Effects of Curcumin on Growth Performance, Ruminal Fermentation, Rumen Microbial Protein Synthesis, and Serum Antioxidant Capacity in Housed Growing Lambs
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals, Experimental Design, and Management
2.2. Data Collection and Sampling of Blood and Rumen Fluid
2.3. Determination of Rumen Fermentation Parameters and Rumen Enzyme Activity
2.4. Determination of Purine Derivatives and Microbial Proteins
2.5. Microbial DNA Extraction and RT-qPCR
2.6. Determination of Serum Antioxidant Capacity and Oxidative Stress
2.7. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Ruminal pH, VFA and NH3-N
3.3. Ruminal Enzyme Activity and Microbial Population
3.4. Purine Derivatives and Microbial Protein Synthesis
3.5. Serum Antioxidant Activity
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Low, C.X.; Tan, L.T.; Ab, M.N.; Pusparajah, P.; Goh, B.; Chan, K.; Letchumanan, V.; Lee, L. Unveiling the impact of antibiotics and alternative methods for animal husbandry: A review. Antibiotics 2021, 10, 578. [Google Scholar] [CrossRef] [PubMed]
- Salami, S.A.; Guinguina, A.; Agboola, J.O.; Omede, A.A.; Agbonlahor, E.M.; Tayyab, U. Review: In vivo and postmortem effects of feed antioxidants in livestock: A review of the implications on authorization of antioxidant feed additives. Animal 2016, 10, 1375–1390. [Google Scholar] [CrossRef] [PubMed]
- Zhong, R.Z.; Zhou, D.W. Oxidative stress and role of natural plant derived antioxidants in animal reproduction. J. Integr. Agric. 2013, 12, 1826–1838. [Google Scholar] [CrossRef]
- Rege, S.A.; Arya, M.; Momin, S.A. Structure activity relationship of tautomers of curcumin: A review. Ukr. Food J. 2019, 8, 45–60. [Google Scholar] [CrossRef]
- Fadhlurrahma, A.; Saepudin, E.; Rahayu, D.U.C. Acetylation of curcuminoids extract from Turmeric Rhizomes (Curcuma longa) as antibacterial compounds against S. aureus and E. coli. IOP Conf. Ser. Mater. Sci. Eng. 2020, 902, 012065. [Google Scholar] [CrossRef]
- Guo, J.; Zhang, Y.Y.; Sun, M.; Xu, L.F. Therapeutic potential of curcumin in a rat model of dextran sulfate sodium-induced ulcerative colitis by regulating the balance of tregth17 cells. Inflammation 2022, 45, 2163–2171. [Google Scholar] [CrossRef]
- Pontes, Q.G.M.; Benito, G.L.; Cano, J.P.; Aguilar, M.R.; Vázquez, L.B. Amphiphilic polymeric nanoparticles encapsulating curcumin: Antioxidant, anti-inflammatory and biocompatibility studies. Mater. Sci. Eng. C 2020, 121, 11793. [Google Scholar]
- Orzuna-Orzuna, J.F.; Dorantes-Iturbide, G.; Lara-Bueno, A. Effects of dietary tannins’ supplementation on growth performance, rumen fermentation, and enteric methane emissions in beef cattle: A metaanalysis. Sustainability 2021, 13, 7410. [Google Scholar] [CrossRef]
- Jafari, S.; Ebrahimi, M.; Goh, Y.M. Manipulation of rumen fermentation and methane gas production by plant secondary metabolites (saponin, tannin and essential oil): A review of ten-year studies. Ann. Anim. Sci. 2019, 19, 3–29. [Google Scholar] [CrossRef]
- Silva, S.N.S.E.; Chabrillat, T.; Kerros, S. Effects of plant extract supplementations or monensin on nutrient intake, digestibility, ruminal fermentation and metabolism in dairy cows. Anim. Feed Sci. Technol. 2021, 275, 114886. [Google Scholar] [CrossRef]
- Vasta, V.; Daghio, M.; Cappucci, A. Invited review: Plant polyphenols and rumen microbiota responsible for fatty acid biohydrogenation, fiber digestion, and methane emission: Experimental evidence and methodological approaches. J. Dairy Sci. 2019, 102, 3781–3804. [Google Scholar] [CrossRef]
- Marcon, H.; Souza, C.F.; Baldissera, M.D.; Alba, D.F.; Favaretto, J.A.; Santos, D.S.; Borges, L.; Kessler, J.D.; Vedovatto, M.; Bianchi, A.E.; et al. Effect of curcumin dietary supplementation on growth performance, physiology, carcass characteristics and meat quality in lambs. Ann. Anim. Sci. 2021, 21, 623–638. [Google Scholar] [CrossRef]
- Jiang, Z.Y.; Wan, Y.G.; Li, P.; Xue, Y.; Cui, W.W.; Chen, Q.; Chen, J.Q.; Wang, F.; Mao, D.G. Effect of curcumin supplement in summer diet on blood metabolites, antioxidant status, immune response, and testicular gene expression in hu sheep. Animals 2019, 9, 720. [Google Scholar] [CrossRef]
- Wang, C.; Liu, Q.; Guo, G.; Huo, W.J.; Ma, L.; Zhang, Y.L.; Pei, C.X.; Zhang, S.L.; Wang, H. Effects of rumen-protected folic acid on ruminal fermentation, microbial enzyme activity, cellulolytic bacteria and urinary excretion of purine derivatives in growing beef steers. Anim. Feed Sci. Technol. 2016, 221, 185–194. [Google Scholar] [CrossRef]
- Agarwal, N.; Kamra, D.N.; Chaudhary, L.C.; Agarwal, L.; Sahoo, A.; Pathak, N.N. Microbial status and rumen enzyme profile of crossbred calves fed on different microbial feed additives. Lett. Appl. Microbiol. 2002, 34, 329–336. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.B.; Gomes, M.J. Estimation of Microbial Protein Supply to Sheep and Cattle Based on Urinary Excretion of Purine Derivatives—An Overview of Technical Details; Rowett Research Institute: Aberdeen, UK, 1992. [Google Scholar]
- Yu, Z.T.; Morrison, M. Improved extraction of PCR-quality community DNA from digesta and fecal samples. Biotechniques 2004, 36, 808–812. [Google Scholar] [CrossRef]
- Kongmun, P.; Wanapat, M.; Pakdee, P.; Navanukraw, C. Effect of coconut oil and garlic powder on in vitro fermentation using gas production technique. Livest. Sci. 2010, 127, 38–44. [Google Scholar] [CrossRef]
- Wu, H.M.; Zhang, J.; Wang, C.; Liu, Q.; Guo, G.; Huo, W.J.; Chen, L.; Zhang, Y.L.; Pei, C.X.; Zhang, S.L. Effects of riboflavin supplementation on performance, nutrient digestion, rumen microbiota composition and activities of Holstein bulls. Br. J. Nutr. 2021, 126, 1–8. [Google Scholar] [CrossRef]
- Feng, T.; Hu, Z.S.; Wang, K.; Wang, K.; Zhu, X.; Chen, D.; Zhuang, H.N.; Yao, L.Y.; Song, S.Q.; Wang, H.T.; et al. Emulsion-based delivery systems for curcumin: Encapsulation and interaction mechanism between debrancher starch and curcumin. Int. J. Biol. Macromol. 2020, 161, 746–754. [Google Scholar] [CrossRef]
- Alam, J.; Dilnawaz, F.; Sahoo, S.K.; Singh, D.V.; Mukhopadhyay, A.K.; Hussain, T.; Pati, S. Curcumin encapsulated into biocompatible Co-polymer PLGA nanoparticle enhanced anti-gastric cancer and anti-helicobacter pylori effect. Asian Pac. J. Cancer Prev. 2022, 23, 61–70. [Google Scholar] [CrossRef]
- Florian, T.; Johann, S.; Lothar, B. Spectroscopic studies on the molecular interactions of curcumin and piperine. Monatsh Chem. 2020, 151, 325–330. [Google Scholar]
- Wang, Y.; Lu, Z.X.; Wu, H.; Lv, F.X. Study on the antibiotic activity of microcapsule curcumin against foodborne pathogens. Int. J. Food Microbiol. 2009, 136, 71–74. [Google Scholar] [CrossRef] [PubMed]
- Luo, D.D.; Chen, J.F.; Liu, J.J.; Xie, J.H.; Zhang, Z.B.; Gu, J.Y.; Zhuo, J.Y.; Huang, S.; Su, Z.R.; Sun, Z.H. Tetrahydrocurcumin and octahydrocurcumin, the primary and final hydrogenated metabolites of curcumin, possess superior hepatic-protective effect against acetaminophen-induced liver injury: Role of CYP2E1 and Keap1-Nrf2 pathway. Food Chem. Toxicol. 2018, 123, 349–362. [Google Scholar] [CrossRef]
- Lopresti, A.L. The Problem of Curcumin and Its Bioavailability: Could Its Gastrointestinal Influence Contribute to Its Overall Health-Enhancing Effects? Adv. Nutr. 2018, 9, 41–50. [Google Scholar] [CrossRef] [PubMed]
- Vorlaphim, T.; Phonvisay, M.; Khotsakdee, J.; Vasupen, K.; Bureenok, S.; Wongsuthavas, S.; Alhaidary, A.; Mohamed, H.E.; Beynen, A.C.; Yuangklang, C. Influence of dietary curcumin on rumen fermentation, macronutrient digestion and nitrogen balance in beef cattle. Am. J. Agric. Biol. Sci. 2011, 6, 7–11. [Google Scholar] [CrossRef]
- Antonise, M.; Jaguezeski, G.P.; Nathieli, B.; Bottari, R.W.; Mariane, B.; Fagundes, M.R.C.; Schetinger, V.M.; Morsch, C.S.; Stein, R.N.; Moresco, D.A.; et al. Addition of curcumin to the diet of dairy sheep improves health, performance and milk quality. Anim. Feed Sci. Technol. 2018, 246, 144–157. [Google Scholar]
- Nozière, P.; Glasser, F.; Sauvant, D. In vivo production and molar percentages of volatile fatty acids in the rumen: A quantitative review by an empirical approach. Animal 2010, 5, 403–414. [Google Scholar] [CrossRef]
- Xun, W.J.; Shi, L.G.; Zhou, H.L.; Hou, G.Y.; Cao, T.; Zhao, C.P. Effects of curcumin on growth performance, jejunal mucosal membrane integrity, morphology and immune status in weaned piglets challenged with enterotoxigenic Escherichia coli. Int. Immunopharmacol. 2015, 27, 46–52. [Google Scholar] [CrossRef]
- Zhong, R.Z.; Yu, M.; Liu, H.W.; Sun, H.X.; Cao, Y.; Zhou, D.W. Effects of dietary Astragalus polysaccharide and Astragalus membranaceus root supplementation on growth performance, rumen fermentation, immune responses, and antioxidant status of lambs. Anim. Feed Sci. Technol. 2012, 174, 60–67. [Google Scholar] [CrossRef]
- Zhou, L.L.; Wang, D.F.; Hu, H.C.; Zhou, H.L. Effects of Piper sarmentosum extract supplementation on growth performances and rumen fermentation and microflora characteristics in goats. J. Anim. Physiol. Anim. Nutr. 2020, 104, 431–438. [Google Scholar] [CrossRef]
- Akito, S.; Nose, K.; Takaoka, M.; Hayashi, H.; Kond, T. Effect of dietary turmeric on breath hydrogen. Dig. Dis. Sci. 2009, 54, 1725–1729. [Google Scholar]
- Li, S.Y.; Wang, C.; Wu, Z.Z.; Liu, Q.; Guo, G.; Huo, W.J.; Zhang, J.; Chen, L.; Zhang, Y.L.; Pei, C.X.; et al. Effects of guanidinoacetic acid supplementation on growth performance, nutrient digestion, rumen fermentation and blood metabolites in Angus bulls. Anim. Int. J. Anim. Biosci. 2020, 14, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Vitor, M.; Carine, F.S.; Matheus, D. Diet supplemented with curcumin for nursing lambs improves animal growth, energetic metabolism, and performance of the antioxidant and immune systems. Small Rumin. Res. 2018, 170, 74–81. [Google Scholar]
- Vogels, G.D.; Hoppe, W.F.; Stumm, C.K. Association of methanogenic bacteria with rumen ciliates. Appl. Environ. Microbiol. 1982, 47, 95–99. [Google Scholar] [CrossRef]
- Dohme, F.; Machmüller, A.; Estermann, B.L.; Pfister, P.; Wasserfallen, A.; Kreuzer, M. The role of the rumen ciliate protozoa for methane suppression caused by coconut oil. Lett. Appl. Microbiol. 1999, 29, 187–192. [Google Scholar] [CrossRef]
- Feng, W.; Wang, H.; Zhang, P.; Gao, C.; Tao, J.; Ge, Z.; Zhu, D.; Bi, Y. Modulation of gut microbiota contributes to curcumin-mediated attenuation of hepatic steatosis in rats. Biochim. Biophys. Acta 2017, 1861, 1801–1812. [Google Scholar] [CrossRef]
- Bereswill, S.; Munoz, M.; Fischer, A.; Plickert, R.; Haag, L.M.; Otto, B.; Kuhl, A.A.; Loddenkemper, C.; Gobel, U.B.; Heimesaat, M.M. Antiinflammatory effects of resveratrol, curcumin and simvastatin in acute small intestinal inflammation. Public Libr. Sci. One 2010, 5, e15099. [Google Scholar]
- Mu, C.T.; Yang, W.J.; Wang, P.J.; Zhao, J.X.; Hao, X.Y.; Zhang, J.X. Effects of high-concentrate diet supplemented with grape seed proanthocyanidins on growth performance, liver function, meat quality, and antioxidant activity in finishing lambs. Anim. Feed Sci. Technol. 2020, 266, 114518. [Google Scholar] [CrossRef]
- Weimer, P.J.; Hatfield, R.D.; Buxton, D.R. Inhibition of ruminal cellulose fermentation by extracts of the perennial legume cicer milkvetch (Astragalus cicer). Appl. Environ. Microbiol. 1993, 59, 405–409. [Google Scholar] [CrossRef]
- Boucher, S.E.; Ordway, R.S.; Whitehouse, N.L.; Lundy, F.P.; Kononoff, P.J.; Schwab, C.G. Effect of incremental urea supplementation of a conventional corn silage-based diet on ruminal ammonia concentration and synthesis of microbial protein. J. Dairy Sci. 2007, 90, 5619–5633. [Google Scholar] [CrossRef]
- Firkins, J.L.; Yu, Z.; Morrison, M. Ruminal nitrogen metabolism: Perspectives for integration of microbiology and nutrition for dairy. J. Dairy Sci. 2007, 90, E1–E16. [Google Scholar] [CrossRef] [PubMed]
- Descalzo, A.M.; Sancho, A.M. A review of natural antioxidants and their effects on oxidative status, odor and quality of fresh beef produced in Argentina. Meat Sci. 2008, 79, 423–436. [Google Scholar] [CrossRef] [PubMed]
- Cao, S.T.; Wang, C.C.; Yan, J.T.; Li, X.; Wen, J.S.; Hu, C.H. Curcumin ameliorates oxidative stress-induced intestinal barrier injury and mitochondrial damage by promoting Parkin dependent mitophagy through AMPK-TFEB signal pathway. Free Radic. Biol. Med. 2020, 147, 8–22. [Google Scholar] [CrossRef]
- Zhang, L.G.; Zhang, J.Q.; Yan, E.F.; He, J.T.; Zhong, X.; Zhang, L.L.; Wang, C.; Wang, T. Dietary Supplemented Curcumin Improves Meat Quality and Antioxidant Status of Intrauterine Growth Retardation Growing Pigs via Nrf2 Signal Pathway. Animals 2020, 10, 539. [Google Scholar] [CrossRef] [PubMed]
- Galati, G.; Sabzevari, O.; Wilson, J.X.; O’Brien, P.J. Prooxidant activity and cellular effects of the phenoxyl radicals of dietary flavonoids and other polyphenolics. Toxicology 2002, 177, 91–104. [Google Scholar] [CrossRef] [PubMed]
Items | Contents |
---|---|
Ingredients | |
Soybean meal | 7.00 |
Cottonseed meal | 5.00 |
Corn germ meal | 18.00 |
Sprayed corn husk | 6.00 |
Corn | 25.00 |
Peanut shell powder | 10.00 |
Corn straw | 14.00 |
Sunflower peel powder | 10.00 |
Premix a | 5.00 |
Total | 100.00 |
Nutrient levels | |
Crude protein, CP | 15.19 |
Ether extract, EE | 2.20 |
Ash | 9.30 |
Neutral detergent fiber, NDF | 34.86 |
Acid detergent fiber, ADF | 21.43 |
Metabolizable energy, ME; MJ/kg DM | 9.53 |
Target Species | Sequences, 5′–3′ | Size, bp |
---|---|---|
Total bacteria | F:CGGTGAATACGTTCYCGG R:CGWTACCTTGTTACGACTT | 123 |
Protozoan | F:GCTTTCGWTGGTAGTGTATT R:CTTGCCCTCYAATCGTWCT | 223 |
Methanogens | F:TTCGGTGGATCDCARAGRGC R:GBARGTCGWAWCCGTAGAATCC | 140 |
Ruminococcus albus | F:CCCTAAAAGCAGTCTTAGTTCG R:CCTCCTTGCGGTTAGAACA | 176 |
Ruminococcus flavefaciens | F:ATTGTCCCAGTTCAGATTGC R:GGCGTCCTCATTGCTGTTAG | 173 |
Fibrobacter succinogenes | F:GGCGGGATTGAATGTACCTTGAGA R:TCCGCCTGCCCCTGAACTATC | 204 |
Butyrivibrio fibrisolvens | F:TAACATGAGAGTTTGATCCTGGCTC R:CGTTACTCACCCGTCCGC | 136 |
Prevotella ruminicola | F:CATCCTATAGCGGTAAACCTTTGG R:GAAAGTCGGATTAATGCTCTATGTTG | 74 |
Ruminobacter amylophilus | F:CTGGGGAGCTGCCTGAATG R:GCATCTGAATGCGACTGGTTG | 100 |
Items | Treatments a | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|
Control | 300 CUR | 600 CUR | 900 CUR | Linear | Quadratic | ||
Initial body weight, kg | 20.49 | 20.96 | 21.11 | 20.99 | 0.23 | 0.463 | 0.560 |
Final body weight, kg | 38.12 | 41.36 | 40.17 | 40.12 | 0.40 | 0.144 | 0.030 |
ADG, g/day | 295.24 | 340.71 | 315.71 | 317.86 | 5.84 | 0.371 | 0.050 |
DMI., g/day | 1793.50 | 1834.76 | 1858.27 | 1829.62 | 20.83 | 0.501 | 0.426 |
DMI/ADG | 6.12 | 5.46 | 5.97 | 5.81 | 0.08 | 0.497 | 0.079 |
Items | Treatments | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|
Control | 300 CUR | 600 CUR | 900 CUR | Linear | Quadratic | ||
pH | 7.13 | 6.63 | 6.83 | 6.89 | 0.06 | 0.235 | 0.008 |
Total VFA, mmol/L | 95.29 | 110.49 | 105.44 | 103.01 | 2.01 | 0.280 | 0.024 |
Acetate, mmol/L | 52.40 | 60.82 | 57.34 | 56.73 | 0.94 | 0.199 | 0.009 |
Propionate. mmol/L | 33.65 | 38.87 | 34.39 | 35.97 | 0.88 | 0.504 | 0.054 |
Butyrate, mmol/L | 10.37 | 11.91 | 10.50 | 9.23 | 0.45 | 0.230 | 0.122 |
Isovalerate, mmol/L | 0.65 | 0.71 | 0.67 | 0.57 | 0.04 | 0.445 | 0.313 |
Valerate, mmol/L | 2.80 | 3.23 | 2.54 | 2.23 | 0.12 | 0.023 | 0.104 |
Acetate/propionate | 1.61 | 1.42 | 1.65 | 1.59 | 0.06 | 0.772 | 0.625 |
NH3-N, mg/dL | 12.17 | 9.42 | 10.05 | 11.55 | 0.37 | 0.680 | 0.003 |
Items | Treatments | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|
Control | 300 CUR | 600 CUR | 900 CUR | Linear | Quadratic | ||
Microbial enzyme activity | |||||||
Cellobiase | 0.67 | 0.75 | 0.70 | 0.60 | 0.02 | 0.158 | 0.053 |
Pectinase | 1.55 | 2.11 | 1.98 | 1.72 | 0.06 | 0.360 | <0.001 |
Carboxymethyl cellulose | 0.31 | 0.51 | 0.34 | 0.31 | 0.02 | 0.553 | 0.013 |
Xylanase | 1.65 | 2.50 | 2.49 | 2.16 | 0.17 | 0.314 | 0.091 |
Protease | 5.10 | 10.12 | 8.75 | 7.58 | 0.46 | 0.058 | <0.001 |
α-amylase | 0.47 | 0.79 | 0.55 | 0.56 | 0.06 | 0.951 | 0.199 |
Microflora (copies/mL) | |||||||
Total bacteria, ×1011 | 2.85 | 3.88 | 3.45 | 2.69 | 0.13 | 0.329 | <0.001 |
Protozoan, ×106 | 2.13 | 1.63 | 1.26 | 1.17 | 0.13 | 0.022 | 0.383 |
Methanogens, ×108 | 1.28 | 0.97 | 0.88 | 0.84 | 0.06 | 0.011 | 0.129 |
Ruminococcus albus, ×108 | 1.81 | 3.09 | 1.82 | 1.65 | 0.21 | 0.555 | 0.001 |
Ruminococcus flavefaciens, ×109 | 2.15 | 2.77 | 2.65 | 2.24 | 0.14 | 0.892 | 0.063 |
Fibrobacter succinogenes, ×1010 | 1.64 | 1.70 | 1.35 | 0.91 | 0.09 | <0.001 | 0.070 |
Butyrivibrio fibrisolvens, ×1010 | 1.29 | 1.65 | 1.37 | 1.14 | 0.12 | 0.391 | 0.118 |
Prevotella ruminicola, ×1010 | 1.41 | 2.99 | 2.45 | 2.67 | 0.18 | 0.023 | 0.032 |
Ruminobacter amylophilus, ×108 | 1.40 | 1.78 | 1.64 | 1.49 | 0.08 | 0.856 | 0.121 |
Items | Treatments | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|
Control | 300 CUR | 600 CUR | 900 CUR | Linear | Quadratic | ||
Uric acid, mmol/d | 1.00 | 1.84 | 1.62 | 1.44 | 0.20 | 0.561 | 0.228 |
Allantoin, mmol/d | 7.96 | 12.00 | 10.96 | 10.19 | 0.55 | 0.182 | 0.019 |
Xanthine + hypoxanthine a, mmol/d | 0.73 | 1.12 | 1.02 | 0.94 | 0.06 | 0.192 | 0.020 |
Total PD b, mmol/d | 9.68 | 14.97 | 13.61 | 12.57 | 0.73 | 0.197 | 0.021 |
Exogenous purines absorption c, mmol/d | 11.32 | 17.78 | 16.12 | 14.88 | 0.89 | 0.197 | 0.021 |
MCP d, g/d | 51.46 | 80.79 | 73.26 | 67.63 | 4.06 | 0.197 | 0.021 |
Items | Treatments | SEM | p-Value | ||||
---|---|---|---|---|---|---|---|
Control | 300 CUR | 600 CUR | 900 CUR | Linear | Quadratic | ||
T-AOC, U/mL | 18.84 | 20.88 | 20.02 | 18.59 | 0.27 | 0.432 | 0.001 |
SOD, U/mL | 13.05 | 14.50 | 13.57 | 13.11 | 0.18 | 0.580 | 0.004 |
GSH-Px, U/mL | 164.67 | 182.67 | 174.96 | 168.34 | 2.29 | 0.857 | 0.005 |
CAT, U/mL | 73.11 | 76.96 | 75.48 | 74.81 | 0.60 | 0.486 | 0.059 |
MDA, mmol/mL | 5.16 | 4.80 | 5.02 | 4.90 | 0.04 | 0.111 | 0.123 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tian, G.; Zhang, X.; Hao, X.; Zhang, J. Effects of Curcumin on Growth Performance, Ruminal Fermentation, Rumen Microbial Protein Synthesis, and Serum Antioxidant Capacity in Housed Growing Lambs. Animals 2023, 13, 1439. https://doi.org/10.3390/ani13091439
Tian G, Zhang X, Hao X, Zhang J. Effects of Curcumin on Growth Performance, Ruminal Fermentation, Rumen Microbial Protein Synthesis, and Serum Antioxidant Capacity in Housed Growing Lambs. Animals. 2023; 13(9):1439. https://doi.org/10.3390/ani13091439
Chicago/Turabian StyleTian, Guangyuan, Xuanzi Zhang, Xiaoyan Hao, and Jianxin Zhang. 2023. "Effects of Curcumin on Growth Performance, Ruminal Fermentation, Rumen Microbial Protein Synthesis, and Serum Antioxidant Capacity in Housed Growing Lambs" Animals 13, no. 9: 1439. https://doi.org/10.3390/ani13091439