The Characterization and Differential Analysis of m6A Methylation in Hycole Rabbit Muscle and Adipose Tissue and Prediction of Regulatory Mechanism about Intramuscular Fat
Abstract
:Simple Summary
Abstract
1. Introduction
2. Material and Methods
2.1. Ethics Statement
2.2. Animals and Tissues Collection
2.3. RNA Extraction and Fragmentation
2.4. M6A Immunoprecipitation and Library Construction
2.5. MeRIP-Seq
2.6. RT-qPCR
2.7. Quality Control, Mapping and Statistical Analysis
3. Results
3.1. Data Filtering and Quality Evaluation
3.2. General Features of Rabbit m6A Methylation
3.3. Unique Features of Rabbit m6A Methylation
3.4. GO Analysis and KEGG Pathway Analysis of Differently Methylated Genes
3.5. Difference Analysis of Methylase and m6A Modified Genes between Muscle and Adipose Tissue
3.6. Regulation of Methylase on the Expression of m6A Modifying Genes Related to Fat Deposition
3.7. Methylase Regulated Genes Related to Fat Deposition through Signal Pathway
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Wei, C.-M.; Gershowitz, A.; Moss, B. Methylated nucleotides block 5′ terminus of HeLa cell messenger RNA. Cell 1975, 4, 379–386. [Google Scholar] [CrossRef] [PubMed]
- Shi, H.; Wang, X.; Lu, Z.; Zhao, B.S.; Ma, H.; Hsu, P.J.; Liu, C.; He, C. YTHDF3 facilitates translation and decay of N6-methyladenosine-modified RNA. Cell Res. 2017, 27, 315–328. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, X.; He, C. Dynamic rna modifications in posttranscriptional regulation. Mol. Cell 2014, 56, 5–12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, J.; Yue, Y.; Han, D.; Wang, X.; Fu, Y.; Zhang, L.; He, C.A. mettl3-mettl14 complex mediates mammalian nuclear rna n6-adenosine methylation. Nat. Chem. Biol. 2014, 10, 93–95. [Google Scholar] [CrossRef] [Green Version]
- Ping, X.-L.; Sun, B.-F.; Wang, L.; Xiao, W.; Yang, X.; Wang, W.-J.; Adhikari, S.; Shi, Y.; Lv, Y.; Chen, Y.-S.; et al. Mammalian WTAP is a regulatory subunit of the RNA N6-methyladenosine methyltransferase. Cell Res. 2014, 24, 177–189. [Google Scholar] [CrossRef] [Green Version]
- Patil, D.P.; Chen, C.-K.; Pickering, B.F.; Chow, A.; Jackson, C.; Guttman, M.; Jaffrey, S.R. m6A RNA methylation promotes XIST-mediated transcriptional repression. Nature 2016, 537, 369–373. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wen, J.; Lv, R.; Ma, H.; Shen, H.; He, C.; Wang, J.; Jiao, F.; Liu, H.; Yang, P.; Tan, L.; et al. Zc3h13 Regulates Nuclear RNA m6A Methylation and Mouse Embryonic Stem Cell Self-Renewal. Mol. Cell 2018, 69, 1028–1038.e6. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Hou, Y.; Wang, Y.; Gao, T.; Ma, Z.; Yang, Y.; Zhang, P.; Yi, F.; Zhan, J.; Zhang, H.; et al. Regulation of Adipocyte Differentiation by METTL4, a 6 mA Methylase. Sci. Rep. 2020, 10, 8285. [Google Scholar] [CrossRef]
- Jia, G.; Fu, Y.; Zhao, X.; Dai, Q.; Zheng, G.; Yang, Y.; Yi, C.; Lindahl, T.; Pan, T.; Yang, Y.-G.; et al. N6-Methyladenosine in nuclear RNA is a major substrate of the obesityassociated FTO. Nat. Chem. Biol. 2011, 7, 885–887. [Google Scholar] [CrossRef]
- Zheng, G.; Dahl, J.A.; Niu, Y.; Fedorcsak, P.; Huang, C.M.; Li, C.J.; He, C. Alkbh5 is a mammalian rna demethylase that impacts rna metabolism and mouse fertility. Mol. Cell 2013, 49, 18–29. [Google Scholar]
- Deng, X.; Su, R.; Weng, H.; Huang, H.; Li, Z.; Chen, J. Rna n6-methyladenosine modification in cancers: Cur-rent status and perspectives. Cell Res. 2018, 28, 507–517. [Google Scholar] [CrossRef] [PubMed]
- Alarcón, C.R.; Goodarzi, H.; Lee, H.; Liu, X.; Tavazoie, S.; Tavazoie, S.F. HNRNPA2B1 Is a Mediator of m6A-Dependent Nuclear RNA Processing Events. Cell 2015, 162, 1299–1308. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Chen, L.; Qiang, P. The role of igf2bp2, an m6a reader gene, in human metabolic diseases and cancers. Cancer Cell Int. 2021, 21, 2280. [Google Scholar] [CrossRef] [PubMed]
- Dominissini, D.; Moshitch-Moshkovitz, S.; Schwartz, S.; Salmon-Divon, M.; Ungar, L.; Osenberg, S.; Cesarkas, K.; Jacob-Hirsch, J.; Amariglio, N.; Kupiec, M.; et al. Topology of the human and mouse m6A RNA methylomes revealed by m6A-seq. Nature 2012, 485, 201–206. [Google Scholar] [CrossRef] [PubMed]
- Bujnicki, J.M.; Feder, M.; Radlinska, M.; Blumenthal, R.M. Structure prediction and phylogenetic analysis of a functionally diverse family of proteins homologous to the mt-a70 subunit of the human mrna:M6a methyltransferase. J. Mol. Evol. 2002, 55, 431–444. [Google Scholar] [CrossRef]
- Greer, E.L.; Blanco, M.A.; Lei, G.; Sendinc, E.; Yang, S. DNA methylation on n-adenine in C. elegans. Cell 2015, 161, 868–878. [Google Scholar] [CrossRef] [Green Version]
- Kweon, S.-M.; Chen, Y.; Moon, E.; Kvederaviciutė, K.; Klimasauskas, S.; Feldman, D.E. An Adversarial DNA N6-Methyladenine-Sensor Network Preserves Polycomb Silencing. Mol. Cell 2019, 74, 1137–1148. [Google Scholar] [CrossRef] [Green Version]
- Gewurz, B.E.; Towfic, F.; Mar, J.C.; Shinners, N.P.; Takasaki, K.; Zhao, B.; Cahir-McFarland, E.D.; Quackenbush, J.; Xavier, R.J.; Kieff, E. Genome-wide siRNA screen for mediators of NF-κB activation. Proc. Natl. Acad. Sci. USA 2012, 109, 2467–2472. [Google Scholar] [CrossRef] [Green Version]
- Weidemann, A.; Lovas, A.; Rauch, A.; Andreas, N.; Maltzahn, J.V.; Riemann, M.; Weih, F. Classical and alternative nf-κb signaling cooperate in regulating adipocyte differentiation and function. Int. J. Obes. 2016, 40, 452–459. [Google Scholar] [CrossRef]
- Maity, A.; Das, B. N6-methyladenosine modification in mrna: Machinery, function and implications for health and diseases. Febs J. 2016, 283, 1607–1630. [Google Scholar] [CrossRef] [Green Version]
- Le, H.T.T.; Sorrell, A.M.; Siddle, K. Two isoforms of the mrna binding protein igf2bp2 are generated by alternative translational initiation. PLoS ONE 2012, 7, e33140. [Google Scholar] [CrossRef] [PubMed]
- Stefan, N.; Schick, F.; Häring, H.U. Causes, characteristics, and consequences of metabolically unhealthy normal weight in humans. Cell Metab. 2017, 26, 292–300. [Google Scholar] [CrossRef]
- Tyra, M.; Ropka-Molik, K. Effect of the fabp3 and lepr gene polymorphisms and expression levels on intramuscular fat (imf) content and fat cover degree in pigs. Livest. Sci. 2011, 142, 114–120. [Google Scholar] [CrossRef]
- Sun, L.F.; Yang, Y.L.; Wang, M.Y.; Zhao, H.S.; Zhang, J.V. Inhibition of col6a5 improve lipid metabolism disorder in dihydrotestosterone-induced hyperandrogenic mice. Front. Cell Dev. Biol. 2021, 9, 669189. [Google Scholar] [CrossRef]
- Fathzadeh, M.; Li, J.; Rao, A.; Cook, N.; Chennamsetty, I.; Seldin, M.; Zhou, X.; Sangwung, P.; Gloudemans, M.J.; Keller, M.; et al. FAM13A affects body fat distribution and adipocyte function. Nat. Commun. 2020, 11, 1465. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Mingzhou, L.I.; Jinyong, W.; Li, Z.; Xuewei, L.I.; Surong, S.; Xiaokun, T.; Huasheng, X.; Qiang, L.I.; Lei, C.; Yujiao, G. Expression profiling analysis for genes related to meat quality and carcass traits during postnatal development of backfat in two pig breeds. Sci. China C Life Sci. 2008, 51, 718–733. [Google Scholar]
- Frey, N.; Olson, E.N. Calsarcin-3, a Novel Skeletal Muscle-specific Member of the Calsarcin Family, Interacts with Multiple Z-disc Proteins. J. Biol. Chem. 2002, 277, 13998–14004. [Google Scholar] [CrossRef] [Green Version]
- Chen, Z.; Torrens, J.I.; Anand, A.; Spiegelman, B.M.; Friedman, J.M. Krox20 stimulates adipogenesis via c/ebpbeta-dependent and independent mechanisms. Cell Metab. 2005, 1, 93–106. [Google Scholar] [CrossRef] [Green Version]
- Gulyaeva, O.; Nguyen, H.; Sambeat, A.; Heydari, K.; Sul, H.S. Sox9-meis1 inactivation is required for adipogenesis, advancing pref-1+ to pdgfrα+ cells. Cell Rep. 2018, 25, 1002–1017. [Google Scholar] [CrossRef] [Green Version]
- Bjune, J.I.; Haugen, C.; Gudbrandsen, O.; Nordbø, O.; Nielsen, H.J.; Våge, V.; Njølstad, P.R.; Sagen, J.V.; Dankel, S.N.; Mellgren, G. Irx5 regulates adipocyte amyloid precursor protein and mitochondrial respiration in obesity. Int. J. Obes. 2018, 43, 2151–2162. [Google Scholar] [CrossRef] [Green Version]
- Zierath, B.R.B. Role of amp-activated protein kinase in the control of glucose homeostasis. Curr. Mol. Med. 2005, 5, 341–348. [Google Scholar]
- Yuan, Z.Q.; Li, K.W. Role of farnesoid X receptor in cholestasis. J. Dig. Dis. 2016, 17, 501–509. [Google Scholar] [CrossRef] [PubMed]
- Sammons, M.F.; Price, D.A. Modulation of adipose tissue thermogenesis as a method for increasing energy expenditure. Bioorganic Med. Chem. Lett. 2014, 24, 425–429. [Google Scholar] [CrossRef] [PubMed]
- Lu, T.; Dang, S.; Rui, Z.; Ying, W.; Nie, Z.; Tao, H.; Wei, Z. Adamts18 deficiency promotes colon carcinogene-sis by enhancing β-catenin and p38mapk/erk1/2 signaling in the mouse model of aom/dss-induced coli-tis-associated colorectal cancer. Oncotarget 2017, 8, 18979–18990. [Google Scholar] [CrossRef] [Green Version]
- Volloch, V.; Olsen, B.R. Why cellular stress suppresses adipogenesis in skeletal tissue, but is ineffective in adipose tissue: Control of mesenchymal cell differentiation via integrin binding sites in extracellular matrices. Matrix Biol. 2013, 32, 365–371. [Google Scholar] [CrossRef]
- Suh, J.M.; Gao, X.; McKay, J.; McKay, R.; Salo, Z.; Graff, J.M. Hedgehog signaling plays a conserved role in inhibiting fat formation. Cell Metab. 2006, 3, 25–34. [Google Scholar] [CrossRef] [Green Version]
- Liang, S.; Chen, R.-T.; Zhang, D.-P.; Xin, H.-H.; Lu, Y.; Wang, M.-X.; Miao, Y.-G. Hedgehog signaling pathway regulated the target genes for adipogenesis in silkworm Bombyx mori. Insect Sci. 2014, 22, 587–596. [Google Scholar] [CrossRef]
- Yang, Y.; Hsu, P.J.; Chen, Y.S.; Yang, Y.G. Dynamic transcriptomic m6a decoration: Writers, erasers, readers and functions in rna metabolism. Cell Res. 2018, 28, 616–624. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Zheng, Y.; Guo, D.; Zhang, X.; Guo, S.; Hui, T.; Yue, C.; Sun, J.; Bai, Z.; Cai, W.; et al. m6A Methylation Analysis of Differentially Expressed Genes in Skin Tissues of Coarse and Fine Type Liaoning Cashmere Goats. Front. Genet. 2020, 10, 1–12. [Google Scholar] [CrossRef]
- Karsai, A.; Müller, S.; Platz, S.; Hauser, M.-T. Evaluation of a Homemade SYBR® Green I Reaction Mixture for Real-Time PCR Quantification of Gene Expression. Biotechniques 2002, 32, 790–796. [Google Scholar] [CrossRef] [Green Version]
- Chen, S.; Zhou, Y.; Chen, Y.; Gu, J. fastp: An ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 2018, 34, i884–i890. [Google Scholar] [CrossRef] [PubMed]
- Langmead, B.; Salzberg, S.L. Fast gapped-read alignment with Bowtie 2. Nat. Methods 2012, 9, 357–359. [Google Scholar] [CrossRef] [Green Version]
- Stark, R.; Brown, G. Diffbind differential binding analysis of chip-seq peak data. R Package Version 2011, 100, 3. [Google Scholar]
- Ahima, R.S.; Flier, J.S. Adipose tissue as an endocrine organ. Mol. Cell. Endocrinol. 2010, 11, 327–332. [Google Scholar]
- Choe, S.S.; Jin, Y.H.; Hwang, I.J.; Kim, J.I.; Kim, J.B. Adipose tissue remodeling: Its role in energy metabolism and metabolic disorders. Front. Endocrinol. 2016, 7, 30. [Google Scholar] [CrossRef]
- Tao, X.; Chen, J.; Jiang, Y.; Wei, Y.; Chen, Y.; Xu, H.; Zhu, L.; Tang, G.; Li, M.; Jiang, A. Transcriptome-wide n 6 -methyladenosine methylome profiling of porcine muscle and adipose tissues reveals a potential mechanism for transcriptional regulation and differential methylation pattern. BMC Genom. 2017, 18, 336–349. [Google Scholar] [CrossRef] [Green Version]
- Meyer, K.D.; Saletore, Y.; Zumbo, P.; Elemento, O.; Mason, C.E.; Jaffrey, S.R. Comprehensive Analysis of mRNA Methylation Reveals Enrichment in 3′ UTRs and near Stop Codons. Cell 2012, 149, 1635–1646. [Google Scholar] [CrossRef] [Green Version]
- Luo, G.-Z.; MacQueen, A.; Zheng, G.; Duan, H.; Dore, L.C.; Lu, Z.; Liu, J.; Chen, K.; Jia, G.; Bergelson, J.; et al. Unique features of the m6A methylome in Arabidopsis thaliana. Nat. Commun. 2014, 5, 5630–5647. [Google Scholar] [CrossRef] [Green Version]
- Wang, Y.; Zegang, Z.; Dayong, D.; Lang, Z.; Tang, K.; Xie, S. Transcriptome-wide high-throughput deep m(6)a-seq reveals unique differential m(6)a methylation patterns between three organs in Arabidopsis thaliana. Genome Biol. 2015, 16, 272. [Google Scholar]
- Bost, F.; Aouadi, M.; Binétruy, L.C.B. The role of mapks in adipocyte differentiation and obesity. Biochimie 2005, 87, 51–56. [Google Scholar] [CrossRef] [Green Version]
- Shen, J.; Hao, Z.; Wang, J.; Hu, J.; Liu, X.; Li, S.; Ke, N.; Song, Y.; Lu, Y.; Hu, L.; et al. Comparative Transcriptome Profile Analysis of Longissimus dorsi Muscle Tissues from Two Goat Breeds with Different Meat Production Performance Using RNA-Seq. Front. Genet. 2021, 11, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Ba, K.; Yang, X.; Wu, L.; Wei, X.; Fu, N.; Fu, Y.; Lin, Y. Jag-ged-1-mediated activation of notch signalling induces adipogenesis of adipose-derived stem cells. Cell Prolif. 2012, 45, 538–544. [Google Scholar] [CrossRef]
- Gustafson, B.; Smith, U. Cytokines promote wnt signaling and inflammation and impair the normal differentiation and lipid accumulation in 3t3-l1 preadipocytes. J. Biol. Chem. 2006, 281, 9507–9516. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Go, G.W.; Oh, S.; Park, M.; Gang, G.; Kim, Y. T10,c12 conjugated linoleic acid upregulates hepatic de novo lipogenesis and triglyceride synthesis via mtor pathway activation. J. Microbiol. Biotechnol. 2013, 23, 1569. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fu, C.; Zhang, Y.; Yao, Q.; Wei, X.; Shi, T.; Yan, P.; Liu, X. Maternal conjugated linoleic acid alters hepatic lipid metabolism via the AMPK signaling pathway in chick embryos. Poult. Sci. 2020, 99, 224–234. [Google Scholar] [CrossRef] [PubMed]
- Guannv, L.; Meihang, L.; Yatao, X.; Song, W.; Muhammad, S.; Chao, S. Colxv promotes adipocyte differentiation via inhibiting DNA methylation and camp/pka pathway in mice. Oncotarget 2019, 8, 60135–60148. [Google Scholar]
- Han, J.; Yu, X.; Wang, S.; Wang, Y.; Liu, Q.; Xu, H.; Wang, X. Igf2bp2 in-duces u251 glioblastoma cell chemoresistance by inhibiting foxo1-mediated pid1 expression through stabilizing lncrna dancr. Front. Cell Dev. Biol. 2022, 9, 659228. [Google Scholar] [CrossRef]
- Guan, H.; Tan, P.; Xie, L.; Mi, B.; Fang, Z.; Li, J.; Yue, J.; Liao, H.; Li, F. Foxo1 inhibits osteosarcoma oncogenesis via wnt/β-catenin pathway suppression. Oncogenesis 2015, 4, e166. [Google Scholar] [CrossRef] [Green Version]
- Koth, M.L.; Garcia-Moreno, S.A.; Novak, A.; Holthusen, K.A.; Jorgensen, J.S. Canonical wnt/β-catenin activ-ity and differential epigenetic marks direct sexually dimorphic regulation of irx3 and irx5 in developing gonads. Development 2020, 147, dev. 183814. [Google Scholar]
- Schymik, H.D.; Barghash, A.; Kiemer, A.K. The m6a reader igf2bp2 regulates macrophage phenotypic activation and inflammatory diseases by stabilizing tsc1 and pparγ. Adv. Sci. 2022, 8, 2100209. [Google Scholar]
- Chawla, A.; Boisvert, W.A.; Lee, C.H.; Laffitte, B.A.; Tontonoz, P. A ppar gamma-lxr-abca1 pathway in macrophages is involved in cholesterol efflux and atherogenesis. Mol. Cell 2001, 7, 161–171. [Google Scholar] [CrossRef] [PubMed]
- Ji, F.; Chen, S.Y.; Yu, Y.; Lin, X.L.; Zhu, Y.F.; Luo, X. Igf2bp2-modified circular rna circarhgap12 promotes cervical cancer progression by interacting m(6)a/foxm1 manner. Cell Death Discov. 2021, 7, 215. [Google Scholar] [CrossRef] [PubMed]
- Jiang, Y.; Zhang, H.; Li, W.; Yan, Y.; Gu, W. Foxm1-activated linc01094 promotes clear cell renal cell carci-noma development via mir-224-5p/chsy1. Mol. Cell. Biol. 2019, 40, e00357-19. [Google Scholar]
- Zang, C.-S.; Huang, H.-T.; Qiu, J.; Sun, J.; Ge, R.-F.; Jiang, L.-W. MiR-224-5p targets EGR2 to promote the development of papillary thyroid carcinoma. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 4890–4900. [Google Scholar] [PubMed]
- Groenewoud, M.J.; Dekker, J.M.; Fritsche, A.; Reiling, E.; Nijpels, G.; Heine, R.J.; Maassen, J.A.; Machicao, F.; Schfer, S.A.; Hring, H.U. Variants of cdkal1 and igf2bp2 affect first-phase insulin secretion during hyper-glycaemic clamps. Diabetologia 2008, 51, 1659–1663. [Google Scholar] [CrossRef] [Green Version]
- Coffer, P.J.; Puijenbroek, A.V.; Burgering, B.M.; Jonge, K.D.; Koenderman, L.; Bos, J.L.; Kruijer, W. Insulin activates stat3 independently of p21ras-erk and pi-3k signal transduction. Oncogene 1997, 15, 2529–2539. [Google Scholar] [CrossRef] [Green Version]
- Tang, Y.; Weng, X.; Liu, C.; Li, X.; Chen, C. Hypoxia enhances activity and malignant behaviors of colorectal cancer cells through the stat3/microrna-19a/pten/pi3k/akt axis. Anal. Cell. Pathol. 2021, 2021, 4132488. [Google Scholar] [CrossRef]
- Ye, M.; Hui, C.; Min, L. Mir-19a overexpression contributes to heart failure through targeting adrb1. Int. J. Clin. Exp. Med. 2015, 8, 642–649. [Google Scholar]
- Conejo, R.; Alvaro, C.D.; Benito, M.; Cuadrado, A.; Lorenzo, M. Insulin restores differentiation of ras-transformed c2c12 myoblasts by inducing nf-kappab through an akt/p70s6k/p38-mapk pathway. Oncogene 2002, 21, 3739–3753. [Google Scholar] [CrossRef]
- Xu, B.; Peng, Y.-J.; Zhu, W.-J. Curcumin Inhibits Viability of Clear Cell Renal Cell Carcinoma by Down-Regulating ADAMTS18 Gene Methylation though NF-κ B and AKT Signaling Pathway. Chin. J. Integr. Med. 2021, 28, 419–424. [Google Scholar] [CrossRef]
- Wang, H.; Yang, S.; Yang, E.; Zhu, Z.; Li, K. Nf-κb mediates the transcription of mouse calsarcin-1 gene, but not calsarcin-2, in c2c12 cells. BMC Mol. Biol. 2007, 8, 19. [Google Scholar] [CrossRef] [PubMed]
- Lawrence, T.; Fong, C. The resolution of inflammation: Anti-inflammatory roles for nf-κb—Sciencedirect. Int. J. Biochem. Cell Biol. 2010, 42, 519–523. [Google Scholar] [CrossRef] [PubMed]
- Corvol, H.; Rousselet, N.; Thompson, K.E.; Berdah, L.; Cottin, G.; Foussigniere, T.; Longchampt, E.; Fiette, L.; Sage, E.; Prunier, C.; et al. FAM13A is a modifier gene of cystic fibrosis lung phenotype regulating rhoa activity, actin cytoskeleton dynamics and epithelial-mesenchymal transition. J. Cyst. Fibros. 2018, 17, 190–203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, X.; Chen, X.; Liu, Y.; Tian, L.; Zhou, Q.; Liu, S.; Fang, J.; Chen, J. Effects of water extract and crude poly-saccharides from liriope spicata var. Prolifera on insr/irs-1/pi3k pathway and glucose metabolism in mice. J. Ethnopharmacol. 2009, 125, 482–486. [Google Scholar] [CrossRef] [PubMed]
- Qiu, W.; Leibowitz, B.; Zhang, L.; Yu, J. Growth factors protect intestinal stem cells from radiation-induced apoptosis by suppressing PUMA through the PI3K/AKT/p53 axis. Oncogene 2009, 29, 1622–1632. [Google Scholar] [CrossRef] [Green Version]
- Chen, J.; Wang, J.; Li, H.; Wang, S.; Xiang, X.; Zhang, D. p53 activates miR-192-5p to mediate vancomycin induced AKI. Sci. Rep. 2016, 6, 38868. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Y.; Huang, R.; Zhou, W.; Zhao, Q.; Lü, Z. miR-192-5p mediates hypoxia/reoxygenation-induced apoptosis in H9c2 cardiomyocytes via targeting of FABP3. J. Biochem. Mol. Toxicol. 2016, 31, e21873. [Google Scholar] [CrossRef]
- Xu, J.; Jia, L.; Ma, H.; Li, Y.; Ma, Z.; Zhao, Y. Axl gene knockdown inhibits the metastasis properties of hepatocellular carcinoma via pi3k/akt-pak1 signal pathway. Tumor Biol. 2013, 35, 3809–3817. [Google Scholar] [CrossRef]
- Liu, F.; Cheng, Z.; Li, X.; Li, Y.; Zhang, H.; Li, J.; Liu, F.; Xu, H.; Li, F. A novel pak1/atf2/mir-132 signaling axis is involved in the hematogenous metastasis of gastric cancer cells. Mol. Therapy. Nucleic Acids 2017, 8, 370–382. [Google Scholar] [CrossRef] [Green Version]
- Yao, C.; Shi, X.; Zhang, Z.; Zhou, S.; Qian, T.; Wang, Y.; Ding, F.; Gu, X.; Yu, B. Hypoxia-Induced Upregulation of miR-132 Promotes Schwann Cell Migration After Sciatic Nerve Injury by Targeting PRKAG3. Mol. Neurobiol. 2015, 53, 5129–5139. [Google Scholar] [CrossRef]
- Feng, C.; Chen, Y.; Zhang, Y.; Yan, Y.; Yang, M.; Gui, H.; Wang, M. PTEN Regulates Mitochondrial Biogenesis via the AKT/GSK-3β/PGC-1α Pathway in Autism. Neuroscience 2021, 465, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Kawakami, Y.; Tsuda, M.; Takahashi, S.; Taniguchi, N.; Esteban, C.R.; Zemmyo, M.; Furumatsu, T.; Lotz, M.; Belmonte, J.C.I.; Asahara, H. Transcriptional coactivator PGC-1α regulates chondrogenesis via association with Sox9. Proc. Natl. Acad. Sci. USA 2005, 102, 2414–2419. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Liu, Y.; Wu, H.; Zhang, F.; Yang, J.; He, J. Resveratrol upregulates mir-455-5p to antagonize cisplatin ototoxicity via modulating the pten-pi3k-akt axis. Biochem. Cell Biol. = Biochim. Biol. Cell. 2021, 99, 385–395. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Li, Q.; Zhang, G.; Wang, H.; Zhu, Z.; Chen, L. Lncrna hoxa-as3 promotes the malignancy of glio-blastoma through regulating mir-455-5p/usp3 axis. J. Cell. Mol. Med. 2020, 24, 11755–11767. [Google Scholar] [CrossRef]
- Wu, X.; Wang, H.; Zhu, D.; Chai, Y.; Wang, J.; Dai, W.; Liu, S. Usp3 promotes gastric cancer progression and metastasis by deubiquitination-dependent col9a3/col6a5 stabilisation. Cell Death Dis. 2022, 13, 10. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, L.; Chu, W.; Wang, B.; Zhang, J.; Zhao, M.; Li, X.; Li, B.; Lu, Y.; Yang, B. Tanshinone iia inhibits mir-1 expression through p38 mapk signal pathway in post-infarction rat cardiomyocytes. Cell. Physiol. Biochem. 2009, 26, 991–998. [Google Scholar] [CrossRef]
- Che, X.; Chen, T.; Wei, L.; Gu, X.; Gao, Y.; Liang, S.; Li, P. Microrna1 regulates the development of osteoarthritis in a col2a1creert2/gfpfl/flrfpmir1mouse model of osteoarthritis through the downregulation of indian hedgehog expression. Int. J. Mol. Med. 2020, 46, 360–370. [Google Scholar] [CrossRef]
- Shimoyama, A.; Wada, M.; Ikeda, F.; Hata, K.; Matsubara, T.; Nifuji, A.; Noda, M.; Amano, K.; Yamaguchi, A.; Nishimura, R.; et al. Ihh/Gli2 Signaling Promotes Osteoblast Differentiation by Regulating Runx2 Expression and Function. Mol. Biol. Cell 2007, 18, 2411–2418. [Google Scholar] [CrossRef] [Green Version]
- Zhu, C.W.L.; Nie, X.Y.; Yang, X.F.; Gao, K.G.; Jiang, Z.Y. Dietary dibutyryl camp supplementation regulates the fat deposition in adipose tissues of finishing pigs via camp/pka pathway. Anim. Biotechnol. 2021, 6, 1–14. [Google Scholar] [CrossRef]
- Yang, A.; Kang, Q.; Zhao, Y.; Hu, X.; Li, N.; Hong, W. Lats2 modulates adipocyte proliferation and differentiation via hippo signaling. PLoS ONE 2013, 8, e72042. [Google Scholar]
- Zhang, Y.; O’Keefe, R.J.; Jonason, J.H. BMP-TAK1 (MAP3K7) Induces Adipocyte Differentiation Through PPARγ Signaling. J. Cells Biochem. 2016, 118, 204–210. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, L.; Ha, J.-H.; Okla, M.; Chung, S. Activation of autophagy and AMPK by gamma-tocotrienol suppresses the adipogenesis in human adipose derived stem cells. Mol. Nutr. Food Res. 2013, 58, 569–579. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Primer Sequence (5′→3′) | (Tm/°C) |
---|---|---|
β-actin | GGAGATCGTGCGGGACAT | 61.4 |
GTTGAAGGTGGTCTCGTGGAT | ||
ADRB1 | CATCATCATGGGCGTGTTCA | 51.8 |
TAGCCGAGCCAGTTGAAGAA |
Sample | Peak Number | Total Length | Average Length | Genome Rate (%) |
---|---|---|---|---|
B | 6971 | 7800148 | 1118 | 0.347 |
S | 7028 | 8055673 | 1117 | 0.358 |
Symbol | Chromosome | Start | End | Gene_Start | Gene_End |
---|---|---|---|---|---|
ZC3H13 | 8 | 49156464 | 49163130 | 49112198 | 49203390 |
METTL4 | 9 | 59497322 | 59497522 | 59489716 | 59522894 |
IGF2BP2 | 14 | 79807766 | 79979443 | 79807317 | 79979658 |
Symbol | Chromosome | Gene_Start | Gene_End | Diff.log2FC | p-Value |
---|---|---|---|---|---|
ABCA1 | 1 | 8128276 | 8262632 | 1.258322149 | 0.030511101 |
IRX5 | 5 | 11211307 | 11214739 | 3.145191738 | 0.043951603 |
ADAMTS18 | 5 | 31919264 | 32078296 | 1.763515547 | 0.026105306 |
GLI2 | 7 | 59796306 | 59899847 | 2.106650174 | 0.018530687 |
PRKAG3 | 7 | 160092580 | 160099205 | −3.456695972 | 0.047136086 |
FABP3 | 13 | 134849947 | 134860535 | −1.076952166 | 0.008346079 |
COL6A5 | 14 | 963915 | 1100656 | −7.002296213 | 0.009463418 |
FAM13A | 15 | 60958616 | 61325685 | −5.001719634 | 0.041259027 |
MYOZ2 | 15 | 94465177 | 94502456 | 3.759079992 | 0.011579319 |
EGR2 | 18 | 23380925 | 23387584 | 1.671242666 | 0.03208062 |
ADRB1 | 18 | 61629975 | 61631390 | 5.667263578 | 0.020071817 |
SOX9 | 19 | 55820444 | 55823755 | −5.772627603 | 0.001606224 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, G.; Ai, Y.; Yu, L.; Wang, S.; Ren, Z. The Characterization and Differential Analysis of m6A Methylation in Hycole Rabbit Muscle and Adipose Tissue and Prediction of Regulatory Mechanism about Intramuscular Fat. Animals 2023, 13, 446. https://doi.org/10.3390/ani13030446
Luo G, Ai Y, Yu L, Wang S, Ren Z. The Characterization and Differential Analysis of m6A Methylation in Hycole Rabbit Muscle and Adipose Tissue and Prediction of Regulatory Mechanism about Intramuscular Fat. Animals. 2023; 13(3):446. https://doi.org/10.3390/ani13030446
Chicago/Turabian StyleLuo, Gang, Yaotian Ai, Lin Yu, Shuhui Wang, and Zhanjun Ren. 2023. "The Characterization and Differential Analysis of m6A Methylation in Hycole Rabbit Muscle and Adipose Tissue and Prediction of Regulatory Mechanism about Intramuscular Fat" Animals 13, no. 3: 446. https://doi.org/10.3390/ani13030446