Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animals, Diets, and Treatments
2.2. Sample Collection
2.3. Serum IgA and Cytokine Levels
2.4. Quantitative Real-Time PCR
2.5. Ileal Microbiota Analysis
2.6. Statistical Analysis
3. Results
3.1. Expression of Genes Involving Stem Cell Proliferation in Jejunum
3.2. Serum IgA and Cytokine Level
3.3. Immune-Related Gene Expression in Jejunum
3.4. Immune-Related Gene Expression in Cecal Tonsil
3.5. Expression of Key Genes in the JAK/STAT Signaling Pathway in the Jejunum
3.6. Expression of Key Genes in the JAK/STAT Signaling Pathway in the Cecal Tonsil
3.7. Alpha Diversity of Microbiota in Ileum
3.8. Bacterial Composition at Phylum Level in Ileum
3.9. Bacterial Composition at Genus Level in Ileum
3.10. LEfSe Analysis for Biomarkers
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Abd El-Hack, M.E.; El-Saadony, M.T.; Elbestawy, A.R.; El-Shall, N.A.; Saad, A.M.; Salem, H.M.; El-Tahan, A.M.; Khafaga, A.F.; Taha, A.E.; AbuQamar, S.F.; et al. Necrotic enteritis in broiler chickens: Disease characteristics and prevention using organic antibiotic alternatives—A comprehensive review. Poult. Sci. 2022, 101, 101590. [Google Scholar] [CrossRef] [PubMed]
- Antonissen, G.; Eeckhaut, V.; Van Driessche, K.; Onrust, L.; Haesebrouck, F.; Ducatelle, R.; Moore, R.J.; Van Immerseel, F. Microbial shifts associated with necrotic enteritis. Avian Pathol. 2016, 45, 308–312. [Google Scholar] [CrossRef] [PubMed]
- Bansal, M.; Alenezi, T.; Fu, Y.; Almansour, A.; Wang, H.; Gupta, A.; Liyanage, R.; Graham, D.B.; Hargis, B.M.; Sun, X. Specific secondary bile acids control chicken necrotic enteritis. Pathogens 2021, 10, 1041. [Google Scholar] [CrossRef]
- Fathima, S.; Hakeem, W.G.A.; Shanmugasundaram, R.; Selvaraj, R.K. Necrotic enteritis in broiler chickens: A review on the pathogen, pathogenesis, and prevention. Microorganisms 2022, 10, 1958. [Google Scholar] [CrossRef] [PubMed]
- Songer, J.G. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 1996, 9, 216–234. [Google Scholar] [CrossRef] [PubMed]
- Belote, B.L.; Tujimoto-Silva, A.; Hümmelgen, P.H.; Sanches, A.W.D.; Wammes, J.C.S.; Hayashi, R.M.; Santin, E. Histological parameters to evaluate intestinal health on broilers challenged with Eimeria and Clostridium perfringens with or without enramycin as growth promoter. Poult. Sci. 2018, 97, 2287–2294. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Zheng, L.; Qi, Y.; Liu, Z.; Du, E.; Wei, J.; Zhang, Z.; Guo, S.; Ding, B. Dietary Lactobacillus fermentum and Lactobacillus paracasei improve the intestinal health of broilers challenged with coccidia and Clostridium perfringens. Front. Vet. Sci. 2022, 9, 1025677. [Google Scholar] [CrossRef] [PubMed]
- Shimizu, T.; Ohtani, K.; Hirakawa, H.; Ohshima, K.; Yamashita, A.; Shiba, T.; Ogasawara, N.; Hattori, M.; Kuhara, S.; Hayashi, H. Complete genome sequence of Clostridium perfringens, an anaerobic flesh-eater. Proc. Natl. Acad. Sci. USA 2002, 99, 996–1001. [Google Scholar] [CrossRef]
- Kiu, R.; Hall, L.J. An update on the human and animal enteric pathogen Clostridium perfringens. Emerg. Microbes Infect. 2018, 7, 141. [Google Scholar] [CrossRef]
- Righi, F.; Pitino, R.; Manuelian, C.L.; Simoni, M.; Quarantelli, A.; De Marchi, M.; Tsiplakou, E. Plant feed additives as natural alternatives to the use of synthetic antioxidant vitamins on poultry performances, health, and oxidative status: A review of the literature in the last 20 years. Antioxidants 2021, 10, 659. [Google Scholar] [CrossRef]
- Khan, R.U.; Naz, S.; Raziq, F.; Qudratullah, Q.; Khan, N.A.; Laudadio, V.; Tufarelli, V.; Ragni, M. Prospects of organic acids as safe alternative to antibiotics in broiler chickens diet. Environ. Sci. Pollut. Res. Int. 2022, 29, 32594–32604. [Google Scholar] [CrossRef] [PubMed]
- Jana, U.K.; Suryawanshi, R.K.; Prajapati, B.P.; Kango, N. Prebiotic mannooligosaccharides: Synthesis, characterization and bioactive properties. Food Chem. 2021, 342, 128328. [Google Scholar] [CrossRef] [PubMed]
- Song, B.; Li, P.; Yan, S.; Liu, Y.; Gao, M.; Lv, H.; Lv, Z.; Guo, Y. Effects of dietary astragalus polysaccharide supplementation on the Th17/Treg balance and the gut microbiota of broiler chickens challenged with necrotic enteritis. Front. Immunol. 2022, 13, 781934. [Google Scholar] [CrossRef] [PubMed]
- Cai, G.; Mao, N.; Gu, P.; Zhu, T.; He, J.; Peng, S.; Yang, Y.; Liu, Z.; Hu, Y.; Wang, D. Effects of alhagi honey polysaccharides as feed supplement on intestine function and microbiome, immune function, and growth performance in chicken. Int. J. Mol. Sci. 2022, 23, 14332. [Google Scholar] [CrossRef] [PubMed]
- Yaqoob, M.U.; El-Hack, M.E.A.; Hassan, F.; El-Saadony, M.T.; Khafaga, A.F.; Batiha, G.E.; Yehia, N.; Elnesr, S.S.; Alagawany, M.; El-Tarabily, K.A.; et al. The potential mechanistic insights and future implications for the effect of prebiotics on poultry performance, gut microbiome, and intestinal morphology. Poult. Sci. 2021, 100, 101143. [Google Scholar] [CrossRef]
- Ayalew, H.; Zhang, H.; Wang, J.; Wu, S.; Qiu, K.; Qi, G.; Tekeste, A.; Wassie, T.; Chanie, D. Potential feed additives as antibiotic alternatives in broiler production. Front. Vet. Sci. 2022, 9, 916473. [Google Scholar] [CrossRef] [PubMed]
- Eeckhaut, V.; Wang, J.; Van Parys, A.; Haesebrouck, F.; Joossens, M.; Falony, G.; Raes, J.; Ducatelle, R.; Van Immerseel, F. The probiotic Butyricicoccus pullicaecorum reduces feed conversion and protects from potentially harmful intestinal microorganisms and necrotic enteritis in broilers. Front. Microbiol. 2016, 7, 1416. [Google Scholar] [CrossRef] [PubMed]
- Kan, L.; Guo, F.; Liu, Y.; Pham, V.H.; Guo, Y.; Wang, Z. Probiotics Bacillus licheniformis improves intestinal health of subclinical necrotic enteritis-challenged broilers. Front. Microbiol. 2021, 12, 623739. [Google Scholar] [CrossRef]
- Ma, K.; Chen, W.; Lin, X.Q.; Liu, Z.Z.; Wang, T.; Zhang, J.B.; Zhang, J.G.; Zhou, C.K.; Gao, Y.; Du, C.T.; et al. Culturing the chicken intestinal microbiota and potential application as probiotics development. Int. J. Mol. Sci. 2023, 24, 3045. [Google Scholar] [CrossRef]
- Šefcová, M.A.; Ortega-Paredes, D.; Larrea-Álvarez, C.M.; Mina, I.; Guapás, V.; Ayala-Velasteguí, D.; Leoro-Garzón, P.; Molina-Cuasapaz, G.; Vinueza-Burgos, C.; Revajová, V.; et al. Effects of Lactobacillus fermentum administration on intestinal morphometry and antibody serum levels in Salmonella-infantis-challenged chickens. Microorganisms 2023, 11, 256. [Google Scholar] [CrossRef]
- Šefcová, M.; Larrea-Álvarez, M.; Larrea-Álvarez, C.; Karaffová, V.; Revajová, V.; Gancarčíková, S.; Ševčíková, Z.; Herich, R. Lactobacillus fermentum administration modulates cytokine expression and lymphocyte subpopulation levels in broiler chickens challenged with Campylobacter coli. Foodborne Pathog. Dis. 2020, 17, 485–493. [Google Scholar] [CrossRef] [PubMed]
- Xu, Y.; Tian, Y.; Cao, Y.; Li, J.; Guo, H.; Su, Y.; Tian, Y.; Wang, C.; Wang, T.; Zhang, L. Probiotic properties of Lactobacillus paracasei subsp. paracasei L1 and its growth performance-promotion in chicken by improving the intestinal microflora. Front. Physiol. 2019, 10, 937. [Google Scholar] [CrossRef] [PubMed]
- Wu, H.; Xie, S.; Miao, J.; Li, Y.; Wang, Z.; Wang, M.; Yu, Q. Lactobacillus reuteri maintains intestinal epithelial regeneration and repairs damaged intestinal mucosa. Gut Microbes 2020, 11, 997–1014. [Google Scholar] [CrossRef] [PubMed]
- Guo, S.; Xi, Y.; Xia, Y.; Wu, T.; Zhao, D.; Zhang, Z.; Ding, B. Dietary Lactobacillus fermentum and Bacillus coagulans supplementation modulates intestinal immunity and microbiota of broiler chickens challenged by Clostridium perfringens. Front. Vet. Sci. 2021, 8, 680742. [Google Scholar] [CrossRef] [PubMed]
- Azarin, H.; Aramli, M.S.; Imanpour, M.R.; Rajabpour, M. Effect of a probiotic containing Bacillus licheniformis and Bacillus subtilis and ferroin solution on growth performance, body composition and haematological parameters in Kutum (Rutilus frisii kutum) fry. Probiotics Antimicrob. Proteins 2015, 7, 31–37. [Google Scholar] [CrossRef] [PubMed]
- Lutful Kabir, S.M. The role of probiotics in the poultry industry. Int. J. Mol. Sci. 2009, 10, 3531–3546. [Google Scholar] [CrossRef] [PubMed]
- Khan, S.; Moore, R.J.; Stanley, D.; Chousalkar, K.K. The gut microbiota of laying hens and its manipulation with prebiotics and probiotics to enhance gut health and food safety. Appl. Environ. Microbiol. 2020, 86, e00600–e00620. [Google Scholar] [CrossRef] [PubMed]
- Miyajima, A.; Tanaka, M.; Itoh, T. Stem/progenitor cells in liver development, homeostasis, regeneration, and reprogramming. Cell Stem Cell 2014, 14, 561–574. [Google Scholar] [CrossRef]
- Vitale, I.; Manic, G.; De Maria, R.; Kroemer, G.; Galluzzi, L. DNA damage in stem cells. Mol. Cell 2017, 66, 306–319. [Google Scholar] [CrossRef]
- Gehart, H.; Clevers, H. Tales from the crypt: New insights into intestinal stem cells. Nat. Rev. Gastroenterol. Hepatol. 2019, 16, 19–34. [Google Scholar] [CrossRef]
- Van der Flier, L.G.; Clevers, H. Stem cells, self-renewal, and differentiation in the intestinal epithelium. Annu. Rev. Physiol. 2009, 71, 241–260. [Google Scholar] [CrossRef]
- Mah, A.T.; Yan, K.S.; Kuo, C.J. Wnt pathway regulation of intestinal stem cells. J. Physiol. 2016, 594, 4837–4847. [Google Scholar] [CrossRef] [PubMed]
- Panek, M.; Grabacka, M.; Pierzchalska, M. The formation of intestinal organoids in a hanging drop culture. Cytotechnology 2018, 70, 1085–1095. [Google Scholar] [CrossRef] [PubMed]
- Koo, B.K.; Spit, M.; Jordens, I.; Low, T.Y.; Stange, D.E.; van de Wetering, M.; van Es, J.H.; Mohammed, S.; Heck, A.J.; Maurice, M.M.; et al. Tumour suppressor RNF43 is a stem-cell E3 ligase that induces endocytosis of Wnt receptors. Nature 2012, 488, 665–669. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.; Zhou, Z.; Yu, L.; Jiang, K.; Xia, J.; Mi, Y.; Zhang, C.; Li, J. Lactobacillus salivarius and Lactobacillus agilis feeding regulates intestinal stem cells activity by modulating crypt niche in hens. Appl. Microbiol. Biotechnol. 2021, 105, 8823–8835. [Google Scholar] [CrossRef]
- Pierzchalska, M.; Panek, M.; Czyrnek, M.; Gielicz, A.; Mickowska, B.; Grabacka, M. Probiotic Lactobacillus acidophilus bacteria or synthetic TLR2 agonist boost the growth of chicken embryo intestinal organoids in cultures comprising epithelial cells and myofibroblasts. Comp. Immunol. Microbiol. Infect. Dis. 2017, 53, 7–18. [Google Scholar] [CrossRef] [PubMed]
- Xie, S.; Zhao, S.; Jiang, L.; Lu, L.; Yang, Q.; Yu, Q. Lactobacillus reuteri stimulates intestinal epithelial proliferation and induces differentiation into goblet cells in young chickens. J. Agric. Food Chem. 2019, 67, 13758–13766. [Google Scholar] [CrossRef] [PubMed]
- Hou, Q.; Ye, L.; Liu, H.; Huang, L.; Yang, Q.; Turner, J.R.; Yu, Q. Lactobacillus accelerates ISCs regeneration to protect the integrity of intestinal mucosa through activation of STAT3 signaling pathway induced by LPLs secretion of IL-22. Cell Death Differ. 2018, 25, 1657–1670. [Google Scholar] [CrossRef]
- Sanmarco, L.M.; Chao, C.C.; Wang, Y.C.; Kenison, J.E.; Li, Z.; Rone, J.M.; Rejano-Gordillo, C.M.; Polonio, C.M.; Gutierrez-Vazquez, C.; Piester, G.; et al. Identification of environmental factors that promote intestinal inflammation. Nature 2022, 611, 801–809. [Google Scholar] [CrossRef]
- Platanias, L.C. Mechanisms of type-I- and type-II-interferon-mediated signalling. Nat. Rev. Immunol. 2005, 5, 375–386. [Google Scholar] [CrossRef]
- Chen, K.; Liu, J.; Cao, X. Regulation of type I interferon signaling in immunity and inflammation: A comprehensive review. J. Autoimmun. 2017, 83, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Zhang, B.; Gan, L.; Shahid, M.S.; Lv, Z.; Fan, H.; Liu, D.; Guo, Y. In vivo and in vitro protective effect of arginine against intestinal inflammatory response induced by Clostridium perfringens in broiler chickens. J. Anim. Sci. Biotechnol. 2019, 10, 73. [Google Scholar] [CrossRef] [PubMed]
- Ott, N.; Faletti, L.; Heeg, M.; Andreani, V.; Grimbacher, B. JAKs and STATs from a clinical perspective: Loss-of-function mutations, gain-of-function mutations, and their multidimensional consequences. J. Clin. Immunol. 2023, 43, 1326–1359. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Wang, Z.; Dong, Y.; Cao, J.; Chen, Y. Effects of different monochromatic light combinations on cecal microbiota composition and cecal tonsil T lymphocyte proliferation. Front. Immunol. 2022, 13, 849780. [Google Scholar] [CrossRef] [PubMed]
- Yitbarek, A.; Echeverry, H.; Munyaka, P.; Rodriguez-Lecompte, J.C. Innate immune response of pullets fed diets supplemented with prebiotics and synbiotics. Poult. Sci. 2015, 94, 1802–1811. [Google Scholar] [CrossRef]
- Sommer, F.; Anderson, J.M.; Bharti, R.; Raes, J.; Rosenstiel, P. The resilience of the intestinal microbiota influences health and disease. Nat. Rev. Microbiol. 2017, 15, 630–638. [Google Scholar] [CrossRef]
- Li, Z.; Wang, W.; Liu, D.; Guo, Y. Effects of Lactobacillus acidophilus on gut microbiota composition in broilers challenged with Clostridium perfringens. PLoS ONE 2017, 12, e0188634. [Google Scholar] [CrossRef]
- Zhang, B.; Lv, Z.; Li, Z.; Wang, W.; Li, G.; Guo, Y. Dietary l-arginine supplementation alleviates the intestinal injury and modulates the gut microbiota in broiler chickens challenged by Clostridium perfringens. Front. Microbiol. 2018, 9, 1716. [Google Scholar] [CrossRef]
- Zi, J.; Pan, X.; MacIsaac, H.J.; Yang, J.; Xu, R.; Chen, S.; Chang, X. Cyanobacteria blooms induce embryonic heart failure in an endangered fish species. Aquat. Toxicol. 2018, 194, 78–85. [Google Scholar] [CrossRef]
- Mohamed, T.M.; Sun, W.; Bumbie, G.Z.; Elokil, A.A.; Mohammed, K.A.F.; Zebin, R.; Hu, P.; Wu, L.; Tang, Z. Feeding Bacillus subtilis ATCC19659 to broiler chickens enhances growth performance and immune function by modulating intestinal morphology and cecum microbiota. Front. Microbiol. 2021, 12, 798350. [Google Scholar] [CrossRef]
- Xu, S.; Lin, Y.; Zeng, D.; Zhou, M.; Zeng, Y.; Wang, H.; Zhou, Y.; Zhu, H.; Pan, K.; Jing, B.; et al. Bacillus licheniformis normalize the ileum microbiota of chickens infected with necrotic enteritis. Sci. Rep. 2018, 8, 1744. [Google Scholar] [CrossRef]
- Singh, K.M.; Shah, T.; Deshpande, S.; Jakhesara, S.J.; Koringa, P.G.; Rank, D.N.; Joshi, C.G. High through put 16S rRNA gene-based pyrosequencing analysis of the fecal microbiota of high FCR and low FCR broiler growers. Mol. Biol. Rep. 2012, 39, 10595–10602. [Google Scholar] [CrossRef]
- Fan, L.; Qi, Y.; Qu, S.; Chen, X.; Li, A.; Hendi, M.; Xu, C.; Wang, L.; Hou, T.; Si, J.; et al. B. adolescentis ameliorates chronic colitis by regulating Treg/Th2 response and gut microbiota remodeling. Gut Microbes 2021, 13, 1826746. [Google Scholar] [CrossRef] [PubMed]
- Van Zyl, W.F.; Deane, S.M.; Dicks, L.M.T. Molecular insights into probiotic mechanisms of action employed against intestinal pathogenic bacteria. Gut Microbes 2020, 12, 1831339. [Google Scholar] [CrossRef] [PubMed]
- Mangifesta, M.; Mancabelli, L.; Milani, C.; Gaiani, F.; de’Angelis, N.; de’Angelis, G.L.; van Sinderen, D.; Ventura, M.; Turroni, F. Mucosal microbiota of intestinal polyps reveals putative biomarkers of colorectal cancer. Sci. Rep. 2018, 8, 13974. [Google Scholar] [CrossRef] [PubMed]
- Gerritsen, J.; Fuentes, S.; Grievink, W.; van Niftrik, L.; Tindall, B.J.; Timmerman, H.M.; Rijkers, G.T.; Smidt, H. Characterization of Romboutsia ilealis gen. nov., sp. nov., isolated from the gastro-intestinal tract of a rat, and proposal for the reclassification of five closely related members of the genus Clostridium into the genera Romboutsia gen. nov., Intestinibacter gen. nov., Terrisporobacter gen. nov. and Asaccharospora gen. nov. Int. J. Syst. Evol. Microbiol. 2014, 64, 1600–1616. [Google Scholar] [PubMed]
- Liang, G.; Malmuthuge, N.; Bao, H.; Stothard, P.; Griebel, P.J.; Guan, L.L. Transcriptome analysis reveals regional and temporal differences in mucosal immune system development in the small intestine of neonatal calves. BMC Genom. 2016, 17, 602. [Google Scholar] [CrossRef]
- Umesaki, Y.; Okada, Y.; Matsumoto, S.; Imaoka, A.; Setoyama, H. Segmented filamentous bacteria are indigenous intestinal bacteria that activate intraepithelial lymphocytes and induce MHC class II molecules and fucosyl asialo GM1 glycolipids on the small intestinal epithelial cells in the ex-germ-free mouse. Microbiol. Immunol. 1995, 39, 555–562. [Google Scholar] [CrossRef]
- Gaboriau-Routhiau, V.; Rakotobe, S.; Lécuyer, E.; Mulder, I.; Lan, A.; Bridonneau, C.; Rochet, V.; Pisi, A.; De Paepe, M.; Brandi, G.; et al. The key role of segmented filamentous bacteria in the coordinated maturation of gut helper T cell responses. Immunity 2009, 31, 677–689. [Google Scholar] [CrossRef]
Ingredient, % | Days 0–19 | Nutrient and Energy Composition 3 | Days 0–19 |
---|---|---|---|
Wheat | 68.69 | ME, kcal/kg | 2930 |
Soybean meal | 20.32 | Crude protein, % | 21.61 |
Fish meal | 5.00 | Lysine, % | 1.16 |
Soybean oil | 2.50 | Methionine, % | 0.60 |
CaHPO4 | 1.20 | Methionine + Cystine, % | 0.91 |
Stone powder | 1.10 | Calcium, % | 1.13 |
NaCl | 0.35 | Available phosphorus, % | 0.48 |
DL-Met | 0.26 | Threonine, % | 0.75 |
Choline chloride, 50% | 0.20 | Sodium, % | 0.14 |
Mineral premix 1 | 0.20 | ||
L-Lys HCl, 78% | 0.15 | ||
Vitamin premix 2 | 0.03 | ||
Total | 100.00 |
Gene Name | Accession Number | Primer Sequence (5′–3′) | Product Size [25] |
---|---|---|---|
Lgr5 | XM_205518.1 | CCTTTATCAGCCCAGAAGTGA | 136 |
TGGAACAAATGCTACGGATG | |||
Znrf3 | M_015275473.1 | GCCTCTACCAAGCCCAATCT | 130 |
GGTCGTCGGAAGTTGTGAG | |||
Olfm4 | NM_001040463.1 | GACTGGCTCTCTGGATGACC | 108 |
AGCGTTGTGGCTATCACTTG | |||
Hopx | NM_204556.1 | GCAAGGTGAACAAGCATCC | 227 |
CCCAAGTAAACCCACTCTGAA | |||
cdxA | NM_204676.2 | CAGTGAGTGTCCCCCATGTC | 92 |
GGGACAGATGTCTGCAGGTC | |||
cdxB | NM_204614.1 | ATCTGGTTCCAGAATCGCCG | 141 |
TGGTGGGAACAGGGAACTTG | |||
IL-1β | NM_204524 | ACTGGGCATCAAGGGCTA | 131 |
GGTAGAAGATGAAGCGGGTC | |||
iNOS | U46505 | CAGCTGATTGGGTGTGGAT | 158 |
TTTCTTTGGCCTACGGGTC | |||
TNF-α | NM_204267 | GAGCGTTGACTTGGCTGTC | 64 |
AAGCAACAACCAGCTATGCAC | |||
IFN-γ | NM_205149.1 | AGCTGACGGTGGACCTATTATT | 259 |
GGCTTTGCGCTGGATTC | |||
TGF-β4 | M31160 | CGGGACGGATGAGAAGAAC | 258 |
CGGCCCACGTAGTAAATGAT | |||
IL-13 | AJ621735 | CCAGGGCATCCAGAAGC | 256 |
CAGTGCCGGCAAGAAGTT | |||
JAK1 | XM_015290965.1 | TGCACCGTGACTTAGCAGCAAG | 168 |
TCTGAATCAAGCATTCTGGAGCATACC | |||
JAK2 | XM_015280061.1 | TCGCTATGGCATTATTCG | 197 |
GTGGGGTTTGGTCCTTTT | |||
JAK3 | NM_204996 | CAGCCCCAACCAGATGTC | 106 |
CCGCTTGATGCCTTTGTAG | |||
STAT1 | XM_015289392.1 | TAAAGAGGGAGCAATCAC | 112 |
ATCAGGGAAAGTAACAGC | |||
STAT3 | NM_001030931 | AGGGCCAGGTGTGAACTACT | 98 |
CCAGCCAGACCCAGAAAG | |||
STAT5 | NM_204779 | CCCACCCCCATTACAACA | 114 |
GCAGCAGCTCCTCCACAT | |||
STAT6 | XM_015274736.1 | GCAACCTCTACCCCAACA | 127 |
TCCCTTTCGCTTTCCACT | |||
TYK2 | XM_427671 | GCCCCATGCAGGAGGAAT | 119 |
CTTTGCCACAGCCAGAATCAC | |||
TAK1 | XM_015284677 | CCAGGAAACGGACAGCAGAG | 135 |
GGTTGGTCCCGAGGTAGTGA | |||
SHP2 | NM_204968 | ATGTTGGTGGAGGGGAGAA | 108 |
GGGGCTGCTTGAGTTGC | |||
SOCS1 | NM_001137648 | CTACTGGGGACCGCTGACC | 117 |
TTAACACTGATGGCAAAGAAACAA | |||
NF-κB p65 | NM_205129 | GTGTGAAGAAACGGGAACTG | 203 |
GGCACGGTTGTCATAGATGG | |||
TGGTGGGAACAGGGAACTTG | |||
Actin | NM_205518 | GAGAAATTGTGCGTGACATCA | 152 |
CCTGAACCTCTCATTGCCA |
Items | CTR | CCP | LF_CCP | LP_CCP | SEM | p Values |
---|---|---|---|---|---|---|
Day 13 | ||||||
Shannon | 2.68 b | 2.88 b | 4.20 a | 3.17 ab | 0.20 | 0.028 |
Simpson | 0.67 b | 0.64 b | 0.83 a | 0.69 ab | 0.03 | 0.067 |
Chao1 | 551.65 | 605.25 | 974.46 | 709.70 | 82.54 | 0.282 |
Ace | 578.86 | 625.59 | 1015.19 | 727.72 | 84.09 | 0.260 |
Day 19 | ||||||
Shannon | 3.01 | 3.90 | 3.47 | 2.30 | 0.29 | 0.240 |
Simpson | 0.66 | 0.73 | 0.67 | 0.61 | 0.04 | 0.934 |
Chao1 | 720.14 ab | 1001.97 a | 865.56 ab | 276.30 b | 108.35 | 0.004 |
Ace | 682.06 ab | 1030.91 a | 899.93 a | 295.84 b | 105.17 | 0.001 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, S.; Tong, W.; Qi, Y.; Jiang, M.; Li, P.; Zhang, Z.; Hu, Q.; Song, Z.; Ding, B. Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens. Animals 2023, 13, 3864. https://doi.org/10.3390/ani13243864
Guo S, Tong W, Qi Y, Jiang M, Li P, Zhang Z, Hu Q, Song Z, Ding B. Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens. Animals. 2023; 13(24):3864. https://doi.org/10.3390/ani13243864
Chicago/Turabian StyleGuo, Shuangshuang, Wenfei Tong, Ya Qi, Meihan Jiang, Peng Li, Zhengfan Zhang, Qunbing Hu, Zhuan Song, and Binying Ding. 2023. "Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens" Animals 13, no. 24: 3864. https://doi.org/10.3390/ani13243864
APA StyleGuo, S., Tong, W., Qi, Y., Jiang, M., Li, P., Zhang, Z., Hu, Q., Song, Z., & Ding, B. (2023). Effects of Dietary Limosilactobacillus fermentum and Lacticaseibacillus paracasei Supplementation on the Intestinal Stem Cell Proliferation, Immunity, and Ileal Microbiota of Broiler Chickens Challenged by Coccidia and Clostridium perfringens. Animals, 13(24), 3864. https://doi.org/10.3390/ani13243864