The Effects of Dietary Pterostilbene on the Immune Response, Antioxidant Function, and Jejunal Structure of Broilers
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Animal Design and Diets
2.2. Sample Collection
2.3. Determination of Intestinal Tissue Structure
2.4. Measurement of Serum Biochemical Inflammatory Indicators and Immunoglobulins
2.5. Measurement of Lymphocyte Transformation Rate of Spleen
2.6. Measurement of Antioxidant Status
2.7. RNA Isolation and Quantitative Real-Time PCR (qRT-PCR)
2.8. Western Blotting
2.9. Statistical Analysis
3. Results
3.1. Effects of Dietary PTE on Immune Indexes of Broilers
3.2. Effects of Dietary PTE on Inflammatory Response of Broilers
3.3. Effects of Dietary PTE on Antioxidant Status of the Broiler Serum and Jejunum
3.4. Effects of Dietary PTE on Intestinal Structure of Broilers
3.4.1. The Jejunum Index
3.4.2. The Jejunal Structure
3.5. The Effects of Dietary PTE on the Expression Levels of Tight Junction Protein Genes in the Jejunum
3.6. The Effects of Dietary PTE on the Expression Levels of Inflammation-Related Genes in the Jejunum
3.7. The Effects of Dietary PTE on the Expression Levels of Sirt1 and NF-κB Genes in the Jejunum
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Rashid, Z.; Mirani, Z.A.; Zehra, S.; Gilani, S.M.H.; Ashraf, A.; Azhar, A.; Al-Ghanim, K.; Al-Misned, F.; Al-Mulahim, N.; Mahboob, S. Enhanced modulation of gut microbial dynamics affecting body weight in birds triggered by natural growth promoters administered in conventional feed. SAUDI J. Biol. Sci. 2020, 27, 2747–2755. [Google Scholar] [CrossRef] [PubMed]
- Sejian, V.; Silpa, M.; Reshma Nair, M.; Devaraj, C.; Krishnan, G.; Bagath, M.; Chauhan, S.; Suganthi, R.; Fonseca, V.; König, S. Heat stress and goat welfare: Adaptation and production considerations. Animals 2021, 11, 1021. [Google Scholar] [CrossRef] [PubMed]
- Chai, X.; Sun, X.; Qi, X.; Shan, A.; Feng, X. Food Security: Nutritional characteristics, feed utilization status and limiting factors of aged brown rice. Agriculture 2024, 14, 858. [Google Scholar] [CrossRef]
- Seigner, J.; Junker-Samek, M.; Plaza, A.; D ‘Urso, G.; Masullo, M.; Piacente, S.; Holper-Schichl, Y.M.; de Martin, R. A Symphytum officinale root extract exerts anti-inflammatory properties by affecting two distinct steps of NF-κB signaling. Front. Pharmacol. 2019, 10, 289. [Google Scholar] [CrossRef] [PubMed]
- Moreno, R.M.; Jimenez, V., Jr.; Monroy, F.P. Impact of Binge Alcohol Intoxication on the Humoral Immune Response during Burkholderia spp. Infections. Microorganisms 2019, 7, 125. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Sun, X.; Chai, X.; Jiao, Y.; Sun, J.; Wang, S.; Yu, H.; Feng, X. Curcumin Mitigates Oxidative Damage in Broiler Liver and Ileum Caused by Aflatoxin B1-Contaminated Feed through Nrf2 Signaling Pathway. Animals 2024, 14, 409. [Google Scholar] [CrossRef] [PubMed]
- Guan, P.; Yu, H.; Wang, S.; Sun, J.; Chai, X.; Sun, X.; Qi, X.; Zhang, R.; Jiao, Y.; Li, Z.; et al. Dietary rutin alleviated the damage by cold stress on inflammation reaction, tight junction protein and intestinal microbial flora in the mice intestine. J. Nutr. Biochem. 2024, 130, 109658. [Google Scholar] [CrossRef] [PubMed]
- Meng, Q.; Guo, T.; Li, G.; Sun, S.; He, S.; Cheng, B.; Shi, B.; Shan, A. Dietary resveratrol improves antioxidant status of sows and piglets and regulates antioxidant gene expression in placenta by Keap1-Nrf2 pathway and Sirt1. J. Anim. Sci. Biotechnol. 2018, 9, 34. [Google Scholar] [CrossRef] [PubMed]
- Nunes, S.; Danesi, F.; Del Rio, D.; Silva, P. Resveratrol and inflammatory bowel disease: The evidence so far. Nutr. Res. Rev. 2018, 31, 85–97. [Google Scholar] [CrossRef]
- Dyck, G.J.; Raj, P.; Zieroth, S.; Dyck, J.R.; Ezekowitz, J.A. The effects of resveratrol in patients with cardiovascular disease and heart failure: A narrative review. Int. J. Mol. Sci. 2019, 20, 904. [Google Scholar] [CrossRef]
- Liu, T.-H.; Wang, J.; Zhang, C.-Y.; Zhao, L.; Sheng, Y.-Y.; Tao, G.-S.; Xue, Y.-Z. Gut microbial characteristical comparison reveals potential anti-aging function of Dubosiella newyorkensis in mice. Front. Endocrinol. 2023, 14, 1133167. [Google Scholar] [CrossRef] [PubMed]
- Wang, L.; Lai, C.; Li, D.; Luo, Z.; Liu, L.; Jiang, Y.; Li, L. Lecithin-polysaccharide self-assembled microspheres for resveratrol delivery. Antioxidants 2022, 11, 1666. [Google Scholar] [CrossRef] [PubMed]
- Lange, K.W.; Li, S. Resveratrol, pterostilbene, and dementia. Biofactors 2018, 44, 83–90. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Sang, S. Metabolism and pharmacokinetics of resveratrol and pterostilbene. Biofactors 2018, 44, 16–25. [Google Scholar] [CrossRef] [PubMed]
- Virgili, F.; Marino, M. Regulation of cellular signals from nutritional molecules: A specific role for phytochemicals, beyond antioxidant activity. Free. Radic. Biol. Med. 2008, 45, 1205–1216. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Chen, Y.; Li, Y.; Jia, P.; Ji, S.; Chen, Y.; Wang, T. Protective effects of pterostilbene against hepatic damage, redox imbalance, mitochondrial dysfunction, and endoplasmic reticulum stress in weanling piglets. J. Anim. Sci. 2020, 98, skaa328. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Chen, Y.; Zhang, H.; Wang, T. Pterostilbene as a protective antioxidant attenuates diquat-induced liver injury and oxidative stress in 21-day-old broiler chickens. Poult. Sci. 2020, 99, 3158–3167. [Google Scholar] [CrossRef] [PubMed]
- Hsu, C.L.; Lin, Y.J.; Ho, C.T.; Yen, G.C. The inhibitory effect of pterostilbene on inflammatory responses during the interaction of 3T3-L1 adipocytes and RAW 264.7 macrophages. J. Agric. Food. Chem. 2013, 61, 602–610. [Google Scholar] [CrossRef]
- Klingensmith, N.J.; Fay, K.T.; Swift, D.A.; Bazzano, J.M.; Lyons, J.D.; Chen, C.-W.; Meng, M.; Ramonell, K.M.; Liang, Z.; Burd, E.M. Junctional adhesion molecule-A deletion increases phagocytosis and improves survival in a murine model of sepsis. JCI Insight 2022, 7, e156255. [Google Scholar] [CrossRef]
- Yan, D.; Wei, G.; Ai, Z.; Song, S.; Zhang, L.; Dong, N.; Dou, X.; Shan, A. CXCR2, as a key regulatory gene of HDP-PG-1, maintains intestinal mucosal homeostasis. J. Agric. Food Chem. 2024, 269, 132025. [Google Scholar] [CrossRef]
- Cai, T.-T.; Ye, X.-L.; Li, R.-R.; Chen, H.; Wang, Y.-Y.; Yong, H.-J.; Pan, M.-L.; Lu, W.; Tang, Y.; Miao, H. Resveratrol modulates the gut microbiota and inflammation to protect against diabetic nephropathy in mice. Front. Pharmacol. 2020, 11, 1249. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Zhang, H.; Li, Y.; Wang, T. Pterostilbene Confers Protection against Diquat-Induced Intestinal damage with potential regulation of redox status and ferroptosis in broiler chickens. Oxid. Med. Cell. Longev. 2023, 2023, 8258354. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Chen, Y.; Chen, Y.; Ji, S.; Jia, P.; Li, Y.; Wang, T. Comparison of the protective effects of resveratrol and pterostilbene against intestinal damage and redox imbalance in weanling piglets. J. Anim. Sci. Biotechnol. 2020, 11, 52. [Google Scholar] [CrossRef] [PubMed]
- Council, N. Nutrient Requirements of Poultry, 9th revised ed.; National Academy of Sciences: Washington, DC, USA, 1994. [Google Scholar]
- Yang, H.; Wang, Y.; Jin, S.; Pang, Q.; Shan, A.; Feng, X. Dietary resveratrol alleviated lipopolysaccharide-induced ileitis through Nrf2 and NF-κB signalling pathways in ducks (Anas platyrhynchos). J. Anim. Physiol. Anim. Nutr. 2022, 106, 1306–1320. [Google Scholar] [CrossRef] [PubMed]
- Jin, S.; Yang, H.; Jiao, Y.; Pang, Q.; Wang, Y.; Wang, M.; Shan, A.; Feng, X. Dietary curcumin alleviated acute ileum damage of ducks (Anas platyrhynchos) induced by AFB1 through regulating Nrf2-ARE and NF-κB signaling pathways. Foods 2021, 10, 1370. [Google Scholar] [CrossRef] [PubMed]
- Choo, Q.Y.; Yeo, S.C.M.; Ho, P.C.; Tanaka, Y.; Lin, H.S. Pterostilbene surpassed resveratrol for anti-inflammatory application: Potency consideration and pharmacokinetics perspective. J. Funct. Foods 2014, 11, 352–362. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, L.L.; Zhan, X.A.; Zeng, X.F.; Zhou, L.; Cao, G.T.; Chen, A.G.; Yang, C.M. Effects of dietary supplementation of probiotic, Clostridium butyricum, on growth performance, immune response, intestinal barrier function, and digestive enzyme activity in broiler chickens challenged with Escherichia coli K88. J. Anim. Sci. Biotechnol. 2016, 7, 3. [Google Scholar] [CrossRef] [PubMed]
- Kosuru, R.; Kandula, V.; Rai, U.; Prakash, S.; Xia, Z.; Singh, S. Pterostilbene Decreases Cardiac Oxidative Stress and Inflammation via Activation of AMPK/Nrf2/HO-1 Pathway in Fructose-Fed Diabetic Rats. Cardiovasc. Drugs Ther. 2018, 32, 147–163. [Google Scholar] [CrossRef] [PubMed]
- Chang, J.; Rimando, A.; Pallas, M.; Camins, A.; Porquet, D.; Reeves, J.; Shukitt-Hale, B.; Smith, M.A.; Joseph, J.A.; Casadesus, G. Low-dose pterostilbene, but not resveratrol, is a potent neuromodulator in aging and Alzheimer’s disease. Neurobiol. Aging 2012, 33, 2062–2071. [Google Scholar] [CrossRef]
- Zhang, L.; Zhang, J.; Zang, H.; Yin, Z.; Guan, P.; Yu, C.; Shan, A.; Feng, X. Dietary pterostilbene exerts potential protective effects by regulating lipid metabolism and enhancing antioxidant capacity on liver in broilers. J. Anim. Physiol. Anim. Nutr. 2024. early view. [Google Scholar] [CrossRef]
- Liu, L.L.; He, J.H.; Xie, H.B.; Yang, Y.S.; Li, J.C.; Zou, Y. Resveratrol induces antioxidant and heat shock protein mRNA expression in response to heat stress in black-boned chickens. Poult. Sci. 2014, 93, 54–62. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhou, Y.; Sun, G.; Li, K.; Li, Z.; Su, A.; Liu, X.; Li, G.; Jiang, R.; Han, R. Transcriptome profile in bursa of Fabricius reveals potential mode for stress-influenced immune function in chicken stress model. BMC Genom. 2018, 19, 918. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Li, W.; Yang, S.; Sun, X.; Tarique, I.; Yang, P.; Chen, Q. Morphological characterization of postembryonic development of blood–spleen barrier in duck. Poult. Sci. 2020, 99, 3823–3830. [Google Scholar] [CrossRef]
- Zhang, C.; Chen, K.K.; Zhao, X.H.; Geng, Z.Y. Protective effects of resveratrol against high ambient temperature-induced spleen dysplasia in broilers through modulating splenic redox status and apoptosis. J. Sci. Food Agric. 2018, 98, 5409–5417. [Google Scholar] [CrossRef] [PubMed]
- He, S.P.; Yu, Q.F.; He, Y.J.; Hu, R.Z.; Xia, S.T.; He, J.H. Dietary resveratrol supplementation inhibits heat stress-induced high-activated innate immunity and inflammatory response in spleen of yellow-feather broilers. Poult. Sci. 2019, 98, 6378–6387. [Google Scholar] [CrossRef]
- Berkeveld, M.; Langendijk, P.; Verheijden, J.H.M.; Taverne, M.A.M.; van Nes, A.; van Haard, P.; Koets, A.P. Citrulline and intestinal fatty acid-binding protein: Longitudinal markers of postweaning small intestinal function in pigs? J. Anim. Sci. 2008, 86, 3440–3449. [Google Scholar] [CrossRef]
- Iizuka, M.; Konno, S. Wound healing of intestinal epithelial cells. World J. Gastroenterol. 2011, 17, 2161–2171. [Google Scholar] [CrossRef] [PubMed]
- Hermans, D.; Pasmans, F.; Heyndrickx, M.; Van Immerseel, F.; Martel, A.; Deun, K.; Haesebrouck, F. A tolerogenic mucosal immune response leads to persistent Campylobacter jejuni colonization in the chicken gut. Crit. Rev. Microbiol. 2012, 38, 17–29. [Google Scholar] [CrossRef]
- Fu, Q.T.; Cui, Q.K.; Yang, Y.; Zhao, X.H.; Song, X.; Wang, G.X.; Bai, L.; Chen, S.F.; Tian, Y.; Zou, Y.F.; et al. Effect of Resveratrol Dry Suspension on Immune Function of Piglets. Evid.-Based Complement. Altern. Med. 2018, 2018, 5952707. [Google Scholar] [CrossRef]
- Viveros, A.; Chamorro, S.; Pizarro, M.; Arija, I.; Centeno, C.; Brenes, A. Effects of dietary polyphenol-rich grape products on intestinal microflora and gut morphology in broiler chicks. Poult. Sci. 2011, 90, 566–578. [Google Scholar] [CrossRef]
- Lai, X.; Pei, Q.; Song, X.; Zhou, X.; Yin, Z.; Jia, R.; Zou, Y.; Li, L.; Yue, G.; Liang, X. The enhancement of immune function and activation of NF-κB by resveratrol-treatment in immunosuppressive mice. Int. Immunopharmacol. 2016, 33, 42–47. [Google Scholar] [CrossRef] [PubMed]
- Wouters, D.; Wiessenberg, H.D.; Hart, M.; Bruins, P.; Voskuyl, A.; Daha, M.R.; Hack, C.E. Complexes between C1q and C3 or C4: Novel and specific markers for classical complement pathway activation. J. Immunol. Methods 2005, 298, 35–45. [Google Scholar] [CrossRef] [PubMed]
- Pasternack, M.S. Fundamental Immunology Edited by William E. Paul. 3rd edition. New York: Raven Press, 1993. 1,490 pp. illustrated. $95. Clin. Infect. Dis. 1994, 19, 996–997. [Google Scholar] [CrossRef]
- Han, Y.J.; Kwon, Y.G.; Chung, H.T.; Lee, S.K.; Simmons, R.L.; Billiar, T.R.; Kim, Y.M. Antioxidant enzymes suppress nitric oxide production through the inhibition of NF-kappa B activation: Role of H2O2 and nitric oxide in inducible nitric oxide synthase expression in macrophages. Nitric Oxide 2001, 5, 504–513. [Google Scholar] [CrossRef] [PubMed]
- Bogdan, C. Nitric oxide and the immune response. Nat. Immunol. 2001, 2, 907–916. [Google Scholar] [CrossRef] [PubMed]
- Aktan, F.; Henness, S.; Roufogalis, B.D.; Ammit, A.J. Gypenosides derived from Gynostemma pentaphyllum suppress NO synthesis in murine macrophages by inhibiting iNOS enzymatic activity and attenuating NF-kappaB-mediated iNOS protein expression. Nitric Oxide 2003, 8, 235–242. [Google Scholar] [CrossRef] [PubMed]
- Kroncke, K.D. Cysteine-Zn2+ complexes: Unique molecular switches for inducible nitric oxide synthase-derived NO. FASEB J. 2001, 15, 2503–2507. [Google Scholar] [CrossRef] [PubMed]
- Gao, X.; Xu, Y.X.; Janakiraman, N.; Chapman, R.A.; Gautam, S.C. Immunomodulatory activity of resveratrol: Suppression of lymphocyte proliferation, development of cell-mediated cytotoxicity, and cytokine production. Biochem. Pharmacol. 2001, 62, 1299–1308. [Google Scholar] [CrossRef]
- Radkar, V.; Hardej, D.; Lau-Cam, C.; Billack, B. Evaluation of resveratrol and piceatannol cytotoxicity in macrophages, T cells, and skin cells. Arh. Hig. Rada Toksikol. 2007, 58, 293–304. [Google Scholar] [CrossRef]
- Hsieh, T.C.; Wu, J.M. Differential effects on growth, cell cycle arrest, and induction of apoptosis by resveratrol in human prostate cancer cell lines. Exp. Cell Res. 1999, 249, 109–115. [Google Scholar] [CrossRef]
- Schneider, Y.; Vincent, F.; Duranton, B.; Badolo, L.; Gossé, F.; Bergmann, C.; Seiler, N.; Raul, F. Anti-proliferative effect of resveratrol, a natural component of grapes and wine, on human colonic cancer cells. Cancer Lett. 2000, 158, 85–91. [Google Scholar] [CrossRef] [PubMed]
- Montagne, L.; Pluske, J.; Hampson, D. A review of interactions between dietary fibre and the intestinal mucosa, and their consequences on digestive health in young non-ruminant animals. Anim. Feed Sci. 2003, 108, 95–117. [Google Scholar] [CrossRef]
- Liu, L.; Fu, C.; Yan, M.; Xie, H.; Li, S.; Yu, Q.; He, S.; He, J. Resveratrol modulates intestinal morphology and HSP70/90, NF-κB and EGF expression in the jejunal mucosa of black-boned chickens on exposure to circular heat stress. Food Funct. 2016, 7, 1329–1338. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Chen, Y.; Chen, Y.; Li, Y.; Jia, P.; Ji, S.; Zhou, Y.; Wang, T. Dietary pterostilbene supplementation attenuates intestinal damage and immunological stress of broiler chickens challenged with lipopolysaccharide. J. Anim. Sci. 2020, 98, skz373. [Google Scholar] [CrossRef] [PubMed]
- Zhang, C.; Zhao, X.; Yang, L.; Chen, X.; Jiang, R.; Jin, S.; Geng, Z. Resveratrol alleviates heat stress-induced impairment of intestinal morphology, microflora, and barrier integrity in broilers. Poult. Sci. 2017, 96, 4325–4332. [Google Scholar] [CrossRef] [PubMed]
- Lv, T.; Shen, L.; Yang, L.; Diao, W.; Yang, Z.; Zhang, Y.; Yu, S.; Li, Y. Polydatin ameliorates dextran sulfate sodium-induced colitis by decreasing oxidative stress and apoptosis partially via Sonic hedgehog signaling pathway. Int. Immunopharmacol. 2018, 64, 256–263. [Google Scholar] [CrossRef] [PubMed]
- Zeng, Z.; Yang, Y.; Dai, X.; Xu, S.; Li, T.; Zhang, Q.; Zhao, K.-S.; Chen, Z. Polydatin ameliorates injury to the small intestine induced by hemorrhagic shock via SIRT3 activation-mediated mitochondrial protection. Expert Opin. Ther. Targets 2016, 20, 645–652. [Google Scholar] [CrossRef]
- Bereswill, S.; Muñoz, M.; Fischer, A.; Plickert, R.; Haag, L.-M.; Otto, B.; Kühl, A.A.; Loddenkemper, C.; Göbel, U.B.; Heimesaat, M.M. Anti-inflammatory effects of resveratrol, curcumin and simvastatin in acute small intestinal inflammation. PLoS ONE 2010, 5, e15099. [Google Scholar] [CrossRef] [PubMed]
- Ling, K.-H.; Wan, M.L.Y.; El-Nezami, H.; Wang, M. Protective capacity of resveratrol, a natural polyphenolic compound, against deoxynivalenol-induced intestinal barrier dysfunction and bacterial translocation. Chem. Res. Toxicol. 2016, 29, 823–833. [Google Scholar] [CrossRef]
- Caruso, R.; Marafini, I.; Franzè, E.; Stolfi, C.; Zorzi, F.; Monteleone, I.; Caprioli, F.; Colantoni, A.; Sarra, M.; Sedda, S. Defective expression of SIRT1 contributes to sustain inflammatory pathways in the gut. Mucosal Immunol. 2014, 7, 1467–1479. [Google Scholar] [CrossRef]
- Wellman, A.S.; Metukuri, M.R.; Kazgan, N.; Xu, X.; Xu, Q.; Ren, N.S.; Czopik, A.; Shanahan, M.T.; Kang, A.; Chen, W. Intestinal epithelial sirtuin 1 regulates intestinal inflammation during aging in mice by altering the intestinal microbiota. Gastroenterology 2017, 153, 772–786. [Google Scholar] [CrossRef] [PubMed]
- Singh, U.P.; Singh, N.P.; Singh, B.; Hofseth, L.J.; Price, R.L.; Nagarkatti, M.; Nagarkatti, P.S. Resveratrol (trans-3, 5, 4′-trihydroxystilbene) induces silent mating type information regulation-1 and down-regulates nuclear transcription factor-κB activation to abrogate dextran sulfate sodium-induced colitis. J. Pharmacol. Exp. Ther. 2010, 332, 829–839. [Google Scholar] [CrossRef] [PubMed]
Ingredients (%) | 0–21 Days | 22–42 Days | Nutrient Levels 2 | 0–21 Days | 22–42 Days |
---|---|---|---|---|---|
Corn | 58.50 | 61.15 | Metabolic energy (MJ/kg) | 12.54 | 12.96 |
Soybean meal | 30.00 | 26.30 | Crude protein (%) | 21.50 | 20.09 |
Soybean oil | 2.70 | 3.80 | Lysine (%) | 1.15 | 1.01 |
Corn gluten meal | 4.06 | 4.33 | Methionine (%) | 0.55 | 0.43 |
Methionine | 0.21 | 0.10 | Methionine + Cysteine (%) | 0.91 | 0.77 |
L-Lysine | 0.20 | 0.14 | Threonine (%) | 0.80 | 0.73 |
Dicalcium phosphate | 1.60 | 1.52 | Tryptophan (%) | 0.21 | 0.18 |
Limestone | 1.33 | 1.26 | Arginine (%) | 1.20 | 1.12 |
Sodium chloride | 0.30 | 0.30 | Leucine (%) | 1.26 | 1.05 |
Choline chloride | 0.10 | 0.10 | Isoleucine (%) | 0.81 | 0.75 |
Premix 1 | 1.00 | 1.00 | Phenylalanine (%) | 0.71 | 0.66 |
Total | 100.00 | 100.00 | Phenylalanine + Tyrosine (%) | 1.27 | 1.15 |
Histidine (%) | 0.35 | 0.32 | |||
Valine (%) | 0.85 | 0.74 | |||
Calcium (%) | 1.06 | 0.91 | |||
Total phosphorus (%) | 0.73 | 0.69 | |||
Available phosphorus (%) | 0.45 | 0.43 |
Genes | Sequence (5′ to 3′) | Product Size (bp) | GenBank No. |
---|---|---|---|
β-actin | F: TGCGTGACATCAAGGAGAAG R: TGCCAGGGTACATTGTGGTA | 300 | NM_205518.2 |
IL-1β | F: TGCCTGCAGAAGAAGCCTCG R: GACGGGCTCAAAAACCTCCT | 204 | NM_204524.2 |
IL-4 | F: AGCCAGCACTGCCACAAGAAC R: GTGGAAGAAGGTACGTAGGTCTGC | 156 | XM_046900385.1 |
IL-6 | F: TTTATGGAGAAGACCGTGAGG R: TGTGGCAGATTGGTAACAGAG | 106 | NM_204628.2 |
IL-8 | F: TCATGTTCTCCATACCCTTGGT R: AAACTGCGAGTGGGGTCAG | 175 | NM_010851 |
TNF-α | F: CAGGACAGCCTATGCCAACAAG R: GGTTACAGGAAGGGCAACTCATC | 114 | XM_046927265.1 |
IFN-γ | F: ATGTAGCTGACGGTGGACCT R: TTCACGCCATCAGGAAGGTT | 196 | NM_205149.2 |
NLRP3 | F: GGTTTACCAGGGGAA ATGAG R: TTGTGCTTCCAGAT GCCGT | 253 | XM_046918112.1 |
Claudin 1 | F: GCAGATCCAGTGCAAGGTGTA R: CACTTCATGCCCGTCACAG | 132 | NM_001013611.2 |
Claudin 2 | F: CCTGCTCACCCTCATTGGAG R: GCTGAACTCACTCTTGGGCT | 145 | NM_001277622.1 |
Occludin | F: CCGTAACCCCGAGTTGGAT R: ATTGAGGCGGTCGTTGATG | 214 | XM_046904540.1 |
ZO-1 | F: TGTAGCCACAGCAAGAGGTG R: CTGGAATGGCTCCTTGTGGT | 98 | XM_046925214.1 |
NF-κB | F: TCAACGCAGGACCTAAAGACAT R: GCAGATAGCCAAGTTCAGGATG | 162 | XM_046915553.1 |
Sirt1 | F: GATCAGCAAAAGGCTGGATGGT R: ACGAGCCGCTTTCGCTACTAC | 143 | NM_001004767.2 |
Control | PTE200 | PTE400 | PTE600 | |
---|---|---|---|---|
Thymus index (g/kg·BW) | 4.33 ± 0.05 a | 4.13 ± 0.14 ab | 4.54 ± 0.17 a | 3.83 ± 0.15 b |
Spleen index (g/kg·BW) | 1.35 ± 0.07 | 1.51 ± 0.010 | 1.54 ± 0.05 | 1.29 ± 0.09 |
Bursa of Fabricius index (g/kg·BW) | 1.49 ± 0.04 | 1.54 ± 0.04 | 1.63 ± 0.05 | 1.62 ± 0.09 |
Parameters | Control | PTE200 | PTE400 | PTE600 |
---|---|---|---|---|
IL-4 (μg/L) | 68.86 ± 1.47 b | 77.55 ± 2.50 a | 78.37 ± 1.06 a | 65.38 ± 2.25 b |
IL-6 (μg/L) | 76.39 ± 1.94 a | 64.91 ± 1.31 b | 60.53 ± 0.99 b | 65.70 ± 2.48 b |
IL-1β (μg/L) | 55.1 ± 2.08 a | 48.9 ± 1.50 b | 52.5 ± 0.911 ab | 55.8 ± 1.77 a |
TNF-α (pg/mL) | 72.9 ± 1.65 a | 69.1 ± 1.87 a | 63.1 ± 2.40 b | 63.4 ± 1.26 b |
TNOS (U/mL) | 9.87 ± 0.31 a | 9.53 ± 0.15 ab | 9.19 ± 0.45 b | 8.99 ± 0.31 b |
iNOS (U/mL) | 2.16 ± 0.23 | 2.51 ± 0.39 | 2.55 ± 0.37 | 2.46 ± 0.94 |
NO (μmol/L) | 18.83 ± 1.43 ab | 14.54 ± 3.85 bc | 19.68 ± 1.70 a | 11.23 ± 2.58 c |
Items | Control | PTE200 | PTE400 | PTE600 |
---|---|---|---|---|
T-AOC (U/mL) | 1.12 ± 0.114 | 1.53 ± 0.270 | 1.19 ± 0.187 | 1.10 ± 0.084 |
CAT (U/mL) | 3.50 ± 0.195 | 4.44 ± 0.373 | 4.41 ± 0.744 | 3.96 ± 0.272 |
GSH-Px (U/mL) | 1001 ± 122 | 1002 ± 230 | 1498 ± 126 | 1378 ± 115 |
T-SOD (U/mg prot) | 127 ± 5.95 b | 137 ± 1.14 a | 135 ± 0.856 ab | 126 ± 4.48 ab |
MDA (nmol/mL) | 4.27 ± 0.390 a | 3.01 ± 0.262 b | 3.07 ± 0.183 b | 3.41 ± 0.331 b |
Items | Control | PTE200 | PTE400 | PTE600 |
---|---|---|---|---|
T-AOC (U/mg prot) | 0.695 ± 0.013 | 0.699 ± 0.004 | 0.715 ± 0.008 | 0.714 ± 0.011 |
CAT (U/mg prot) | 3.824 ± 0.336 b | 6.381 ± 0.226 a | 7.203 ± 0.176 a | 6.876 ± 0.914 a |
GSH-Px (U/mg prot) | 9.332 ± 1.41 c | 12.503 ± 0.916 bc | 13.410 ± 0.818 b | 22.404 ± 1.190 a |
T-SOD (U/mg prot) | 102.1 ± 3.1 b | 106.4 ± 6.2 b | 125.7 ± 3.7 a | 105.0 ± 4.0 b |
MDA (nmol/mg prot) | 0.393 ± 0.0349 a | 0.243 ± 0.0137 b | 0.0758 ± 0.0324 c | 0.389 ± 0.0148 a |
Items | Relative Length (cm/kg·BW) | Relative Weight (g/kg·BW) | Unit Weight (g/cm) |
---|---|---|---|
Control | 28.98 ± 1.41 a | 10.28 ± 0.18 a | 0.37 ± 0.02 a |
PTE200 | 26.93 ± 1.63 ab | 9.92 ± 0.12 ab | 0.36 ± 0.01 a |
PTE400 | 25.76 ± 0.52 b | 9.60 ± 0.07 b | 0.36 ± 0.02 a |
PTE600 | 27.27 ± 2.57 ab | 9.90 ± 0.33 b | 0.33 ± 0.15 b |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yin, Z.; Sun, X.; Chai, X.; Zhou, X.; Wang, Y.; Liu, M.; Feng, X. The Effects of Dietary Pterostilbene on the Immune Response, Antioxidant Function, and Jejunal Structure of Broilers. Animals 2024, 14, 1851. https://doi.org/10.3390/ani14131851
Yin Z, Sun X, Chai X, Zhou X, Wang Y, Liu M, Feng X. The Effects of Dietary Pterostilbene on the Immune Response, Antioxidant Function, and Jejunal Structure of Broilers. Animals. 2024; 14(13):1851. https://doi.org/10.3390/ani14131851
Chicago/Turabian StyleYin, Zesheng, Xue Sun, Xuehong Chai, Xin Zhou, Yingjie Wang, Mengru Liu, and Xingjun Feng. 2024. "The Effects of Dietary Pterostilbene on the Immune Response, Antioxidant Function, and Jejunal Structure of Broilers" Animals 14, no. 13: 1851. https://doi.org/10.3390/ani14131851