Tryptophan and Cortisol Modulate the Kynurenine and Serotonin Transcriptional Pathway in the Kidney of Oncorhynchus kisutch
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals
2.2. Primary Culture Cells
2.3. In Vitro Treatment
2.4. Total RNA Extraction
2.5. qRT-PCR Analysis of Gene Expression
2.6. Statistical Analysis
3. Results
3.1. Tryptophan Hydroxylase (TPH2) mRNA Gene Expression Changes
3.2. 5HT1α Receptor mRNA Gene Expression Changes
3.3. INFγ Receptor mRNA Gene Expression Changes
3.4. Kynurenine Aminotransferase 2 (KIAT 2) mRNA Gene Expression Changes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Oyarzún-Salazar, R.; Muñoz, J.L.P.; Mardones, O.; Labbé, B.S.; Romero, A.; Nualart, D.; Vargas-Chacoff, L. Dietary Melatonin and L-Tryptophan Supplementation Counteracts the Effects of Acute Stress in Salmo Salar. Aquaculture 2022, 550, 737882. [Google Scholar] [CrossRef]
- Navedo, J.G.; Vargas-Chacoff, L. Salmon Aquaculture Threatens Patagonia. Science 2021, 372, 695–696. [Google Scholar] [CrossRef]
- Wendelaar-Bonga, S.E. The stress response in fish. Physiol. Rev. 1997, 77, 591–625. [Google Scholar] [CrossRef]
- Barandica, L.M.; Tort, L. Neuroendocrinología e Inmunología de La Respuesta Al Estrés En Peces. Rev. Acad. Colomb. Cienc. 2008, 13, 267–284. [Google Scholar]
- Gesto, M.; López-patiño, M.A.; Hernández, J.; Soengas, J.L.; Míguez, J.M. The Response of Brain Serotonergic and Dopaminergic Systems to an Acute Stressor in Rainbow Trout: A Time Course Study. J. Exp. Biol. 2013, 216, 4435–4442. [Google Scholar] [CrossRef]
- Romero, A.; Vega, M.; Santibáñez, N.; Spies, J.; Pérez, T.; Enríquez, R.; Kausel, G.; Oliver, C.; Oyarzún, R.; Tort, L.; et al. Salmo Salar Glucocorticoid Receptors Analyses of Alternative Splicing Variants under Stress Conditions. Gen. Comp. Endocrinol. 2020, 293, 113466. [Google Scholar] [CrossRef]
- Øverli, Ø.; Pottinger, T.G.; Carrick, T.R.; Øverli, E.; Winberg, S. Brain Monoaminergic Activity in Rainbow Trout Selected for High and Low Stress Responsiveness. Brain. Behav. Evol. 2001, 57, 214–224. [Google Scholar] [CrossRef]
- Øverli, Ø.; Harris, C.A.; Winberg, S. Short-Term Effects of Fights for Social Dominance and the Establishment of Dominant-Subordinate Relationships on Brain Monoamines and Cortisol in Rainbow Trout. Brain. Behav. Evol. 1999, 54, 263–275. [Google Scholar] [CrossRef]
- Höglund, E.; Balm, P.H.M.; Winberg, S. Skin darkening, a Potential Social Signal in Subordinate Arctic Charr (Salvelinus alpinus): The Regulatory Role of Brain Monoamines and Pro-opiomelanocortin-derived peptides. J. Exp. Biol. 2000, 1721, 1711–1721. [Google Scholar] [CrossRef]
- Lepage, O.; Øverli, Ø.; Petersson, E.; Järvi, T.; Winberg, S. Differential Stress Coping in Wild and Domesticated Sea Trout. Brain Behav. Evol. 2000, 56, 259–268. [Google Scholar] [CrossRef]
- Vargas-Chacoff, L.; Muñoz, J.L.P.; Saravia, J.; Oyarzún, R.; Pontigo, J.P.; González, M.P.; Mardones, O.; Hawes, C.; Pino, J.; Wadsworth, S.; et al. Neuroendocrine Stress Response in Atlantic salmon (Salmo salar) and coho salmon (Oncorynchus kisutch) during Sea Lice Infestation. Aquaculture 2019, 507, 329–340. [Google Scholar] [CrossRef]
- Øverli, Ø.; Nordgreen, J.; Mejdell, C.M.; Janczak, A.M.; Kittilsen, S.; Johansen, I.B.; Horsberg, T.E. Ectoparasitic Sea Lice (Lepeophtheirus Salmonis) Affect Behavior and Brain Serotonergic Activity in Atlantic Salmon (Salmo salar L.): Perspectives on Animal Welfare. Physiol. Behav. 2014, 132, 44–50. [Google Scholar] [CrossRef]
- Winberg, S.; Nilsson, G.E. Time Course of Changes in Brain Serotonergic Activity and Brain Tryptophan Levels in Dominant and Subordinate Juvenile Arctic Charr. J. Exp. Biol. 1993, 179, 181–195. [Google Scholar] [CrossRef]
- Lepage, O.; Tottmar, O.; Winberg, S. Elevated Dietary Intake of L-Tryptophan Counteracts the Stress-Induced Elevation of Plasma Cortisol in Rainbow Trout (Oncorhynchus mykiss). J. Exp. Biol. 2002, 205, 3679–3687. [Google Scholar] [CrossRef]
- Lepage, O.; Vílchez, I.M.; Pottinger, T.G.; Winberg, S. Time-Course of the Effect of Dietary L-Tryptophan on Plasma Cortisol Levels in Rainbow Trout Oncorhynchus mykiss. J. Exp. Biol. 2003, 206, 3589–3599. [Google Scholar] [CrossRef]
- Hseu, J.R.; Lu, F.I.; Su, H.M.; Wang, L.S.; Tsai, C.L.; Hwang, P.P. Effect of Exogenous Tryptophan on Cannibalism, Survival and Growth in Juvenile Grouper, Epinephelus coioides. Aquaculture 2003, 218, 251–263. [Google Scholar] [CrossRef]
- Herrero, M.J.; Martínez, F.J.; Míguez, J.M.; Madrid, J.A. Response of Plasma and Gastrointestinal Melatonin, Plasma Cortisol and Activity Rhythms of European Sea Bass (Dicentrarchus labrax) to Dietary Supplementation with Tryptophan and Melatonin. J. Comp. Physiol. B Biochem. Syst. Environ. Physiol. 2007, 177, 319–326. [Google Scholar] [CrossRef]
- Höglund, E.; Sørensen, C.; Bakke, M.J.; Nilsson, G.E.; Øverli, Ø. Attenuation of Stress-Induced Anorexia in Brown Trout (Salmo trutta) by Pre-Treatment with Dietary L-Tryptophan. Br. J. Nutr. 2007, 97, 786–789. [Google Scholar] [CrossRef]
- Wolkers, C.P.B.; Serra, M.; Hoshiba, M.A.; Urbinati, E.C. Dietary L-Tryptophan Alters Aggression in Juvenile Matrinxã Brycon Amazonicus. Fish Physiol. Biochem. 2012, 38, 819–827. [Google Scholar] [CrossRef]
- Conde-Sieira, M.; Muñoz, J.L.P.; López-Patiño, M.A.; Gesto, M.; Soengas, J.L.; Míguez, J.M. Oral Administration of Melatonin Counteracts Several of the Effects of Chronic Stress in Rainbow Trout. Domest. Anim. Endocrinol. 2014, 46, 26–36. [Google Scholar] [CrossRef]
- Basic, D.; Schjolden, J.; Krogdahl, Å.; Von Krogh, K.; Hillestad, M.; Winberg, S.; Mayer, I.; Skjerve, E.; Höglund, E. Changes in Regional Brain Monoaminergic Activity and Temporary Down-Regulation in Stress Response from Dietary Supplementation with l-Tryptophan in Atlantic Cod (Gadus morhua). Br. J. Nutr. 2013, 109, 2166–2174. [Google Scholar] [CrossRef]
- Martins, G.P.; Espe, M.; Zhang, Z.; Guimarães, I.G.; Holen, E. Surplus Arginine Reduced Lipopolysaccharide Induced Transcription of Proinflammatory Genes in Atlantic Salmon Head Kidney Cells. Fish Shellfish Immunol. 2019, 86, 1130–1138. [Google Scholar] [CrossRef]
- Hoseini, S.M.; Pérez-Jiménez, A.; Costas, B.; Azeredo, R.; Gesto, M. Physiological Roles of Tryptophan in Teleosts: Current Knowledge and Perspectives for Future Studies. Rev. Aquac. 2019, 11, 3–24. [Google Scholar] [CrossRef]
- Grohmann, U.; Fallarino, F.; Puccetti, P. Tolerance, DCs and tryptophan: Much ado about IDO. Trends Immunol. 2003, 24, 242–248. [Google Scholar] [CrossRef]
- Moffett, J.R.; Namboodiri, M.A. Tryptophan and the immune response. Immunol Cell Biol. 2003, 81, 247–265. [Google Scholar] [CrossRef]
- Azeredo, R.; Serra, C.R.; Oliva-Teles, A.; Costas, B. Amino acids as modulators of the European seabass, Dicentrarchus labrax, innate immune response: An in vitro approach. Sci. Rep. 2017, 7, 18009. [Google Scholar] [CrossRef]
- Johnston, W.L.; Atkinson, J.L.; Hilton, J.W.; Were, K.E. Effect of Dietary Tryptophan on Plasma and Brain Tryptophan, Brain Serotonin, and Brain 5-Hydroxyindoleacetic Acid in Rainbow Trout. J. Nutr. Biochem. 1990, 1, 49–54. [Google Scholar] [CrossRef]
- Fuertig, R.; Ceci, A.; Camus, S.M.; Bezard, E.; Luippold, A.H.; Hengerer, B. LC-MS/MS-Based Quantification of Kynurenine Metabolites, Tryptophan, Monoamines and Neopterin in Plasma, Cerebrospinal Fluid and Brain. Bioanalysis 2016, 8, 1903–1917. [Google Scholar] [CrossRef]
- Lefèvre, A.; Mavel, S.; Nadal-Desbarats, L.; Galineau, L.; Attucci, S.; Dufour, D.; Sokol, H.; Emond, P. Validation of a Global Quantitative Analysis Methodology of Tryptophan Metabolites in Mice Using LC-MS. Talanta 2019, 195, 593–598. [Google Scholar] [CrossRef]
- Badawy, A.A. Kynurenine Pathway of Tryptophan Metabolism: Regulatory and Functional Aspects. Int. J. Tryptophan Res. 2017, 10. [Google Scholar] [CrossRef]
- Badawy, A.A.B.; Guillemin, G. The Plasma [Kynurenine]/[Tryptophan] Ratio and Indoleamine 2,3-Dioxygenase: Time for Appraisal. Int. J. Tryptophan Res. 2019, 12. [Google Scholar] [CrossRef]
- Álvarez-Rodríguez, M.; Pereiro, P.; Reyes-López, F.E.; Tort, L.; Figueras, A.; Novoa, B. Analysis of the Long-Lived Responses Induced by Immunostimulants and Their Effects on a Viral Infection in Zebrafish (Danio rerio). Front. Immunol. 2018, 9. [Google Scholar] [CrossRef]
- Kaczorek, E.; Szarek, J.; Mikiewicz, M.; Terech-Majewska, E.; Schulz, P.; Małaczewska, J.; Wójcik, R.; Siwicki, A.K. Effect of Feed Supplementation with Kynurenic Acid on the Morphology of the Liver, Kidney and Gills in Rainbow Trout (Oncorhynchus mykiss Walbaum, 1792), Healthy and Experimentally Infected with Yersinia ruckeri. J. Fish Dis. 2017, 40, 873–884. [Google Scholar] [CrossRef]
- Nualart, D.P.; Dann, F.; Oyarzún-Salazar, R.; Morera, F.J.; Vargas-Chacoff, L. Immune Transcriptional Response in Head Kidney Primary Cell Cultures Isolated from the Three Most Important Species in Chilean Salmonids Aquaculture. Biology 2023, 12, 924. [Google Scholar] [CrossRef]
- Castro, R.; Zou, J.; Secombes, C.J.; Martin, S.A.M. Cortisol Modulates the Induction of Inflammatory Gene Expression in a Rainbow Trout Macrophage Cell Line. Fish Shellfish Immunol. 2011, 30, 215–223. [Google Scholar] [CrossRef]
- Mardones, O.; Devia, E.; Labbé, B.S.; Oyarzún, R.; Vargas-Chacoff, L.; Muñoz, J.L.P. Effect of L-Tryptophan and Melatonin Supplementation on the Serotonin Gastrointestinal Content and Digestive Enzymatic Activity for Salmo Salar and Oncorhynchus Kisutch. Aquaculture 2018, 482, 203–210. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Ramakers, C.; Ruijter, J.M.; Lekanne Deprez, R.H.; Moorman, A.F.M. Assumption-Free Analysis of Quantitative Real-Time Polymerase Chain Reaction (PCR) Data. Neurosci Lett. 2003, 339, 62–66. [Google Scholar] [CrossRef]
- Aragão, C.; Corte-Real, J.; Costas, B.; Dinis, M.T.; Conceição, L.E.C. Stress Response and Changes in Amino Acid Requirements in Senegalese Sole (Solea Senegalensis Kaup 1858). Amino Acids 2008, 34, 143–148. [Google Scholar] [CrossRef]
- Costas, B.; Aragão, C.; Mancera, J.M.; Dinis, M.T.; Conceição, L.E.C.; Refojos, B.C. High Stocking Density Induces Crowding Stress and Affects Amino Acid Metabolism in Senegalese Sole Solea Senegalensis (Kaup 1858) Juveniles. Aquac. Res. 2008, 39, 1–9. [Google Scholar] [CrossRef]
- Teixeira, C.; Pedrosa, R.; Castro, C.; Magalhães, R.; Matos, E.; Oliva-Teles, A.; Peres, H.; Pérez-Jiménez, A. Dietary Tryptophan Supplementation Implications on Performance, Plasma Metabolites, and Amino Acid Catabolism Enzymes in Meagre (Argyrosomus Regius). Fishes 2023, 8, 141. [Google Scholar] [CrossRef]
- Martins, C.; Silva, P.; Costas, B.; Larsen, B.K.; Santos, G.A.; Conceição, L.E.C.; Dias, J.; Øverli, Ø.; Höglund, E.; Schrama, J.W. The effect of tryptophan supplemented diets on brain serotonergic activity and plasma cortisol under undisturbed and stressed conditions in grouped-housed Nile tilapia Oreochromis niloticus. Aquaculture 2013, 400–401, 129–134. [Google Scholar] [CrossRef]
- Maximino, C.; Herculano, A.M. A Review of Monoaminergic Neuropsychopharmacology in Zebrafish. Zebrafish 2010, 7, 359–378. [Google Scholar] [CrossRef]
- Robertsen, B. The Interferon System of Teleost Fish. Fish Shellfish Immunol. 2006, 20, 172–191. [Google Scholar] [CrossRef]
- Rogatsky, I.; Ivashkiv, L.B.; Tad, S.H. Glucocorticoid Modulation of Cytokine Signaling. Tissue Antigens 2006, 68, 1–12. [Google Scholar] [CrossRef]
- Tort, L. Stress and Immune Modulation in Fish. Dev. Comp. Immunol. 2011, 35, 1366–1375. [Google Scholar] [CrossRef]
- Saravia, J.; Paschke, K.; Pablo, J.; Nualart, D.; Navarro, J.M.; Vargas-chacoff, L. Effects of Temperature on the Innate Immune Response on Antarctic and Sub-Antarctic Fish Harpagifer antarcticus and Harpagifer bispinis Challenged with Two Immunostimulants, LPS and Poly I: C: In Vivo and in Vitro Approach. Fish Shellfish Immunol. 2022, 130, 391–408. [Google Scholar] [CrossRef]
- Duan, X.; Luan, Y.; Wang, Y.; Wang, X.; Su, P.; Li, Q.; Pang, Y.; He, J.; Gou, M. Tryptophan Metabolism Can Modulate Immunologic Tolerance in Primitive Vertebrate Lamprey via IDO-Kynurenine-AHR Pathway. Fish Shellfish Immunol. 2023, 132, 108485. [Google Scholar] [CrossRef]
- Grayfer, L.; Kerimoglu, B.; Yaparla, A.; Belosevic, J.X.M. Mechanisms of Fish Macrophage Antimicrobial Immunity. Front Immunol. 2018, 9, 1105. [Google Scholar] [CrossRef]
- Małaczewska, J.; Siwicki, A.K.; Wójcik, R.M.; Turski, W.A.; Kaczorek, E. The Effect of Kynurenic Acid on the Synthesis of Selected Cytokines by Murine Splenocytes—In Vitro and Ex Vivo Studies. Cent. Eur. J. Immunol. 2016, 41, 39–46. [Google Scholar] [CrossRef]
- Wish, J.; Bulloch, P.; Oswald, L.; Halldorson, T.; Raine, J.C.; Jamshed, L.; Marvin, C.; Thomas, P.J.; Holloway, A.C.; Tomy, G.T. Kynurenine to Tryptophan Ratio as a Biomarker of Acute Stress in Fish. Chemosphere 2022, 288, 132522. [Google Scholar] [CrossRef]
- Vargas-Chacoff, L.; Regish, A.M.; Weinstock, A.; McCormick, S.D. Effects of Elevated Temperature on Osmoregulation and Stress Responses in Atlantic Salmon Salmo Salar Smolts in Fresh Water and Seawater. J. Fish Biol. 2018, 93, 550–559. [Google Scholar] [CrossRef]
- Luan, Y.; Wang, Y.; Zhang, W.; Duan, X.; Su, P.; Li, Q.; Pang, Y.; Gou, M. Identification and characterization of tryptophan-kynurenine pathway-related genes involving lamprey (Lampetra japonica) innate immunity. Fish Shellfish Immunol. 2023, 140, 108967. [Google Scholar] [CrossRef]
- Machado, M.; Serra, C.R.; Oliva-Teles, A.; Costas, B. Methionine and Tryptophan Play Different Modulatory Roles in the European Seabass (Dicentrarchus labrax) Innate Immune Response and Apoptosis Signaling—An In Vitro Study. Front. Immunol. 2021, 12, 660448. [Google Scholar] [CrossRef]
- Le Floc’h, N.; Otten, W.; Merlot, E. Tryptophan Metabolism, from Nutrition to Potential Therapeutic Applications. Fish Shellfish Immunol. 2018, 9, 4435–4442. [Google Scholar] [CrossRef]
- Michael, A.F.; Drumondd, K.N.; Doeden, D.; Anderson, J.A.; Good, R.A. Tryptophan Metabolism in Man. J. Clin. Investig. 1964, 43, 1730–1746. [Google Scholar] [CrossRef]
Primer | Nucleotide Sequences (5′→3′) | Efficiency Head Kidney (%) | Efficiency Posterior Kidney (%) | |
---|---|---|---|---|
18S Fw | GTCCGGGAAACCGTC | 101.9 | 100.5 | XR_006760234.1 |
18S Rv | TTGAGTCAAATTAAGCCGCA | |||
TPH 2 Fw | AGTGTAGCTCAGTGGAGGA | 101.4 | 103.2 | XM_014125607.2 |
TPH 2 Rv | AATGCACTGGAGAGGATGTT | |||
INF γ receptor Fw | ATCGCTCCCTATTTCTCTGTG | 99.1 | 100.2 | NM_001360942.1 |
INF γ receptor Rv | CCAAGACACCCAACAGGAT | |||
KIAT 2 Fw | TGCACAGCGGAGAAGGTACAGTGG | 101.6 | 104.8 | XM_045693024.1 |
KIAT 2 Rv | GGCTCCGACAGTGACCAGGATGT | |||
5-HT 1α receptor Fw | TGGAGTGCTCAGTGACTGGT | 97.4 | 100.2 | XM_014173861.2 |
5-HT 1α receptor Rv | AGCCCTTTAGTCCAGCCTCTAC |
Tissue | Genes | Times | Control | Cortisol 200 ng/mL | Tryptophan 5 μg/mL | Tryptophan 50 μg/mL | Cortisol 200 ng/mL + Tryptophan 5 μg/mL | Cortisol 200 ng/mL + Tryptophan 50 μg/mL |
---|---|---|---|---|---|---|---|---|
Head Kidney | 5HTP1a | 1 | NS | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 |
3 | NS | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
6 | <0.01 | NS | <0.01 | <0.01 | NS | NS | ||
12 | NS | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
24 | <0.01 | <0.01 | <0.01 | <0.01 | NS | <0.01 | ||
48 | <0.01 | NS | <0.01 | NS | <0.01 | <0.01 | ||
Head Kidney | INFg | 1 | NS | <0.01 | NS | <0.01 | <0.01 | NS |
3 | <0.01 | <0.01 | <0.01 | <0.01 | NS | <0.01 | ||
6 | NS | NS | <0.01 | NS | NS | NS | ||
12 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | NS | ||
24 | <0.01 | NS | NS | <0.01 | <0.01 | <0.01 | ||
48 | <0.01 | NS | NS | NS | <0.01 | <0.01 | ||
Head Kidney | KIAT | 1 | NS | NS | <0.01 | <0.01 | <0.01 | NS |
3 | NS | NS | NS | NS | ||||
6 | NS | NS | NS | NS | NS | NS | ||
12 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
24 | <0.01 | NS | <0.01 | <0.01 | <0.01 | <0.01 | ||
48 | <0.01 | NS | NS | NS | <0.01 | <0.01 | ||
Head Kidney | TPH2 | 1 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 |
3 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
6 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
12 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
24 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
48 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 |
Tissue | Genes | Times | Control | Cortisol 200 ng/mL | Tryptophan 5 μg/mL | Tryptophan 50 μg/mL | Cortisol 200 ng/mL + Tryptophan 5 μg/mL | Cortisol 200 ng/mL + Tryptophan 50 μg/mL |
---|---|---|---|---|---|---|---|---|
Posterior Kidney | 5HTP1a | 1 | NS | <0.01 | <0.01 | <0.01 | <0.01 | NS |
3 | NS | NS | <0.01 | <0.01 | <0.01 | NS | ||
6 | NS | <0.01 | NS | NS | NS | NS | ||
12 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
24 | NS | <0.01 | <0.01 | NS | <0.01 | NS | ||
48 | NS | NS | NS | NS | <0.01 | <0.01 | ||
Posterior Kidney | INFg | 1 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 |
3 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
6 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
12 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
24 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
48 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
Posterior Kidney | KIAT | 1 | NS | <0.01 | NS | <0.01 | <0.01 | <0.01 |
3 | NS | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
6 | NS | <0.01 | <0.01 | NS | <0.01 | NS | ||
12 | <0.01 | <0.01 | NS | <0.01 | NS | <0.01 | ||
24 | <0.01 | NS | <0.01 | <0.01 | <0.01 | <0.01 | ||
48 | <0.01 | NS | <0.01 | <0.01 | <0.01 | <0.01 | ||
Posterior Kidney | TPH2 | 1 | NS | NS | NS | NS | <0.01 | <0.01 |
3 | NS | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
6 | NS | NS | NS | NS | NS | NS | ||
12 | NS | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 | ||
24 | NS | <0.01 | <0.01 | NS | <0.01 | <0.01 | ||
48 | NS | <0.01 | <0.01 | <0.01 | <0.01 | <0.01 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Vargas-Chacoff, L.; Nualart, D.; Vargas-Lagos, C.; Dann, F.; Muñoz, J.L.; Pontigo, J.P. Tryptophan and Cortisol Modulate the Kynurenine and Serotonin Transcriptional Pathway in the Kidney of Oncorhynchus kisutch. Animals 2023, 13, 3562. https://doi.org/10.3390/ani13223562
Vargas-Chacoff L, Nualart D, Vargas-Lagos C, Dann F, Muñoz JL, Pontigo JP. Tryptophan and Cortisol Modulate the Kynurenine and Serotonin Transcriptional Pathway in the Kidney of Oncorhynchus kisutch. Animals. 2023; 13(22):3562. https://doi.org/10.3390/ani13223562
Chicago/Turabian StyleVargas-Chacoff, Luis, Daniela Nualart, Carolina Vargas-Lagos, Francisco Dann, José Luis Muñoz, and Juan Pablo Pontigo. 2023. "Tryptophan and Cortisol Modulate the Kynurenine and Serotonin Transcriptional Pathway in the Kidney of Oncorhynchus kisutch" Animals 13, no. 22: 3562. https://doi.org/10.3390/ani13223562
APA StyleVargas-Chacoff, L., Nualart, D., Vargas-Lagos, C., Dann, F., Muñoz, J. L., & Pontigo, J. P. (2023). Tryptophan and Cortisol Modulate the Kynurenine and Serotonin Transcriptional Pathway in the Kidney of Oncorhynchus kisutch. Animals, 13(22), 3562. https://doi.org/10.3390/ani13223562