Localization of Chicken Rab22a in Cells and Its Relationship to BF or Ii Molecules and Genes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Source of Cells, Plasmids, and Other Materials
2.2. Construction of Recombinant Plasmids
2.3. Alignment of Chicken and Mouse Amino Acid Sequences and 3D Protein Structures
2.4. Gene Overexpression and Silencing
2.5. Intracellular Localization
2.6. Confocal Observation
2.7. Co-Immunoprecipitation (Co-IP) and Western Blotting
2.8. Statistical Analysis
3. Results
3.1. Amino Acid Sequences Alignment of cRab22a Protein and mRab22a Protein and Construction of Their 3D Structures
3.2. Co-Localization of cRab22a in Early and Late Endosomes
3.3. Intracellular Co-Localization of Recombinant Plasmids of cRab22a and Its Mutants with cIi
3.4. Effects of cRab22a Gene Silencing and Overexpression of BFα and cIi Gene
3.5. Interaction of cRab22a with BF and cIi Molecules
4. Discussion
5. Conclusions
- Main Findings
- Intracellular localization of chicken Rab22a (cRab22a) in early and late endosomes can be observed with specific antibodies against EEA1 and LAMP1 respectively. Meanwhile, cRab22a can be co-localized with cIi in the endocytosis
- The protein structures of chicken and mouse Rab22a were highly homologous (95.4%), and both localize to the early and late endosomes. Ser41 and Tyr74 are key amino acids in the Switch regions of Rab22a which maintain its intracellular localization.
- Interference with the expression of the cRab22a gene can down-regulate the expressions of BFa and Ii genes, while high expression of the cRab22a gene can affect the expression of BFa gene but not Ii. As well, cRab22a cannot interact directly with these two molecules.
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Yuan, Y.; Zhang, H.; Yi, G.; You, Z.; Zhao, C.; Yuan, H.; Wang, K.; Li, J.; Yang, N.; Lian, L. Genetic Diversity of MHC BF/BL Region in 21 Chicken Populations. Front. Genet. 2021, 12, 710770. [Google Scholar] [CrossRef] [PubMed]
- Anderson, M.S.; Miller, J. Invariant Chain Can Function as a Chaperone Protein for Class II Major Histocompatibility Complex Molecules. Proc. Natl. Acad. Sci. USA 1992, 89, 2282–2286. [Google Scholar] [CrossRef] [Green Version]
- Neefjes, J.; Jongsma, M.L.M.; Paul, P.; Bakke, O. Towards a Systems Understanding of MHC Class I and MHC Class II Antigen Presentation. Nat. Rev. Immunol. 2011, 11, 823–836. [Google Scholar] [CrossRef]
- Basha, G.; Omilusik, K.; Chavez-Steenbock, A.; Reinicke, A.T.; Lack, N.; Choi, K.B.; Jefferies, W.A. A CD74-Dependent MHC Class I Endolysosomal Cross-Presentation Pathway. Nat. Immunol. 2012, 13, 237–245. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Margiotta, A.; Frei, D.M.; Sendstad, I.H.; Janssen, L.; Neefjes, J.; Bakke, O. Invariant Chain Regulates Endosomal Fusion and Maturation through an Interaction with the SNARE Vti1b. J. Cell Sci. 2020, 133, jcs244624. [Google Scholar] [CrossRef] [PubMed]
- Ye, L.; Liu, X.; Rout, S.N.; Li, Z.; Yan, Y.; Lu, L.; Kamala, T.; Nanda, N.K.; Song, W.; Samal, S.K.; et al. The MHC Class II-Associated Invariant Chain Interacts with the Neonatal Fcγ Receptor and Modulates Its Trafficking to Endosomal/Lysosomal Compartments. J. Immunol. 2008, 181, 2572–2585. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schröder, B. The Multifaceted Roles of the Invariant Chain CD74—More than Just a Chaperone. Biochim. Biophys. Acta Mol. Cell Res. 2016, 1863, 1269–1281. [Google Scholar] [CrossRef]
- Schneppenheim, J.; Loock, A.-C.; Hüttl, S.; Schweizer, M.; Lüllmann-Rauch, R.; Oberg, H.-H.; Arnold, P.; Lehmann, C.H.K.; Dudziak, D.; Kabelitz, D.; et al. The Influence of MHC Class II on B Cell Defects Induced by Invariant Chain/CD74 N-Terminal Fragments. J. Immunol. 2017, 199, 172–185. [Google Scholar] [CrossRef] [Green Version]
- Barr, F.A. Rab GTPases and Membrane Identity: Causal or Inconsequential? J. Cell Biol. 2013, 202, 191–199. [Google Scholar] [CrossRef] [Green Version]
- Diekmann, Y.; Seixas, E.; Gouw, M.; Tavares-Cadete, F.; Seabra, M.C.; Pereira-Leal, J.B. Thousands of Rab GTPases for the Cell Biologist. PLoS Comput. Biol. 2011, 7, e1002217. [Google Scholar] [CrossRef]
- Mitra, S.; Cheng, K.W.; Mills, G.B. Rab GTPases Implicated in Inherited and Acquired Disorders. Semin. Cell Dev. Biol. 68, 57–68. [CrossRef] [Green Version]
- van Kasteren, S.I.; Overkleeft, H.S. Endo-Lysosomal Proteases in Antigen Presentation. Curr. Opin. Chem. Biol. 2014, 23, 8–15. [Google Scholar] [CrossRef] [PubMed]
- Stahl, M.; Holzinger, J.; Bülow, S.; Goepferich, A.M. Enzyme-Triggered Antigen Release Enhances Cross-Presentation by Dendritic Cells. Nanomed. Nanotechnol. Biol. Med. 2022, 42, 102545. [Google Scholar] [CrossRef] [PubMed]
- Rashid, M.; Liu, J.; Guan, G.; Wang, J.; Li, Z.; Hassan, M.A.; Rashid, M.I.; Mukhtar, M.U.; Luo, J.; Yin, H. In Vitro Influence of Theileria Annulata on the Functions of Bovine Dendritic Cells for Stimulation of T Lymphocyte Proliferation. Parasitology 2020, 147, 39–49. [Google Scholar] [CrossRef] [PubMed]
- Wandinger-Ness, A.; Zerial, M. Rab Proteins and the Compartmentalization of the Endosomal System. Cold Spring Harb. Perspect. Biol. 2014, 6, a022616. [Google Scholar] [CrossRef] [Green Version]
- Mesa, R.; Salomón, C.; Roggero, M.; Stahl, P.D.; Mayorga, L.S. Rab22a Affects the Morphology and Function of the Endocytic Pathway. J. Cell Sci. 2001, 114, 4041–4049. [Google Scholar] [CrossRef] [PubMed]
- Weigert, R.; Yeung, A.C.; Li, J.; Donaldson, J.G. Rab22a Regulates the Recycling of Membrane Proteins Internalized Independently of Clathrin. Mol. Biol. Cell 2004, 15, 3758–3770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Magadán, J.G.; Barbieri, M.A.; Mesa, R.; Stahl, P.D.; Mayorga, L.S. Rab22a Regulates the Sorting of Transferrin to Recycling Endosomes. Mol. Cell. Biol. 2006, 26, 2595–2614. [Google Scholar] [CrossRef] [Green Version]
- Johnson, D.L.; Wayt, J.; Wilson, J.M.; Donaldson, J.G. Arf6 and Rab22 Mediate T Cell Conjugate Formation by Regulating Clathrin-Independent Endosomal Membrane Trafficking. J. Cell Sci. 2017, 130, 2405–2415. [Google Scholar] [CrossRef] [Green Version]
- Wang, T.; Liu, Y.; Sun, Y.; Zhang, L.; Guo, K.; Zhang, Y. Rab22a Cooperates with Rab5 and NS4B in Classical Swine Fever Virus Entry Process. Vet. Microbiol. 2022, 266, 109363. [Google Scholar] [CrossRef]
- Shakya, S.; Sharma, P.; Bhatt, A.M.; Jani, R.A.; Delevoye, C.; Gangi Setty, S.R. Rab22A Recruits BLOC-1 and BLOC-2 to Promote the Biogenesis of Recycling Endosomes. EMBO Rep. 2018, 19, e45918. [Google Scholar] [CrossRef]
- Barral, D.C.; Cavallari, M.; McCormick, P.J.; Garg, S.; Magee, A.I.; Bonifacino, J.S.; De Libero, G.; Brenner, M.B. CD1a and MHC Class I Follow a Similar Endocytic Recycling Pathway. Traffic 2008, 9, 1446–1457. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Cebrian, I.; Croce, C.; Guerrero, N.A.; Blanchard, N.; Mayorga, L.S. Rab22a Controls MHC-I Intracellular Trafficking and Antigen Cross-Presentation by Dendritic Cells. EMBO Rep. 2016, 17, 1753–1765. [Google Scholar] [CrossRef] [Green Version]
- Naj, X.; Linder, S. ER-Coordinated Activities of Rab22a and Rab5a Drive Phagosomal Compaction and Intracellular Processing of Borrelia Burgdorferi by Macrophages. Cell Rep. 2015, 12, 1816–1830. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Progida, C.; Cogli, L.; Piro, F.; De Luca, A.; Bakke, O.; Bucci, C. Rab7b Controls Trafficking from Endosomes to the TGN. J. Cell Sci. 2010, 123, 1480–1491. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nair-Gupta, P.; Baccarini, A.; Tung, N.; Seyffer, F.; Florey, O.; Huang, Y.; Banerjee, M.; Overholtzer, M.; Roche, P.A.; Tampé, R.; et al. TLR Signals Induce Phagosomal MHC-I Delivery from the Endosomal Recycling Compartment to Allow Cross-Presentation. Cell 2014, 158, 506–521. [Google Scholar] [CrossRef] [Green Version]
- Ghittoni, R.; Napolitani, G.; Benati, D.; Uliveri, C.; Patrussi, L.; Laghi Pasini, F.; Lanzavecchia, A.; Baldari, C.T. Simvastatin Inhibits the MHC Class II Pathway of Antigen Presentation by Impairing Ras Superfamily GTPases. Eur. J. Immunol. 2006, 36, 2885–2893. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Raheem, M.A.; Han, C.; Yu, F.; Dai, Y.; Imran, M.; Hong, Q.; Tan, Y.; Zha, L.; Chen, F.; et al. The Fowl Adenovirus Serotype 4 (FAdV-4) Induce Cellular Pathway in Chickens to Produce Interferon and Antigen-Presented Molecules (MHCI/II). Poult. Sci. 2021, 100, 101406. [Google Scholar] [CrossRef] [PubMed]
- Eathiraj, S.; Pan, X.; Ritacco, C.; Lambright, D.G. Structural Basis of Family-Wide Rab GTPase Recognition by Rabenosyn-5. Nature 2005, 436, 415–419. [Google Scholar] [CrossRef] [Green Version]
- Kaufman, J. From Chickens to Humans: The Importance of Peptide Repertoires for MHC Class I Alleles. Front. Immunol. 2020, 11, 601089. [Google Scholar] [CrossRef]
- Kaufman, J. The Avian Major Histocompatibility Complex. In Avian Immunology; Elsevier: Edinburgh, UK, 2022; pp. 135–161. [Google Scholar] [CrossRef]
- Nikbakht, G.; Houshmand, P.; Esmailnejad, A.; Abasabadi, F. Major Histocompatibility Complex as Marker Assisted Selection for Breeding Immunocompetent Animal. Iran. J. Vet. Med. 2022, 16, 211–227. [Google Scholar]
- Chen, F.; Pan, L.; Zhang, J.; Zhou, X.; Li, J.; Yu, W. Allele-Dependent Association of Chicken MHC Class I Molecules with the Invariant Chain. Vet. Immunol. Immunopathol. 2014, 160, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Meyer-Siegler, K.L.; Iczkowski, K.A.; Leng, L.; Bucala, R.; Vera, P.L. Inhibition of Macrophage Migration Inhibitory Factor or Its Receptor (CD74) Attenuates Growth and Invasion of DU-145 Prostate Cancer Cells. J. Immunol. 2006, 177, 8730–8739. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shi, X.; Leng, L.; Wang, T.; Wang, W.; Du, X.; Li, J.; McDonald, C.; Chen, Z.; Murphy, J.W.; Lolis, E.; et al. CD44 Is the Signaling Component of the Macrophage Migration Inhibitory Factor-CD74 Receptor Complex. Immunity 2006, 25, 595–606. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lue, H.; Kapurniotu, A.; Fingerle-Rowson, G.; Roger, T.; Leng, L.; Thiele, M.; Calandra, T.; Bucala, R.; Bernhagen, J. Rapid and Transient Activation of the ERK MAPK Signalling Pathway by Macrophage Migration Inhibitory Factor (MIF) and Dependence on JAB1/CSN5 and Src Kinase Activity. Cell. Signal. 2006, 18, 688–703. [Google Scholar] [CrossRef] [PubMed]
- Binsky, I.; Haran, M.; Starlets, D.; Gore, Y.; Lantner, F.; Harpaz, N.; Leng, L.; Goldenberg, D.M.; Shvidel, L.; Berrebi, A.; et al. IL-8 Secreted in a Macrophage Migration-Inhibitory Factor-and CD74-Dependent Manner Regulates B Cell Chronic Lymphocytic Leukemia Survival. Proc. Natl. Acad. Sci. USA 2007, 104, 13408–13413. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Schwartz, V.; Krüttgen, A.; Weis, J.; Weber, C.; Ostendorf, T.; Lue, H.; Bernhagen, J. Role for CD74 and CXCR4 in Clathrin-Dependent Endocytosis of the Cytokine MIF. Eur. J. Cell Biol. 2012, 91, 435–449. [Google Scholar] [CrossRef] [PubMed]
Amplification Region or Substituted Amino Acids | Functional Region | Primer Sequences (5′-3′) | Enzymes | Recombinant Plasmids (585bp) | Templates |
---|---|---|---|---|---|
cRab22a ORF | F: GTCCGGACTCAGATCTCGAGCTATGGCTCTGAGGGAGCTGAAA R: TATCTAGATCCGGTGGATCCTCAACAGCAGCTGCGCTTTGT | Xho I Bam H I | pmCherry-C1-cRab22a | cDNA | |
mRab22a ORF | F: ACGCCTCGAGCTATGGCGCTGAGGGAAC R: AGAGAGTCGACTCAGCAGCAGCTTCGC | Xho I Sal I | pmCherry-C1-mRab22a | cDNA | |
41 | Switch I region | F1:CAATAGGAGCCGCCTTTATGACCAAG R1:TGGTCATAAAGGCGGCTCCTATTGTT | pmCherry-C1-cRab22a(S41A) | pmCherry-C1-cRab22a | |
74 | Switch II region | F1: TTTAGCTCCAATGGCGTATAGAGGGTCA R1:GACCCTCTATACGCCATTGGAGCTAAAG | pmCherry-C1-cRab22a(Y74A) | pmCherry-C1-cRab22a | |
64 | β-folds | F1:ACAGCTGGATTAGAACGGTT R1:AACCGTTCTAATCCAGCTGT | pmCherry-C1-cRab22a(Q64L) | pmCherry-C1-cRab22a | |
36–41 | Switch I region | F1:CAACATCAACGCCGCAGCTGCGGATGCCTTTATGACCAAG R1:TTGGTCATAAAGGCATCCGCAGCTGCGGCGTTGATGTTGG | pmCherry-C1-cRab22a(M36–41aa) | pmCherry-C1-cRab22a | |
42–46 | Switch I region | F1: AGGAGCCTCAGCCGCAGCTGCGGCCGTACAGTATCAAAAT R1: GATACTGTACGGCCGCAGCTGCGGCTGAGGCTCCTATTAT | pmCherry-C1-cRab22a(M42–46aa) | pmCherry-C1-cRab22a | |
70–75 | β-folds | F1: GGTTTCGTGCTGCCGATGCAGCTGCGGCCAGAGGGTCAGC R1: CTGACCCTCTGGCCGCAGCTGCATCGGCAGCACGAAACCG | pmCherry-C1-cRab22a(M70–75aa) | pmCherry-C1-cRab22a | |
74–75 | Switch II region | F1: CTTTAGCTCCAATGGCGGCCAGAGGGTCAGCAGC R1: CTGACCCTCTGGCCGCCATTGGAGCTAAAGCACG | pmCherry-C1-cRab22a(M74–75aa) | pmCherry-C1-cRab22a | |
75 | Switch II region | F1: GCTCCAATGTACGCCAGAGGGTCAGCAG R1: GCTGACCCTCTGGCGTACATTGGAGCTA | pmCherry-C1-cRab22a(Y75A) | pmCherry-C1-cRab22a | |
cRab22a ORF | F: GGTCGACCGAGATCTCTCGAGGTATGGCTCTGAGGGAGCTGAA R: ATCCCCGCGGCCGCGGTACGGATCCTCAACAGCAGCTGCGCTTT | Xho I Bam H I | pCMV-Myc-cRab22a | pmCherry-C1-cRab22a |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yu, F.; Raheem, M.A.; Tan, Y.; Rahim, M.A.; Zha, L.; Zhang, J.; Zhu, Z.; Li, Z.; Chen, F. Localization of Chicken Rab22a in Cells and Its Relationship to BF or Ii Molecules and Genes. Animals 2023, 13, 387. https://doi.org/10.3390/ani13030387
Yu F, Raheem MA, Tan Y, Rahim MA, Zha L, Zhang J, Zhu Z, Li Z, Chen F. Localization of Chicken Rab22a in Cells and Its Relationship to BF or Ii Molecules and Genes. Animals. 2023; 13(3):387. https://doi.org/10.3390/ani13030387
Chicago/Turabian StyleYu, Fengmei, Muhammad Akmal Raheem, Yang Tan, Muhammad Ajwad Rahim, Lisha Zha, Jun Zhang, Zhiwei Zhu, Zhonghua Li, and Fangfang Chen. 2023. "Localization of Chicken Rab22a in Cells and Its Relationship to BF or Ii Molecules and Genes" Animals 13, no. 3: 387. https://doi.org/10.3390/ani13030387