The Role of BMP7 in the Proliferation of Hu Sheep Dermal Papilla Cells Is Influenced by DNA Methylation
Abstract
:Simple Summary
Abstract
1. Introduction
2. Methods
2.1. Ethics Statement and Animals
2.2. Cell Isolation, Culture, and Transfection
2.3. Total RNA Extraction, cDNA Synthesis, and qRT-PCR
2.4. Primers for qRT-PCR
2.5. Plasmids Construction
2.6. 5-Aza-Deoxycytidine (5-Aza-dc)-Induced Demethylation
2.7. Dual-Luciferase Reporter Assay
2.8. CCK-8 Assay
2.9. EdU Assay
2.10. Cell Cycle Assay
2.11. Statistical Analysis
3. Results
3.1. DNA Demethylation Upregulates the Expression and Transcriptional Activity of BMP7
3.2. DNA Demethylation Promotes the Proliferation of DPCs
3.3. DNA Methylation Inhibits the Proliferation of DPCs
3.4. DNA Methylation Inhibits the Cell Cycle of DPCs
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Lv, X.Y.; Gao, W.; Jin, C.Y.; Wang, L.H.; Wang, Y.; Chen, W.H.; Zou, S.X.; Huang, S.N.; Li, Z.F.; Wang, J.Y.; et al. Preliminary study on microR-148a and microR-10a in dermal papilla cells of Hu sheep. BMC Genet. 2019, 20, 70. [Google Scholar] [CrossRef] [PubMed]
- Uyttendaele, H.; Panteleyev, A.A.; de Berker, D.; Tobin, D.J.; Christiano, A.M. Activation of Notch1 in the hair follicle leads to cell-fate switch and Mohawk alopecia. Differentiation 2004, 72, 396–409. [Google Scholar] [CrossRef] [PubMed]
- Nissimov, J.N.; Das Chaudhuri, A.B. Hair curvature: A natural dialectic and review. Biol. Rev. 2014, 89, 723–766. [Google Scholar] [CrossRef] [PubMed]
- Westgate, G.E.; Botchkareva, N.V.; Tobin, D.J. The biology of hair diversity. Int. J. Cosmet. Sci. 2013, 35, 329–336. [Google Scholar] [CrossRef] [PubMed]
- Hynd, P.I.; Edwards, N.M.; Hebart, M.; McDowall, M.; Clark, S. Wool fibre crimp is determined by mitotic asymmetry and position of final keratinisation and not ortho- and para-cortical cell segmentation. Animal 2009, 3, 838–843. [Google Scholar] [CrossRef] [PubMed]
- Laron, E.A.; Aamar, E.; Enshell-Seijffers, D. The Mesenchymal Niche of the Hair Follicle Induces Regeneration by Releasing Primed Progenitors from Inhibitory Effects of Quiescent Stem Cells. Cell Rep. 2018, 24, 909–921.e3. [Google Scholar] [CrossRef] [PubMed]
- Saxena, N.; Mok, K.W.; Rendl, M. An updated classification of hair follicle morphogenesis. Exp. Dermatol. 2019, 28, 332–344. [Google Scholar] [CrossRef] [PubMed]
- Chi, W.; Wu, E.; Morgan, B.A. Dermal papilla cell number specifies hair size, shape and cycling and its reduction causes follicular decline. Development 2013, 140, 1676–1683. [Google Scholar] [CrossRef] [PubMed]
- Rompolas, P.; Deschene, E.R.; Zito, G.; Gonzalez, D.G.; Saotome, I.; Haberman, A.M.; Greco, V. Live imaging of stem cell and progeny behaviour in physiological hair-follicle regeneration. Nature 2012, 487, 496–499. [Google Scholar] [CrossRef]
- Kwack, M.H.; Seo, C.H.; Gangadaran, P.; Ahn, B.C.; Kim, M.K.; Kim, J.C.; Sung, Y.K. Exosomes derived from human dermal papilla cells promote hair growth in cultured human hair follicles and augment the hair-inductive capacity of cultured dermal papilla spheres. Exp. Dermatol. 2019, 28, 854–857. [Google Scholar] [CrossRef]
- Rishikaysh, P.; Dev, K.; Diaz, D.; Qureshi, W.M.S.; Filip, S.; Mokry, J. Signaling Involved in Hair Follicle Morphogenesis and Development. Int. J. Mol. Sci. 2014, 15, 1647–1670. [Google Scholar] [CrossRef] [PubMed]
- Telerman, S.B.; Rognoni, E.; Sequeira, I.; Pisco, A.O.; Lichtenberger, B.M.; Culley, O.J.; Viswanathan, P.; Driskell, R.R.; Watt, F.M. Dermal Blimp1 Acts Downstream of Epidermal TGFβ and Wnt/β-Catenin to Regulate Hair Follicle Formation and Growth. J. Investig. Dermatol. 2017, 137, 2270–2281. [Google Scholar] [CrossRef]
- Botchkarev, V.A.; Sharov, A.A. BMP signaling in the control of skin development and hair follicle growth. Differentiation 2004, 72, 512–526. [Google Scholar] [CrossRef] [PubMed]
- Yin, J.F.; Ni, R.; Wang, Q.Z.; Sun, W.; Ding, J.T.; Zhang, Y.F.; Chen, L.; Wu, W.Z.; Zhou, H. The Genetic Polymorphism, Expression of BMP7 Gene and Its Relationship with Lamb Skin Follicle Traits in Hu Sheep. Sci. Agric. Sin. 2014, 47, 1811–1818. [Google Scholar]
- Li, Y.; Lv, X.Y.; Wang, S.H.; Cao, X.K.; Yuan, Z.H.; Getachew, T.; Mwacharo, J.M.; Haile, A.; Sun, W. BMP7 Functions to Regulate Proliferation of Dermal Papilla Cells in Hu Sheep. Genes 2022, 13, 201. [Google Scholar] [CrossRef] [PubMed]
- Wilkinson, M.F. Evidence that DNA methylation engenders dynamic gene regulation. Proc. Natl. Acad. Sci. USA 2015, 112, E2116. [Google Scholar] [CrossRef] [PubMed]
- Zhu, Y.B.; Wang, Z.Y.; Yin, R.H.; Jiao, Q.; Zhao, S.J.; Cong, Y.Y.; Xue, H.L.; Guo, D.; Wang, S.Q.; Zhu, Y.X.; et al. A IncRNA-H19 transcript from secondary hair follicle of Liaoning cashmere goat: Identification, regulatory network and expression regulated potentially by its promoter methylation. Gene 2018, 641, 78–85. [Google Scholar] [CrossRef]
- Tian, Y.Z.; Yang, X.M.; Du, J.W.; Zeng, W.D.; Wu, W.W.; Di, J.; Huang, X.X.; Tian, K.C. Differential Methylation and Transcriptome Integration Analysis Identified Differential Methylation Annotation Genes and Functional Research Related to Hair Follicle Development in Sheep. Front. Genet. 2021, 12, 735827. [Google Scholar] [CrossRef] [PubMed]
- Bai, L.Y.; Sun, H.T.; Jiang, W.X.; Yang, L.P.; Liu, G.Y.; Zhao, X.Y.; Hu, H.M.; Wang, J.Y.; Gao, S.X. DNA methylation and histone acetylation are involved in Wnt10b expression during the secondary hair follicle cycle in Angora rabbits. J. Anim. Physiol. Anim. Nutr. 2021, 105, 599–609. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Lv, X.Y.; Sun, W.; Zou, S.X.; Chen, L.; Mwacharo, J.M.; Wang, J.Y. Characteristics of the BMP7 Promoter in Hu Sheep. Animals 2019, 9, 874. [Google Scholar] [CrossRef] [PubMed]
- Xiao, P.; Zhong, T.; Liu, Z.F.; Pu, Y.B.; Ma, Y.H.; Zhao, Q.J. Research progress of Mechanism of Hair Follicle Development and Hair Curvature in Sheep and Goat. Acta Vet. Zootech. Sin. 2018, 49, 1567–1576. [Google Scholar]
- Sennett, R.; Rendl, M. Mesenchymal-epithelial interactions during hair follicle morphogenesis and cycling. Semin. Cell Dev. Biol. 2012, 23, 917–927. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Xie, M.; Jiang, Y.; Xiao, N.Q.; Du, X.Y.; Zhang, W.G.; Tosser-Klopp, G.; Wang, J.H.; Yang, S.; Liang, J.; et al. Sequencing and automated whole-genome optical mapping of the genome of a domestic goat (Capra hircus). Nat. Biotechnol. 2013, 31, 135–141. [Google Scholar] [CrossRef] [PubMed]
- Cloete, E.; Khumalo, N.P.; Ngoepe, M.N. The what, why and how of curly hair: A review. Proc. R. Soc. A Math. Phys. 2019, 475, 20190516. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.Q.; Che, L.J.; Hickford, J.G.H.; Zhou, H.T.; Hao, Z.Y.; Luo, Y.Z.; Hu, J.; Liu, X.; Li, S.B. Identification of the Caprine Keratin-Associated Protein 20-2 (KAP20-2) Gene and Its Effect on Cashmere Traits. Genes 2017, 8, 328. [Google Scholar] [CrossRef]
- Li, S.B.; Zhou, H.T.; Gong, H.; Zhao, F.F.; Wang, J.Q.; Liu, X.; Luo, Y.Z.; Hickford, J.G.H. Identification of the Ovine Keratin-Associated Protein 22-1 (KAP22-1) Gene and Its Effect on Wool Traits. Genes 2017, 8, 27. [Google Scholar] [CrossRef]
- Cadieu, E.; Neff, M.W.; Quignon, P.; Walsh, K.; Chase, K.; Parker, H.G.; VonHoldt, B.M.; Rhue, A.; Boyko, A.; Byers, A.; et al. Coat Variation in the Domestic Dog Is Governed by Variants in Three Genes. Science 2009, 326, 150–153. [Google Scholar] [CrossRef] [PubMed]
- Morgenthaler, C.; Diribarne, M.; Capitan, A.; Legendre, R.; Saintilan, R.; Gilles, M.; Esquerré, D.; Juras, R.; Khanshour, A.; Schibler, L.; et al. A missense variant in the coil1A domain of the keratin 25 gene is associated with the dominant curly hair coat trait (Crd) in horse. Genet. Sel. Evol. 2017, 49, 85. [Google Scholar] [CrossRef]
- Kang, X.L.; Liu, Y.F.; Zhang, J.B.; Xu, Q.Q.; Liu, C.K.; Fang, M.Y. Characteristics and Expression Profile of KRT71 Screened by Suppression Subtractive Hybridization cDNA Library in Curly Fleece Chinese Tan Sheep. DNA Cell Biol. 2017, 36, 552–564. [Google Scholar] [CrossRef]
- Mishina, Y. Function of bone morphogenetic protein signaling during mouse development. Front. Biosci. 2003, 8, D855–D869. [Google Scholar] [CrossRef] [PubMed]
- Ceruti, J.M.; Oppenheimer, F.M.; Leirós, G.J.; Balañá, M.E. Androgens downregulate BMP2 impairing the inductive role of dermal papilla cells on hair follicle stem cells differentiation. Mol. Cell. Endocrinol. 2021, 520, 111096. [Google Scholar] [CrossRef] [PubMed]
- Cai, B.J.; Zheng, Y.P.; Yan, J.D.; Wang, J.M.; Liu, X.J.; Yin, G.W. BMP2-mediated PTEN enhancement promotes differentiation of hair follicle stem cells by inducing autophagy. Exp. Cell Res. 2019, 385, 111647. [Google Scholar] [CrossRef] [PubMed]
- Wu, P.; Zhang, Y.M.; Xing, Y.Z.; Xu, W.; Guo, H.Y.; Deng, F.; Ma, X.G.; Li, Y.H. The balance of Bmp6 and Wnt10b regulates the telogen-anagen transition of hair follicles. Cell Commun. Signal. 2019, 17, 16. [Google Scholar] [CrossRef] [PubMed]
- Andl, T.; Ahn, K.; Kairo, A.; Chu, E.Y.; Wine-Lee, L.; Reddy, S.T.; Croft, N.J.; Cebra-Thomas, J.A.; Metzger, D.; Chambon, P.; et al. Epithelial Bmpr1a regulates differentiation and proliferation in postnatal hair follicles and is essential for tooth development. Development 2004, 131, 2257–2268. [Google Scholar] [CrossRef] [PubMed]
- Jamora, C.; DasGupta, R.; Kocieniewski, P.; Fuchs, E. Links between signal transduction, transcription and adhesion in epithelial bud development. Nature 2003, 422, 317–322. [Google Scholar] [CrossRef] [PubMed]
- Moore, L.D.; Le, T.; Fan, G.P. DNA Methylation and Its Basic Function. Neuropsychopharmacology 2013, 38, 23–38. [Google Scholar] [CrossRef]
- Zhao, B.H.; Li, J.L.; Liu, M.; Yang, N.S.; Bao, Z.Y.; Zhang, X.Y.; Dai, Y.Y.; Cai, J.W.; Chen, Y.; Wu, X.S. DNA Methylation Mediates lncRNA2919 Regulation of Hair Follicle Regeneration. Int. J. Mol. Sci. 2022, 23, 9481. [Google Scholar] [CrossRef]
Gene | Primer Sequence (5′-3′) | Product Size (bp) | Annealing Temperature (°C) | Accession Number |
---|---|---|---|---|
BMP7 | F: TGAGTTCCGCATTTACAAGG R: GTGGCTGTGATGTCAAAAAC | 177 | 60 | NM_001308564.1 |
PCNA | F: CGAGGGCTTCGACACTTAC | 97 | 60 | XM_004014340.5 |
R: GTCTTCATTGCCAGCACATT | ||||
DNMT1 | F: CCCAGGAGAAGCAAGTCTGATG R: TGATGGTGGTCTGCCTGGTAGT | 91 | 60 | NM_001009473.1 |
GAPDH | F: TCTCAAGGGCATTCTAGGCTAC | 151 | 60 | NM_001190390.1 |
R: GCCGAATTCATTGTCGTACCAG |
Primer Name | Primer Sequence (5′-3′) | Product Size (bp) | Annealing Temperature (°C) |
---|---|---|---|
BMP7 core promoter | F: CGAGCTCTTACGCGTGCTAGCTCCCACGGGTCCCGTTCA R: CAGTACCGGAATGCCAAGCTTCGCGCGACCCGGGCTCCG | 800 | 60 |
OE-DNMT1 | F: TAGTCCAGTGTGGTGGAATTCATGCCTGCCCGTACCGCC | 4836 | 63 |
R: GCCCTCTAGACTCGAGCGGCCGCCTAGTCCTTGGCAGCCTCCTC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lv, X.; He, M.; Wang, S.; Zheng, W.; Zhou, H.; Mwacharo, J.M.; Sun, W. The Role of BMP7 in the Proliferation of Hu Sheep Dermal Papilla Cells Is Influenced by DNA Methylation. Animals 2024, 14, 1699. https://doi.org/10.3390/ani14111699
Lv X, He M, Wang S, Zheng W, Zhou H, Mwacharo JM, Sun W. The Role of BMP7 in the Proliferation of Hu Sheep Dermal Papilla Cells Is Influenced by DNA Methylation. Animals. 2024; 14(11):1699. https://doi.org/10.3390/ani14111699
Chicago/Turabian StyleLv, Xiaoyang, Mingliang He, Shanhe Wang, Wenxin Zheng, Hanlin Zhou, Joram M. Mwacharo, and Wei Sun. 2024. "The Role of BMP7 in the Proliferation of Hu Sheep Dermal Papilla Cells Is Influenced by DNA Methylation" Animals 14, no. 11: 1699. https://doi.org/10.3390/ani14111699