R.; Lara, H.E.; Ortega, H.H. Expression of melanocortin receptors mRNA, and direct effects of ACTH on steroid secretion in the bovine ovary. Theriogenology 2011, 75, 628–637. [Google Scholar] [CrossRef] [PubMed]
- Dobson, H.; Ribadu, A.Y.; Noble, K.M.; Tebble, J.E.; Ward, W.R. Ultrasonography and hormone profiles of adrenocorticotrophic hormone (ACTH)-induced persistent ovarian follicles (cysts) in cattle. J. Reprod. Fertil. 2000, 120, 405–410. [Google Scholar] [CrossRef]
- Brosens, J.J.; Tullet, J.; Varshochi, R.; Lam, E.W. Steroid receptor action. Best Pract. Res. Clin. Obstet. Gynaecol. 2004, 18, 265–283. [Google Scholar] [CrossRef]
- Gareis, N.C.; Huber, E.; Hein, G.J.; Rodríguez, F.M.; Salvetti, N.R.; Angeli, E.; Ortega, H.H.; Rey, F. Impaired insulin signaling pathways affect ovarian steroidogenesis in cows with COD. Anim. Reprod. Sci. 2018, 192, 298–312. [Google Scholar] [CrossRef]
- Alfaro, N.S.; Salvetti, N.R.; Velazquez, M.M.; Stangaferro, M.L.; Rey, F.; Ortega, H.H. Steroid receptor mRNA expression in the ovarian follicles of cows with cystic ovarian disease. Res. Vet. Sci. 2012, 92, 478–485. [Google Scholar] [CrossRef]
- Rodríguez, F.M.; Colombero, M.; Amweg, A.N.; Huber, E.; Gareis, N.C.; Salvetti, N.R.; Ortega, H.H.; Rey, F. Involvement of PAPP-A and IGFR1 in Cystic Ovarian Disease in Cattle. Reprod. Domest. Anim. 2015, 50, 659–668. [Google Scholar] [CrossRef]
- Calder, M.D.; Manikkam, M.; Salfen, B.E.; Youngquist, R.S.; Lubahn, D.B.; Lamberson, W.R.; Garverick, H.A. Dominant bovine ovarian follicular cysts express increased levels of messenger RNAs for luteinizing hormone receptor and 3β-hydroxysteroid dehydrogenase Δ4, Δ5 isomerase compared to normal dominant follicles. Biol. Reprod. 2001, 65, 471–476. [Google Scholar] [CrossRef] [PubMed]
- Salvetti, N.R.; Acosta, J.C.; Gimeno, E.J.; Müller, L.A.; Mazzini, R.A.; Taboada, A.F.; Ortega, H.H. Estrogen receptors α and β and progesterone receptors in normal bovine ovarian follicles and cystic ovarian disease. Vet. Pathol. 2007, 44, 373–378. [Google Scholar] [CrossRef] [PubMed]
- Bao, B.; Kumar, N.; Karp, R.M.; Garverick, H.A.; Sundaram, K. Estrogen receptor-β expression in relation to the expression of luteinizing hormone receptor and cytochrome P450 enzymes in rat ovarian follicles. Biol. Reprod. 2000, 63, 1747–1755. [Google Scholar] [CrossRef] [PubMed]
- Zhang, D.; Shang, T.; Huang, Y.; Wang, S.; Liu, H.; Wang, J.; Wang, Y.; Ji, H.; Zhang, R. Gene expression profile changes in the jejunum of weaned piglets after oral administration of Lactobacillus or an antibiotic. Sci. Rep. 2017, 7, 15816. [Google Scholar] [CrossRef] [PubMed]
- McCabe, M.; Waters, S.; Morris, D.; Kenny, D.; Lynn, D.; Creevey, C. RNA-seq analysis of differential gene expression in liver from lactating dairy cows divergent in negative energy balance. BMC Genom. 2012, 13, 193. [Google Scholar] [CrossRef]
- Pandey, K.; Mizukami, Y.; Watanabe, K.; Sakaguti, S.; Kadokawa, H. Deep sequencing of the transcriptome in the anterior pituitary of heifers before and after ovulation. J. Vet. Med. Sci. 2017, 79, 1003–1012. [Google Scholar] [CrossRef] [PubMed]
- Stocco, D.M.; Clark, B.J.; Reinhart, A.J.; Williams, S.C.; Dyson, M.; Dassi, B.; Walsh, L.P.; Manna, P.R.; Wang, X.; Zeleznik, A.J. Elements involved in the regulation of the StAR gene. Mol. Cell. Endocrinol. 2001, 177, 55–59. [Google Scholar] [CrossRef] [PubMed]
- Shih, M.C.M.; Chiu, Y.N.; Hu, M.C.; Guo, I.C.; Chung, B.C. Regulation of steroid production: Analysis of Cyp11a1 promoter. Mol. Cell. Endocrinol. 2011, 336, 80–84. [Google Scholar] [CrossRef] [PubMed]
- Wiltbank, M.C.; Souza, A.H.; Carvalho, P.D.; Cunha, A.P.; Giordano, J.O.; Fricke, P.M.; Baez, G.M.; Diskin, M.G. Physiological and practical effects of progesterone on reproduction in dairy cattle. Animal 2014, 8 (Suppl. S1), 70–81. [Google Scholar] [CrossRef] [PubMed]
- Guo, I.C.; Hu, M.C.; Chung, B.C. Transcriptional regulation of CYP11A1. J. Biomed. Sci. 2003, 10 Pt 1, 593–598. [Google Scholar] [CrossRef]
Genes | Primer Sequence | Accession Numbers | Product Length (bp) |
---|---|---|---|
ESR1 | F: AGGGAAGCTCCTATTTGCTCC R: CGGTGGATGTGGTCCTTCTCT | AY538775 | 234 |
ESR2 | F: AACCTGCTGATGCTCCTGTC R: CAAAGACTTGTTGCCGCGAA | NM_174051.3 | 150 |
PGR | F: GAGATCTTATAAGCATGTCAGTGG R: TCATGCAAGTTATCAAGAAGTTTT | NM_001205356.1 | 360 |
INSR | F: CGTGACAGACTATTACGTGCC R: CCCAATTCTCGCAGGAGTGT | XM_005208815.3 | 258 |
IGF1R | F: CCTCATCAGCTTCACCGTCTACT R: GCGTCCTGCCCGTCATACT | XM_606794.3 | 72 |
IGFBP6 | F: ACACTGAGATGGGTCCCTGC R: AGAAGCCCCTTTGGTCACAA | NM_001040495.2 | 117 |
LEPR | F: CTGCTCCCCCAGAAAHACAG R: GCTGAGCTGACATTGGAGGT | XM_010803431 | 172 |
GHSR | F: CTCGTCATCCTGGTCATCTGGG R: AACTCGGTCGCTCGGCACTC | NM_001143736.2 | 125 |
STAR | F: GGAGGAGATGGCTGGAAGAAGGT R: TGCTGTAGCACTGGAATGGAAACA | NM_174189 | 174 |
3β-HSD | F: ACCTGGGAGTGACAATGATGGGAA R: TCTGGTGGCGGAAGGCAGATAGTA | NM_174343 | 161 |
CYP11A1 | F: CTACCAGGACCTGAGACGGA R: CCTGCCAGCATCTCCGTAAT | NM_176644.2 | 123 |
CYP17A1 | F: TCCTGGCTGTCTTTCTGCTCA R: GTGTCCAATCATCACAGTCGT | BOVCYP17A | 224 |
GAPDH | R: GTCATTGATGGCGACGATGT R: CTAACCTCGGGGAGAGCTTG | NM_001034034.2 | 100 |
Gene | Gene ID | Control (FPKM) | Follicular Cysts (FPKM) |
---|---|---|---|
STAR | 281507 | 3.9 | 20.1 |
3β-HSD | 281824 | 16.74 | 90.54 |
CYP11A1 | 338048 | 11.03 | 66.07 |
CYP17A1 | 281739 | 0.92 | 80.42 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, X.; Bai, J.; Liu, K.; Xiao, L.; Qin, Y.; Gao, M.; Liu, Y. Association of Metabolic and Endocrine Disorders with Bovine Ovarian Follicular Cysts. Animals 2023, 13, 3301. https://doi.org/10.3390/ani13213301
Xu X, Bai J, Liu K, Xiao L, Qin Y, Gao M, Liu Y. Association of Metabolic and Endocrine Disorders with Bovine Ovarian Follicular Cysts. Animals. 2023; 13(21):3301. https://doi.org/10.3390/ani13213301
Chicago/Turabian StyleXu, Xiaoling, Jiahua Bai, Kexiong Liu, Linli Xiao, Yusheng Qin, Meihong Gao, and Yan Liu. 2023. "Association of Metabolic and Endocrine Disorders with Bovine Ovarian Follicular Cysts" Animals 13, no. 21: 3301. https://doi.org/10.3390/ani13213301
APA StyleXu, X., Bai, J., Liu, K., Xiao, L., Qin, Y., Gao, M., & Liu, Y. (2023). Association of Metabolic and Endocrine Disorders with Bovine Ovarian Follicular Cysts. Animals, 13(21), 3301. https://doi.org/10.3390/ani13213301