Next Article in Journal
Effect of Guanidinoacetic Acid on Production Performance, Serum Biochemistry, Meat Quality and Rumen Fermentation in Hu Sheep
Previous Article in Journal
The Presence of Microplastics in the Gastrointestinal Tracts of Song Thrushes (Turdus philomelos) Wintering in Apulia (Southern Italy)—Preliminary Results
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 14
10.3390/ani14142051
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Nuclear Receptor Subfamily 4 Group A Member 1 (NR4A1) Promotes the Adipogenesis of Intramuscular Preadipocytes through PI3K/AKT Pathway in Goats

by
Jiani Xing
1,2,†,
Jianying Zheng
1,2,†,
Sheng Cui
1,2,†,
Jinling Wang
3,
Yong Wang
1,2,*,
Yanyan Li
1,2,
Jiangjiang Zhu
1 and
Yaqiu Lin
1,2,*
1
Key Laboratory of Qinghai-Tibetan Plateau Animal Genetic Resource Reservation and Utilization, Ministry of Education, Southwest Minzu University, Chengdu 610041, China
2
College of Animal Husbandry and Veterinary Medicine, Southwest Minzu University, Chengdu 610041, China
3
College of Life Science and Biotechnology, Mianyang Teachers’ College, Mianyang 621000, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2024, 14(14), 2051; https://doi.org/10.3390/ani14142051
Submission received: 11 June 2024 / Revised: 7 July 2024 / Accepted: 10 July 2024 / Published: 12 July 2024
(This article belongs to the Section Small Ruminants)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Nuclear Receptor Subfamily 4 Group A Member 1 (NR4A1) acts as a transcription factor to participate in lots of physiological activities including cell proliferation and cell differentiation. In this study, we found that NR4A1 promoted goat intramuscular preadipocyte differentiation through the PI3K/AKT pathway. This study provides important information about NR4A1 in the intramuscular preadipocyte differentiation in goats and therefore identifies a target for goat meat quality improvement studies.

Abstract

As a transcription factor, Nuclear Receptor Subfamily 4 Group A Member 1 (NR4A1) binds to downstream target genes to participate in cell proliferation and cell differentiation. We found that the NR4A1 reached the highest expression at 60 h after the differentiation of goat intramuscular preadipocytes. Overexpression of goat NR4A1 increased the number of intracellular lipid droplets and up-regulated the expression of adipocyte-differentiation-related marker genes including AP2, SREBP1, ACC, GPAM, and DGAT2, while the relative expression levels of Pref-1 and HSL were significantly decreased. On the contrary, after NR4A1 was knocked down by siRNA, the number of intracellular lipid droplets and the relative expression levels of LPL, CEBPα, CEBPβ, ACC, and DGAT2 were significantly decreased, and the relative expression levels of Pref-1 and HSL were significantly up-regulated. These results suggest that NR4A1 promotes the differentiation of goat intramuscular preadipocytes. Transcriptome sequencing was carried out after overexpression of goat NR4A1, and the KEGG enrichment analysis result showed that the most differentially expressed genes were related to adipocyte differentiation and were enriched in the PI3K-Akt signaling pathway. LY249002, an inhibitor of the PI3K-Akt signaling pathway, was introduced and decreased the number of intracellular lipid droplets, and the relative expression levels of C/EBPα, SREBP1, AP2, C/EBPβ, GPAM, ACC, DGAT1, DGAT2, and ATGL were decreased accordingly. The above results indicate that overexpression of goat NR4A1 may promote the differentiation of intramuscular preadipocytes through the PI3K-Akt signaling pathway.

1. Introduction

The goat breeding industry plays a vital role in China’s animal husbandry, and goat meat is favored by lots of consumers owing to its high protein content, low content of fat and cholesterol, and rich, abundant essential amino acids. Therefore, the improvement of the quality of mutton becomes an urgent problem to be solved. Intramuscular fat (IMF) content is one of the key determinant factors that affects the flavor, tenderness, and juiciness of meat and is determined by preadipocyte differentiation and lipid metabolism. The differentiation of preadipocytes is a complex process with changes of cell morphology, structure, and function, in which functional genes and transcription factors play a major role. Thus, there is great significance to revealing the key candidate genes and transcription factors and the regulatory mechanism of intramuscular fat deposition in goats.
NR4A1 (also known as Nur77 and TR3) is a member of the orphan nuclear receptor transcription factor family and one of the first early response genes to be discovered by rapid activation of NGF in PC12 pheochromocytoma cells [1]. NR4A1 is expressed in a variety of tissues and participates in a variety of physiological activities, including cell proliferation and apoptosis [2,3], and can be induced by physical stimulation and physiological signal expression [4].
In recent years, more and more studies have proved that NR4A1 is involved in the regulation of animal fat metabolism [5], for instance, NR4A1 knockout mice, compared with wild-type mice, fed with high-fat diet were more prone to obesity [6]. However, there are two completely opposite theories about the role of NR4A1 in adipocyte differentiation. Chao et al. [7] also found that overexpression of NR4A1 can inhibit the differentiation of 3T3-F442A preadipocytes. However, Yi et al. [8] pointed out that the low expression of NR4A1 can reduce the body weight, blood lipid, and blood sugar of type 2 diabetic mice, and the size of adipocytes and the volume of lipid droplets decreased accordingly. Jung et al. [9] found that NR4A1 knockout inhibits adipogenesis and differentiation of 3T3-L1 preadipocytes, which is accompanied by a decrease in mitotic clone amplification (MCE) and the MCE-required and cell-cycle-related gene expression (including expression of cyclin An and cyclin D1) in the early stage of adipogenesis. The latest studies have shown that NR4A1 can directly inhibit the transcription of PPARγ by activating the expression of GATA2, and indirectly up-regulate p53 to reduce the expression of SREBP1c and downstream gene FAS, thus inhibiting adipogenesis [2], but it has also been reported that overexpression of NR4A1 or interference with NR4A1 in 3T3-L1 cells can reduce adipocyte differentiation, while transient overexpression can promote lipid accumulation [3]. The above studies suggest that NR4A1 has an effect on adipocyte differentiation and lipid metabolism, but there are differences in the mode of action, and the mechanism has not been fully explained. At the same time, the effect of NR4A1 on the differentiation of ruminant preadipocytes and its possible mechanism have not been reported yet.
Thus, the cultured goat intramuscular preadipocytes were introduced to reveal the function and the molecular mechanism of NR4A1 in regulating IMF deposition. The expression trend of goat NR4A1 in intramuscular adipocytes at different differentiation stages was detected by qPCR; overexpression and RNA interference were introduced to explicate the effect of goat NR4A1 on intramuscular adipocyte differentiation; the number of lipid droplets of intramuscular adipocytes was observed by oil red O staining; and the relative expression levels of adipose differentiation marker genes and lipid-metabolism-related genes were detected by qPCR. RNA-Seq, qPCR, and bioinformatics analysis were used to further explore the regulatory mechanism of goat NR4A1 on adipogenesis and lipid metabolism.

2. Materials and Methods

2.1. Animals and Cell Culture

The animal experimentation study received approval from the Laboratory Animal Ethics Committee at Southwest Minzu University and the Animal Disease Control Center in Sichuan Province, China. The Jianzhou Daer goats (Capra hircus) (N 3) were purchased from Sichuan Tiandi Goat Biological Engineering Co., Ltd. (Chengdu, China). Goat intramuscular preadipocytes were isolated and cultured in accordance with previously described methods [10,11]. Concisely, Longissimus dorsi muscle samples were collected from 7-day-old Jianzhou Daer goats and then sheared. Intramuscular preadipocytes were isolated by collagenase type II digestion (Gbico, Thermo, Waltham, MA, USA) containing 2 mg/mL. Finally, preadipocytes were cultured in DMEM/F12 growth medium with 10% FBS and 1% P/S.

2.2. Induction of Goat Intramuscular Preadipocyte

The goat intramuscular preadipocytes were cultured in DMEM/F12 medium containing 10% fetal bovine serum. When the preadipocyte cells’ confluency reached 80%, the differentiation medium (DMEM/F12 medium with 10% FBS and 100 μm/L oleic acid (Sigma)) was added.

2.3. Construction of NR4A1 Overexpression Vector

The primers listed in the following were designed according to the sequence of goat NR4A1 (MN197544.1), and the sequences were as follows:
sense primer: 5′-CGGGGTACCATGCCCTGTATCCAAGCCC-3′;
antisense primer: 5′-ATAAGAATGCGGCCGCTCAGAAGGGCAGTGTGTCC-3′.
The previously constructed NR4A1-PMD19T plasmid was used as the template, the primers containing restriction enzyme sites were used for amplification, and then gel extraction was carried out. The gel extraction product and the pcDNA3.1(+) vector were digested with KpnⅠ and NotⅠ at 37 °C for 1 h, respectively, followed by purification, and then ligated by T4 ligase at 16 °C for 10–14 h. The ligated products were all transformed into DH5α competent cells and spread on LB solid medium containing Amp and cultured at 37 °C for overnight. The next day, monoclonals were randomly selected for colony PCR testing, and the positive monoclonals were transferred in liquid LB medium containing Amp for overnight culture and plasmid extraction. The plasmid concentration was detected by Nanodrop (TY20190063.IMPLEN, Munich, Germany) and then stored at −20 °C.

2.4. Synthesis of siRNA

Two pairs of siRNAs were designed and synthesized by Invitrogen (Carlsbad, CA, USA), named NR4A1 siRNA-1 (5′-CAUGGUGAAGGAAGUUGUCCGGACA-3′, 5′-UGUCCGGACAACUUCCUUCACCAUG-3′) and NR4A1 siRNA-2 (5′-GAGUCCGCCUUUCUGGAGCUCUUUA-3′, 5′-UAAAGAGCUCCAGAAAGGCGGACUC-3′). Negative control was provided by Invitrogen, and the sequences were sense primer 5′-UUCUCCGAACGUGUCACGUTT-3′ and antisense primer 5′-ACGUGACACGUUCGGAGAATT-3′.

2.5. Cell Transfection

When the cells were passaged to the third generation, and the intramuscular adipocyte cells were fused to 80%, the cell samples were collected after 48 h of differentiation induced by the proper amount of overexpression vector, NR4A1 siRNA-1, and NR4A1 siRNA-2. During inhibitor transfection, the experimental group first transfected goat intramuscular preadipocytes with pcDNA3.1-NR4A1, and then added the appropriate amount of LY294002 inhibitor 6 h later. Each processing setting has 3 duplicates.

2.6. RNA Extraction and Quantitative Real-Time Polymerase Chain Reaction (qPCR)

Total RNA was extracted from cultured cell samples using Trizol reagent (TaKaRa, Kusatsu, Shiga, Japan). The integrity of the total RNA was detected by 2% agarose gel electrophoresis, and the concentration was determined using ultraviolet spectrophotometer. For each cell sample, 1 µg of total RNA was reverse transcribed by Revert Aid First Strand cDNA Synthesis Kit (Thermo) according to the manufacturer’s instructions. Ubiquitously expressed prefoldin-like chaperone (UXT) was selected to normalize the expression levels (geometric mean was used to calculate the internal control). The primer information for qPCR is listed in Table 1. SYBR® Premix Ex Taq TM (2×) (Takara) and CFX96 (Bio-Rad) were used to perform qPCR. The qPCR reaction steps were as follows: 95 °C 30 s, 95 °C 10 s, 60 °C 30 s, and 72 °C 30 s, 39 cycles in total. The 2−ΔΔCt method was used to analyze the expression of each gene.

2.7. Oil Red O Staining

Intramuscular adipocytes were cultured in 24-well plates and visualized by oil red O staining. Intramuscular adipocytes were fixed with 500 µL of 10% formaldehyde solution for 30 min after being washed twice with PBS, and then the fixed adipocytes were rinsed twice in PBS and stained with 500 µL of oil red O working solution for 10 min. Subsequently, adipocytes were washed twice using PBS and observed or photographed under microscope. Finally, the lipids were extracted by 1 mL isopropyl alcohol, and the extracted solution was detected in 96-well plates by colorimeter at OD 490 nm.

2.8. Total RNA Extraction and RNA-Seq

Total RNA was extracted from the cells transfected with the NR4A1 overexpression vector (N = 3) and control vector (N = 3) using RNAiso Plus (TaKaRa, Kusatsu, Shiga, Japan) according to the manufacturer’s instructions (Invitrogen), and genomic DNA was removed using DNase I (TaKaRa, Kusatsu, Shiga, Japan). Then, RNA quality was determined by 2100 Bioanalyser (Agilen, Santa Clara, CA, USA) and quantified using the Nanodrop (TY20190063.IMPLEN, Munich, Germany). The RNA-Seq transcriptome library was prepared using the TruSeq TMRNA sample preparation Kit from Illumina (San Diego, CA, USA) using 1 μg of total RNA. Shortly, messenger RNA was isolated according to polyA selection by oligo(dT) beads and then fragmented by fragmentation buffer firstly. Secondly, double-stranded cDNA was synthesized using a SuperScript double-stranded cDNA synthesis kit (Invitrogen, Carlsbad, CA, USA) with random hexamer primers (Illumina). Then, the synthesized cDNA was subjected to end repair, phosphorylation, and ‘A’ base addition according to Illumina’s library construction protocol. Libraries were size-selected for cDNA target fragments of 300 bp on 2% Low-Range Ultra Agarose then were PCR amplified using Phusion DNA polymerase (NEB) for 15 PCR cycles. After being quantified by TBS380, the paired-end RNA-Seq sequencing library was sequenced with the Illumina HiSeq xten/NovaSeq 6000 sequencer (2 × 150 bp read length).
The differentially expressed mRNAs were randomly selected to verify the accuracy of the RNA-Seq results. The primer sequences are listed in Table 2.

2.9. Differentially Expressed Genes and KEGG Analysis

Cuffdiff provides statistical routines for determining differential expression in digital transcript or gene expression data using a model based on the negative binomial distribution [12]. Transcripts with a p-adjust < 0.05 were assigned as differentially expressed. KEGG is a database resource for understanding high-level functions and utilities of the biological system [13]. KOBAS software (3.0) was introduced to test the statistical enrichment of differentially expressed genes (DEGs) in KEGG pathways [14].

2.10. Data Analysis

All the data are provided as “Means ± SD”. One-way ANOVA was performed with SPSS software (26.0) to compare significance, followed by Duncan’s multiple comparison test. A p value less than 0.05 was considered a significant difference. All experiments were repeated three times.

3. Results

3.1. The Expression Patterns of NR4A1 Gene during Differentiation of Goat Intramuscular Adipocytes

The regulatory effect of NR4A1 on goat intramuscular adipocyte differentiation has not been reported; thus, the expression pattern of NR4A1 at different stages of intramuscular adipocyte differentiation was investigated first. The relative expression of NR4A1 was detected at 0, 12, 36, 60, 96 h after differentiation induced by oleic acid. The result revealed that NR4A1 expression showed an overall upward trend in the first 60 h, reached the peak at the 60 h, and then decreased after 60 h during induction. Taken together, NR4A1 was considered to participate in the process of intramuscular preadipocyte differentiation in goats (Figure 1).

3.2. NR4A1 Overexpression Enhances Intramuscular Preadipocyte Differentiation

In order to further investigate the function of NR4A1 in the adipogenesis of goat intramuscular adipocytes, NR4A1 was overexpressed in goat intramuscular preadipocytes using pcDNA3.1-NR4A1. After pcDNA3.1-NR4A1 was transfected into goat intramuscular adipocytes and differentiation induced for 48 h, the expression level of NR4A1 was 2980.74 times higher than in the NC group (p < 0.01) (Figure 2A). The result of the oil red O staining indicated that the number of lipid droplets significantly increased after overexpression of NR4A1 (Figure 2B). The semi-quantitative result also confirmed that NR4A1 could promote lipid droplet accumulation in goat intramuscular preadipocytes (p < 0.01) (Figure 2C). In addition, adipogenic and lipid metabolism genes were assessed by qPCR, and the results showed that overexpression of NR4A1 up-regulated the expression of AP2 (p < 0.05), SREBP1 (p < 0.05), ACC (p < 0.05), GPAM (p < 0.05), and DGAT2 (p < 0.05), and down-regulated the expression of Pref-1 (p < 0.05) and HSL (p < 0.05). However, LPL, PPARγ, C/EBPα, C/EBPβ, FASN, DGAT1, and ATGL had no significant change after NR4A1 overexpression (Figure 2D). Taken together, NR4A1 promoted the differentiation of goat intramuscular adipocytes.

3.3. NR4A1 Knockdown Inhibits Goat Intramuscular Adipocyte Differentiation

To confirm the role of NR4A1 in intramuscular adipogenic differentiation, the effect of NR4A1 knockdown on intramuscular adipocyte differentiation was observed using two specific siRNAs (siNR4A1-1, siNR4A1-2). The relative mRNA expression of NR4A1 was decreased ~44% by siNR4A1-1 (p < 0.01) and ~85% by siNR4A1-2 (p < 0.01) (Figure 3A). Thus, siNR4A1-2 was used for subsequent experiments. As expected, NR4A1 knockdown blocked lipid droplet accumulation, based on the oil red O staining result (Figure 3B), and the quantitative results obtained by the OD value at 490 nm were consistent with the staining result (Figure 3C). At the gene expression level, LPL, C/EBPα, C/EBPβ, ACC, and DGAT2 expression was significantly decreased (p < 0.05), and Pref-1 and HSL expression was significantly increased (p < 0.05). Nevertheless, the expression of PPARγ, AP2, SREBP1, FASN, GPAM, and DGAT1 was correspondingly unaffected (Figure 3D). Thus, knockdown of NR4A1 expression inhibited the adipogenesis of goat intramuscular preadipocytes.

3.4. KEGG Enrichment Analysis

There were 690 differentially expressed genes (DEGs) in total with NR4A1 overexpression compared with in the NC group, in which 446 genes were up-regulated and 244 genes were down-regulated. KEGG enrichment analysis showed that the DEGs were significantly enriched in 86 pathways. The most significant enrichment was in the Calcium signaling pathway, Apelin signaling pathway, PI3K-Akt signaling pathway, Oxytocin signaling pathway, Adrenergic signaling in cardiomyocytes, Arrhythmogenic right ventricular cardiomyopathy, Chemokine signaling pathway, Circadian entrainment, ECM–receptor interaction, and GABAergic synapse (Figure 4). In addition, the Camp signaling pathway, IL-17 signaling pathway, cGMP-PKG signaling pathway, TNF signaling pathway, FoxO signaling pathway, Wnt signaling pathway, Hippo signaling pathway, AMPK signaling pathway, p53 signaling pathway, PPAR signaling pathway, and other pathways related to adipose differentiation were significantly enriched.
The PI3K-Akt signaling pathway, Camp signaling pathway, PPAR signaling pathway, AMPK signaling pathway, and Wnt signaling pathway were selected to analyze the signaling pathways related to adipocyte differentiation and lipid metabolism (Figure 5). It was found that there were different degrees of differentially expressed gene enrichment in these pathways, with the largest number of genes enriched in the PI3K-Akt signaling pathway, and the second pathway with the most gene enrichment, such as enrichment of PIK3CB, COL6A5, ITGB6, and PRKAA2, was the cAMP signaling pathway. Differentially expressed genes such as ITGA10, IL6R, and NR4A1 were enriched in the PI3K-Akt signaling pathway, while PIK3CB, EDN2, VAV3, NPR1, CAMK2B, ADCY1, and GRIA1 were enriched in the cAMP signaling pathway.
The most differentially expressed genes and the NR4A1 gene were all enriched in the PI3K-Akt signaling pathway, and the PI3K-Akt signaling pathway was chosen for further research.

3.5. RNA-Seq Verification Result

In this study, eight differentially expressed mRNAs were randomly selected for expression detection by qPCR. The results confirmed (Figure 6) the RNA-Seq data, indicating that the RNA-Seq data in this study are highly reliable.

3.6. LY294002 Inhibits Overexpression of NR4A1 and Promotes Differentiation of Goat Intramuscular Adipocytes

After overexpression of NR4A1 in goat intramuscular adipocytes, LY249002 (10 μM), an inhibitor of the PI3K-Akt signaling pathway, was added so the morphological changes of lipid droplet accumulation in goat intramuscular adipocytes could be observed to clarify whether NR4A1 plays a certain regulatory role in goat intramuscular adipocyte differentiation through the PI3K-Akt signaling pathway. The results of oil red O staining showed that the number of lipid droplets increased by NR4A1 overexpression was significantly decreased by the inhibitor of LY249002 (Figure 7A). The semi-quantitative results were consistent with the results mentioned earlier, as indicated by the OD value (Figure 7B). The expression level of genes related to adipocyte differentiation, such as C/EBP α, AP2, SREBP1, and C/EBP β, and genes involved in lipid metabolism, such as ACC, GPAM, DGAT1, DGAT2, and ATGL, was also decreased significantly (p < 0.05) (Figure 7C).

4. Discussion

Intramuscular fat deposition is determined by the increase in the preadipocyte cell number and the preadipocyte differentiation, which are precisely regulated by various key genes and transcription factors. Therefore, revealing the crucial transcription factors that influence adipogenesis to enhance intramuscular fat deposition is of great significance. The NR4A family participates in a variety of physiological processes in mammals, such as cell proliferation and differentiation, and NR4A1 is one of the family members [2,3]. Based on the results for NR4A1 in 3T3-L1 and 3T3-F442A cell lines, it was confirmed that NR4A1 is involved in adipocyte differentiation, but the mechanism remains unclear. To clarify the effect of goat NR4A1 on the differentiation of intramuscular preadipocytes and the underlying mechanism, the expression pattern of NR4A1 in different differentiation stages of goat intramuscular preadipocytes was analyzed, and it was found that goat NR4A1 showed an upward trend in the first 60 h of differentiation, and a downward trend during 60 h to 96 h, which showed a significant difference in the expression of NR4A1 before and after intramuscular preadipocyte differentiation, indicating that NR4A1 may promote the differentiation of intramuscular preadipocytes in the early stage. Fumoto et al. pointed out that NR4A1 was induced and expressed in the early stage of 3T3-L1 differentiation [3], but Veum et al. proposed that NR4A1 was down-regulated during the differentiation of primary human preadipocytes [15]. This difference may be caused by species specificity and different sampling sites; therefore, the role of NR4A1 in goat preadipocyte differentiation remains to be explored.
Adipocyte differentiation is a key step in the process of adipogenesis, and the process through which preadipocytes differentiate into mature adipocytes plays a decisive role for adipogenesis. The differentiation of preadipocytes is a complex biological process which is accompanied by changes of cell morphology and gene expression [16,17], and is regulated by multiple factors and pathways. During the differentiation, the cascade of transcription factors is activated to regulate the expression of adipocyte-development-related genes. PPARγ and C/EBPs are essential transcription factors in adipocyte differentiation [18,19,20], which can activate the expression of differentiation-related genes and promote the lipid accumulation in adipocytes [21,22,23]. Acetyl-CoA carboxylase (ACC) regulates fat synthesis through the adenylate-activated protein kinase (AMPK) pathway [24]. Transcription factors such as SREBP1 and Pref-1 also play an important role in adipocyte differentiation and can be used as marker genes for adipocyte differentiation [25,26]. Lipoprotein lipase (LPL) is a rate-limiting enzyme for the hydrolysis of triglycerides, and its expression level increases gradually during adipocyte differentiation, thus promoting adipocyte differentiation and fat storage [27]. DGAT1 and DGAT2 can catalyze the synthesis of triglycerides, covering almost all triglycerides [28]. Therefore, the expression changes of these marker genes are usually used for indicating adipose precursors’ differentiation. The intracellular lipid accumulation was increased after overexpression of NR4A1 and was decreased after NR4A1 knockdown, which suggested that NR4A1 can promote the differentiation process and the lipid accumulation of adipocytes in goat intramuscular preadipocytes. In order to further determine the effect of NR4A1 on intramuscular preadipocyte differentiation, the changes in the adopigenesis-related marker genes were detected by qPCR. The results showed that overexpression of goat NR4A1 significantly enhanced the expression of AP2, SREBP1, ACC, GPAM, and DGAT2, indicating that NR4A1 may promote the accumulation of intracellular lipid droplets by up-regulating the expression of ACC and DGAT2, and promote the differentiation of goat intramuscular adipose precursors by up-regulating the expression of AP2, SREBP1, and GPAM. Accordingly, NR4A1 knockdown down-regulated the expression of LPL, C/EBPα, C/EBPβ, ACC, and DGAT2, thus inhibiting the lipid accumulation of intramuscular adipocytes and the differentiation of goat intramuscular adipocytes. In summary, goat NR4A1 promoted the differentiation of intramuscular preadipocytes by up-regulating the expression of AP2, SREBP1, ACC, GPAM, and DGAT2.
The transcriptome sequencing data of overexpressed goat NR4A1 were analyzed to reveal the underlying mechanisms, and the KEGG enrichment analysis showed that 690 differentially expressed genes were significantly enriched in 86 pathways, including the PI3K-Akt signaling pathway, calcium signaling pathway, Apelin signaling pathway, oxytocin pathway, etc., as well as those related to adipogenic differentiation, such as the AMP signaling pathway [29], IL-17 signaling pathway [30], Wnt signaling pathway [31], Hippo signaling pathway [32], p53 signaling pathway [33], PPAR signaling pathway [34], etc., of which, the PI3K-Akt signaling pathway, cAMP signaling pathway, PPAR signaling pathway, AMPK signaling pathway, Wnt signaling pathway, and other signaling pathways related to adipocyte differentiation and lipid metabolism were selected for further analysis. It was found that there were different degrees of differentially expressed gene enrichment in these pathways; the largest number of genes were enriched in the PI3K-Akt signaling pathway, followed by those enriched in the cAMP signaling pathway, suggesting these signaling pathways interact and regulate each other [35,36]. Studies have shown that the PI3K/Akt signaling pathway can not only increase lipid accumulation [37], but also promote cell adipogenic differentiation [38]. Choe et al. pointed out that water-extracted plum attenuates fat formation in mouse 3T3-L1 adipocytes through the PI3K/Akt signaling pathway [39]. Ohashi et al. [40] found that N1 adenosine oxide has an anti-inflammatory effect through the PI3K/Akt/GSK-3β signaling pathway and promotes osteoblast and adipocyte differentiation. Wang et al. [41] found that phytosterols increase the number of adipocytes and glucose tolerance in mice fed with a high-fat and high-fructose diet by activating the PI3K/Akt signaling pathway. Zhong et al. [42] found that adipose tissue deficient in connective protein LNK has an activated response to IRS1/PI3K/Akt/AS160 signal transduction, while administration of PI3K inhibitors impairs glucose uptake. Based on the transcriptome sequencing results of this study and other studies, we speculate that goat NR4A1 may regulate adipogenic differentiation of intramuscular preadipocytes directly or indirectly through the PI3K-Akt signaling pathway. In order to verify the role of the PI3K-Akt signaling pathway in the promotion of goat intramuscular preadipocytes by NR4A1, LY249002, an inhibitor of the PI3K-Akt signaling pathway, was added after overexpressing NR4A1 in goat intramuscular preadipocytes. The results of oil red O staining showed that the number of lipid droplets in the cells treated with LY249002 decreased significantly, indicating that LY249002 hindered the promoting effect of NR4A1 overexpression on the differentiation of goat intramuscular preadipocytes. At the same time, compared with the control group, the relative expression levels of C/EBPα, AP2, SREBP1, C/EBPβ, ACC, GPAM, DGAT1, DGAT2, and ATGL decreased significantly when LY249002 was added after overexpression of NR4A1, suggesting that LY249002 inhibited the differentiation of goat intramuscular preadipocytes by blocking the overexpression of NR4A1. Taken together, it is suggested that overexpression of NR4A1 may promote the differentiation of goat intramuscular preadipocytes through up-regulating the PI3K-Akt signaling pathway.

5. Conclusions

In conclusion, our study confirmed that goat NR4A1 serves as a transcription factor to facilitate the differentiation of intramuscular preadipocytes in goats. NR4A1 overexpression leads to the up-regulation of the expression of AP2, SREBP1, ACC, GPAM, and DGAT genes, and may, through the PI3K-Akt signaling pathway, assist the adipogenic differentiation. The findings of this study not only identified the potential of NR4A1 as a novel target for goat meat quality improvement and goat molecular breeding, but also provided basic data revealing the molecular mechanisms of the role of NR4A1 in the IMF deposition regulatory network.

Author Contributions

Conceptualization, Y.L. (Yaqiu Lin); Data curation, Y.L. (Yanyan Li) and J.Z. (Jiangjiang Zhu); Funding acquisition, J.X. and Y.L. (Yaqiu Lin); Investigation, J.Z. (Jianying Zheng) and S.C.; Methodology, J.W.; Resources, Y.L. (Yaqiu Lin); Writing—original draft, J.X.; Writing—review and editing, Y.W. and Y.L. (Yaqiu Lin). All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the National Natural Sciences Foundation of China (grant number 32072723), the Sichuan Science and Technology Program (2022JDTD0030), and the Southwest Minzu University Research Startup Funds (grant number RQD2023036).

Institutional Review Board Statement

The experimental protocols were approved by the Laboratory Animal Ethics Committee of Southwest Minzu University. The experimental animal certification number was 2020086, 2020.

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Conflicts of Interest

Authors declare no conflicts of interest for this article.

References

  1. Pearen, M.A.; Muscat, G.E. Orphan nuclear receptors and the regulation of nutrient metabolism: Understanding obesity. Physiology 2012, 27, 156–166. [Google Scholar] [CrossRef] [PubMed]
  2. Safe, S.; Jin, U.H.; Morpurgo, B.; Abudayyeh, A.; Singh, M.; Tjalkens, R.B. Nuclear receptor 4A (NR4A) family–orphans no more. J. Steroid Biochem. Mol. Biol. 2016, 157, 48–60. [Google Scholar] [CrossRef] [PubMed]
  3. Burris, T.P.; Busby, S.A.; Griffin, P.R. Targeting orphan nuclear receptors for treatment of metabolic diseases and autoimmunity. Chem. Biol. 2012, 19, 51–59. [Google Scholar] [CrossRef] [PubMed]
  4. Zhang, Z.; Yu, J. NR4A1 Promotes Cerebral Ischemia Reperfusion Injury by Repressing Mfn2-Mediated Mitophagy and Inactivating the MAPK-ERK-CREB Signaling Pathway. Neurochem. Res. 2018, 43, 1963–1977. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, Y.; Federation, A.J.; Kim, S.; O’Keefe, J.P.; Lun, M.; Xiang, D.; Brown, J.D.; Steinhauser, M.L. Targeting nuclear receptor NR4A1-dependent adipocyte progenitor quiescence promotes metabolic adaptation to obesity. J. Clin. Investig. 2018, 128, 4898–4911. [Google Scholar] [CrossRef] [PubMed]
  6. Chao, L.C.; Wroblewski, K.; Zhang, Z.; Pei, L.; Vergnes, L.; Ilkayeva, O.R.; Ding, S.Y.; Reue, K.; Watt, M.J.; Newgard, C.B.; et al. Insulin resistance and altered systemic glucose metabolism in mice lacking Nur77. Diabetes 2009, 58, 2788–2796. [Google Scholar] [CrossRef] [PubMed]
  7. Chao, L.C.; Bensinger, S.J.; Villanueva, C.J.; Wroblewski, K.; Tontonoz, P. Inhibition of adipocyte differentiation by Nur77, Nurr1, and Nor1. Mol. Endocrinol. 2008, 22, 2596–2608. [Google Scholar] [CrossRef] [PubMed]
  8. Ming, Y.; Yin, Y.; Sun, Z. Interaction of Nuclear Receptor Subfamily 4 Group A Member 1 (Nr4a1) and Liver Linase B1 (LKB1) Mitigates Type 2 Diabetes Mellitus by Activating Monophosphate-Activated Protein Kinase (AMPK)/Sirtuin 1 (SIRT1) Axis and Inhibiting Nuclear Factor-kappa B (NF-kappaB) Activation. Med. Sci. Monit. 2020, 26, e920278. [Google Scholar] [CrossRef]
  9. Jung, Y.S.; Lee, H.S.; Cho, H.R.; Kim, K.J.; Kim, J.H.; Safe, S.; Lee, S.O. Dual targeting of Nur77 and AMPKalpha by isoalantolactone inhibits adipogenesis in vitro and decreases body fat mass in vivo. Int. J. Obes. 2019, 43, 952–962. [Google Scholar] [CrossRef]
  10. Shan, T.; Xiong, Y.; Zhang, P.; Li, Z.; Jiang, Q.; Bi, P.; Yue, F.; Yang, G.; Wang, Y.; Liu, X.; et al. Lkb1 controls brown adipose tissue growth and thermogenesis by regulating the intracellular localization of CRTC3. Nat. Commun. 2016, 7, 12205. [Google Scholar] [CrossRef]
  11. Chen, D.; Lin, Y.; Zhao, N.; Wang, Y.; Li, Y. Hoxa5 Inhibits the Proliferation and Induces Adipogenic Differentiation of Subcutaneous Preadipocytes in Goats. Animals 2022, 12, 1859. [Google Scholar] [CrossRef] [PubMed]
  12. Trapnell, C.; Hendrickson, D.G.; Sauvageau, M.; Goff, L.; Rinn, J.L.; Pachter, L. Differential analysis of gene regulation at transcript resolution with RNA-seq. Nat. Biotechnol. 2013, 31, 46–53. [Google Scholar] [CrossRef] [PubMed]
  13. Kanehisa, M.; Araki, M.; Goto, S.; Hattori, M.; Hirakawa, M.; Itoh, M.; Katayama, T.; Kawashima, S.; Okuda, S.; Tokimatsu, T.; et al. KEGG for linking genomes to life and the environment. Nucleic Acids Res. 2008, 36, D480–D484. [Google Scholar] [CrossRef]
  14. Mao, X.; Cai, T.; Olyarchuk, J.G.; Wei, L. Automated genome annotation and pathway identification using the KEGG Orthology (KO) as a controlled vocabulary. Bioinformatics 2005, 21, 3787–3793. [Google Scholar] [CrossRef]
  15. Veum, V.L.; Dankel, S.N.; Gjerde, J.; Nielsen, H.J.; Solsvik, M.H.; Haugen, C.; Christensen, B.J.; Hoang, T.; Fadnes, D.J.; Busch, C.; et al. The nuclear receptors NUR77, NURR1 and NOR1 in obesity and during fat loss. Int. J. Obes. 2012, 36, 1195–1202. [Google Scholar] [CrossRef]
  16. Rosen, E.D.; Spiegelman, B.M. Molecular regulation of adipogenesis. Annu. Rev. Cell Dev. Biol. 2000, 16, 145–171. [Google Scholar] [CrossRef]
  17. Rosen, E.D.; MacDougald, O.A. Adipocyte differentiation from the inside out. Nat. Rev. Mol. Cell Biol. 2006, 7, 885–896. [Google Scholar] [CrossRef]
  18. Satoh, A.; Stein, L.; Imai, S. The role of mammalian sirtuins in the regulation of metabolism, aging, and longevity. Handb. Exp. Pharmacol. 2011, 206, 125–162. [Google Scholar] [CrossRef]
  19. Tang, Q.Q.; Otto, T.C.; Lane, M.D. CCAAT/enhancer-binding protein beta is required for mitotic clonal expansion during adipogenesis. Proc. Natl. Acad. Sci. USA 2003, 100, 850–855. [Google Scholar] [CrossRef] [PubMed]
  20. Tontonoz, P.; Hu, E.; Spiegelman, B.M. Stimulation of adipogenesis in fibroblasts by PPAR gamma 2, a lipid-activated transcription factor. Cell 1994, 79, 1147–1156. [Google Scholar] [CrossRef]
  21. Liu, Y.; Wang, J.; Luo, S.; Zhan, Y.; Lu, Q. The roles of PPARgamma and its agonists in autoimmune diseases: A comprehensive review. J. Autoimmun. 2020, 113, 102510. [Google Scholar] [CrossRef] [PubMed]
  22. Ohlsson, E.; Hasemann, M.S.; Willer, A.; Lauridsen, F.K.; Rapin, N.; Jendholm, J.; Porse, B.T. Initiation of MLL-rearranged AML is dependent on C/EBPalpha. J. Exp. Med. 2014, 211, 5–13. [Google Scholar] [CrossRef] [PubMed]
  23. Wang, H.; Zan, L.S.; Wang, H.B.; Gong, C.; Fu, C.Z. Cloning, expression analysis and sequence prediction of the CCAAT/enhancer-binding protein alpha gene of Qinchuan cattle. Genet. Mol. Res. 2012, 11, 1651–1661. [Google Scholar] [CrossRef] [PubMed]
  24. Yuan, E.; Duan, X.; Xiang, L.; Ren, J.; Lai, X.; Li, Q.; Sun, L.; Sun, S. Aged Oolong Tea Reduces High-Fat Diet-Induced Fat Accumulation and Dyslipidemia by Regulating the AMPK/ACC Signaling Pathway. Nutrients 2018, 10, 187. [Google Scholar] [CrossRef] [PubMed]
  25. Jeon, T.I.; Osborne, T.F. SREBPs: Metabolic integrators in physiology and metabolism. Trends Endocrinol. Metab. 2012, 23, 65–72. [Google Scholar] [CrossRef]
  26. Wang, Y.; Kim, K.A.; Kim, J.H.; Sul, H.S. Pref-1, a preadipocyte secreted factor that inhibits adipogenesis. J. Nutr. 2006, 136, 2953–2956. [Google Scholar] [CrossRef] [PubMed]
  27. Mead, J.R.; Irvine, S.A.; Ramji, D.P. Lipoprotein lipase: Structure, function, regulation, and role in disease. J. Mol. Med. 2002, 80, 753–769. [Google Scholar] [CrossRef]
  28. Chitraju, C.; Walther, T.C.; Farese, R.V., Jr. The triglyceride synthesis enzymes DGAT1 and DGAT2 have distinct and overlapping functions in adipocytes. J. Lipid Res. 2019, 60, 1112–1120. [Google Scholar] [CrossRef]
  29. Shimizu, Y.; Satoh, S.; Yano, H.; Minokoshi, Y.; Cushman, S.W.; Shimazu, T. Effects of noradrenaline on the cell-surface glucose transporters in cultured brown adipocytes: Novel mechanism for selective activation of GLUT1 glucose transporters. Biochem. J. 1998, 330 Pt 1, 397–403. [Google Scholar] [CrossRef]
  30. Hu, B.; Jin, C.; Zeng, X.; Resch, J.M.; Jedrychowski, M.P.; Yang, Z.; Desai, B.N.; Banks, A.S.; Lowell, B.B.; Mathis, D.; et al. gammadelta T cells and adipocyte IL-17RC control fat innervation and thermogenesis. Nature 2020, 578, 610–614. [Google Scholar] [CrossRef]
  31. Smith, U.; Kahn, B.B. Adipose tissue regulates insulin sensitivity: Role of adipogenesis, de novo lipogenesis and novel lipids. J. Intern. Med. 2016, 280, 465–475. [Google Scholar] [CrossRef] [PubMed]
  32. Ardestani, A.; Maedler, K. Loss of TAZ Boosts PPARgamma to Cope with Insulin Resistance. Cell Metab. 2020, 31, 6–8. [Google Scholar] [CrossRef] [PubMed]
  33. Wang, H.; Wan, X.; Pilch, P.F.; Ellisen, L.W.; Fried, S.K.; Liu, L. An AMPK-dependent, non-canonical p53 pathway plays a key role in adipocyte metabolic reprogramming. Elife 2020, 9, e63665. [Google Scholar] [CrossRef] [PubMed]
  34. Yang, W.; Yuan, W.; Peng, X.; Wang, M.; Xiao, J.; Wu, C.; Luo, L. PPAR gamma/Nnat/NF-kappaB Axis Involved in Promoting Effects of Adiponectin on Preadipocyte Differentiation. Mediat. Inflamm. 2019, 2019, 5618023. [Google Scholar] [CrossRef] [PubMed]
  35. Bluthgen, N.; Legewie, S. Systems analysis of MAPK signal transduction. Essays Biochem. 2008, 45, 95–107. [Google Scholar] [CrossRef] [PubMed]
  36. Gan, W.; Dai, X.; Dai, X.; Xie, J.; Yin, S.; Zhu, J.; Wang, C.; Liu, Y.; Guo, J.; Wang, M.; et al. LATS suppresses mTORC1 activity to directly coordinate Hippo and mTORC1 pathways in growth control. Nat. Cell Biol. 2020, 22, 246–256. [Google Scholar] [CrossRef] [PubMed]
  37. Xiao, J.; Bai, X.Q.; Liao, L.; Zhou, M.; Peng, J.; Xiang, Q.; Ren, Z.; Wen, H.Y.; Jiang, Z.S.; Tang, Z.H.; et al. Hydrogen sulfide inhibits PCSK9 expression through the PI3K/Akt-SREBP-2 signaling pathway to influence lipid metabolism in HepG2 cells. Int. J. Mol. Med. 2019, 43, 2055–2063. [Google Scholar] [CrossRef] [PubMed]
  38. Song, B.Q.; Chi, Y.; Li, X.; Du, W.J.; Han, Z.B.; Tian, J.J.; Li, J.J.; Chen, F.; Wu, H.H.; Han, L.X.; et al. Inhibition of Notch Signaling Promotes the Adipogenic Differentiation of Mesenchymal Stem Cells Through Autophagy Activation and PTEN-PI3K/AKT/mTOR Pathway. Cell Physiol. Biochem. 2015, 36, 1991–2002. [Google Scholar] [CrossRef] [PubMed]
  39. Choe, W.K.; Kang, B.T.; Kim, S.O. Water-extracted plum (Prunus salicina L. cv. Soldam) attenuates adipogenesis in murine 3T3-L1 adipocyte cells through the PI3K/Akt signaling pathway. Exp. Ther. Med. 2018, 15, 1608–1615. [Google Scholar] [CrossRef]
  40. Ohashi, E.; Kohno, K.; Arai, N.; Harashima, A.; Ariyasu, T.; Ushio, S. Adenosine N1-Oxide Exerts Anti-inflammatory Effects through the PI3K/Akt/GSK-3beta Signaling Pathway and Promotes Osteogenic and Adipocyte Differentiation. Biol. Pharm. Bull. 2019, 42, 968–976. [Google Scholar] [CrossRef]
  41. Wang, J.; Hu, X.; Ai, W.; Zhang, F.; Yang, K.; Wang, L.; Zhu, X.; Gao, P.; Shu, G.; Jiang, Q.; et al. Phytol increases adipocyte number and glucose tolerance through activation of PI3K/Akt signaling pathway in mice fed high-fat and high-fructose diet. Biochem. Biophys. Res. Commun. 2017, 489, 432–438. [Google Scholar] [CrossRef] [PubMed]
  42. Zhong, X.; Ke, C.; Cai, Z.; Wu, H.; Ye, Y.; Liang, X.; Yu, L.; Jiang, S.; Shen, J.; Wang, L.; et al. LNK deficiency decreases obesity-induced insulin resistance by regulating GLUT4 through the PI3K-Akt-AS160 pathway in adipose tissue. Aging 2020, 12, 17150–17166. [Google Scholar] [CrossRef] [PubMed]
Animals 14 02051 g001
Figure 1. Relative expression level of NR4A1 during intramuscular adipocyte differentiation. The expression level of NR4A1 mRNA was detected by qPCR, and the UXT gene was used as the reference gene. Data are expressed as “Means ± SD”, n = 6, * p < 0.05.
Figure 1. Relative expression level of NR4A1 during intramuscular adipocyte differentiation. The expression level of NR4A1 mRNA was detected by qPCR, and the UXT gene was used as the reference gene. Data are expressed as “Means ± SD”, n = 6, * p < 0.05.
Animals 14 02051 g001
Animals 14 02051 g002
Figure 2. Overexpression of NR4A1 promotes the differentiation of intramuscular adipocytes in goats. (A) NR4A1 overexpression efficiency detection. (B) The result of oil red O staining images of 2-day induced differentiation between NC and NR4A1 overexpression groups. (C) The result of OD value at 490 nm. (D) The relative expression levels of goat intramuscular adipocyte differentiation marker genes and lipid-metabolism-related genes after overexpression of NR4A1. Data are expressed as “Means ± SD”, n = 3. ** p < 0.01, * p < 0.05.
Figure 2. Overexpression of NR4A1 promotes the differentiation of intramuscular adipocytes in goats. (A) NR4A1 overexpression efficiency detection. (B) The result of oil red O staining images of 2-day induced differentiation between NC and NR4A1 overexpression groups. (C) The result of OD value at 490 nm. (D) The relative expression levels of goat intramuscular adipocyte differentiation marker genes and lipid-metabolism-related genes after overexpression of NR4A1. Data are expressed as “Means ± SD”, n = 3. ** p < 0.01, * p < 0.05.
Animals 14 02051 g002
Animals 14 02051 g003
Figure 3. Knockdown of NR4A1 expression blocks the differentiation of intramuscular adipocytes in goats. (A) The knockdown efficiency of NR4A1. (B) The result of oil red O staining images of 2-day induced differentiation between NC and NR4A1 overexpression groups. (C) The result of OD value at 490 nm. (D) The relative expression levels of goat intramuscular adipocyte differentiation marker genes and lipid-metabolism-related genes after knockdown of NR4A1. Data are expressed as “Means ± SD”, n = 3. ** p < 0.01, * p < 0.05.
Figure 3. Knockdown of NR4A1 expression blocks the differentiation of intramuscular adipocytes in goats. (A) The knockdown efficiency of NR4A1. (B) The result of oil red O staining images of 2-day induced differentiation between NC and NR4A1 overexpression groups. (C) The result of OD value at 490 nm. (D) The relative expression levels of goat intramuscular adipocyte differentiation marker genes and lipid-metabolism-related genes after knockdown of NR4A1. Data are expressed as “Means ± SD”, n = 3. ** p < 0.01, * p < 0.05.
Animals 14 02051 g003
Animals 14 02051 g004
Figure 4. KEGG enrichment analysis of differentially expressed mRNAs.
Figure 4. KEGG enrichment analysis of differentially expressed mRNAs.
Animals 14 02051 g004
Animals 14 02051 g005
Figure 5. Differentially expressed mRNAs were enriched into adipocyte differentiation and lipid metabolism pathways.
Figure 5. Differentially expressed mRNAs were enriched into adipocyte differentiation and lipid metabolism pathways.
Animals 14 02051 g005
Animals 14 02051 g006
Figure 6. Verification of differentially expressed mRNAs.
Figure 6. Verification of differentially expressed mRNAs.
Animals 14 02051 g006
Animals 14 02051 g007
Figure 7. LY249002 blocks NR4A1 overexpression and promotes the differentiation of intramuscular preadipocytes in goats. (A) The resulting oil red O staining images of 2-day induced differentiation among NC, NR4A1 overexpression, and NR4A1 overexpression with LY294002 added groups. (B) The result of OD value at 490 nm. (C) Overexpression of NR4A1 followed by addition of LY249002 to the relative expression levels of goat intramuscular adipocyte differentiation marker genes and lipid-metabolism-related genes. Data are expressed as “Means ± SD”, n = 3. ** p < 0.01, * p < 0.05.
Figure 7. LY249002 blocks NR4A1 overexpression and promotes the differentiation of intramuscular preadipocytes in goats. (A) The resulting oil red O staining images of 2-day induced differentiation among NC, NR4A1 overexpression, and NR4A1 overexpression with LY294002 added groups. (B) The result of OD value at 490 nm. (C) Overexpression of NR4A1 followed by addition of LY249002 to the relative expression levels of goat intramuscular adipocyte differentiation marker genes and lipid-metabolism-related genes. Data are expressed as “Means ± SD”, n = 3. ** p < 0.01, * p < 0.05.
Animals 14 02051 g007
Table 1. The sequences information of qPCR primers used in this study.
Table 1. The sequences information of qPCR primers used in this study.
GenePrimer Sequence (5′~3′)Tm/°CProduct Length/bpGenBank Accession Number
LPLS: TCCTGGAGTGACGGAATCTGT60174NM_001285607.1
A: GACAGCCAGTCCACCACGAT
C/EBPαS: CCGTGGACAAGAACAGCAAC58142XM_018062278.1
A: AGGCGGTCATTGTCACTGGT
PPARγS: AAGCGTCAGGGTTCCACTATG60197NM_001285658.1
A: GAACCTGATGGCGTTATGAGAC
SREBP1S: AAGTGGTGGGCCTCTCTGA58127NM_001285755.1
A: GCAGGGGTTTCTCGGACT
Pref-1S: CCGGCTTCATGGATAAGACCT65178KP686197.1
A: GCCTCGCACTTGTTGAGGAA
C/EBPβS: CAAGAAGACGGTGGACAAGC65204XM_018058020.1
A: AACAAGTTCCGCAGGGTG
AP2S: TGAAGTCACTCCAGATGACAGG58143NM_001285623.1
A: TGACACATTCCAGCACCAGC
ACCS: GGAGACAAACAGGGACCATT60146XM_018064169.1
A: ATCAGGGACTGCCGAAAC
FASNS: TGTGCAACTGTGCCCTAG57111NM_001285629.1
A: GTCCTCTGAGCAGCGTGT
ATGLS: GGTGCCAATATCATCGAGGT64133NM_001285739.1
A: CACACCCGTGGCAGTCAG
HSLS: AGGGTCATTGCCGACTTCC60161XM_018062484.1
A: GTCTCGTTGCGTTTGTAGTGC
GPAMS: GCAGGTTTATCCAGTATGGCATT6063XM_013975269.2
A: GGACTGATATCTTCCTGATCATCTTG
DGAT1S: CCACTGGGACCTGAGGTGTC60111MT221183.1
A: GCATCACCACACACCAATTCA
DGAT2S: CAATAGGTCCAAGGTAGAGAAGC60156NM_001313305.1
A: ACCAGCCAGGTGAAGTAGAGC
UXTS: GCAAGTGGATTTGGGCTGTAAC60180XM_005700842.2
A: ATGGAGTCCTTGGTGAGGTTGT
S. sense primer; A. antisense primer.
Table 2. Primer sequence information used for RNA-seq verification.
Table 2. Primer sequence information used for RNA-seq verification.
GenePrimers Sequence (5′-3′)TM/°CGenBank Accession Number
RXRGS: TCCTCAGGAAAGCACTACGGT60XM_005677098.3
A: GGCAGTATTGACAGCGGTTG
FN3KS: CGGGAAATGTGGCAGAGGAT61XM_018065388.1
A: TGGTGGTAGGCGGTGAAGAA
ANKRD29S: GACTCTGCTCCGCCTGCTAC59XM_018039771.1
A: GAGATTGATGTCCGCTCCCT
ACSL1S: GCCATCACCTACATCATCAACAA60XM_005698718.3
A: ACACTTCTTGCCTCGTTCCA
SLC3A1S: CACGGTCACTCACTACTCGCA56XM_005686551.3
A: CTGTATCGCCCTGGCTCCCT
CMKLR1S: ACTACCCCGACGACTTGGAC62XM_005691599.3
A: TCCCGAGGAGGCAGATAATG
KLF2S: GCGGCAAGACCTACACCAA60KU041748.1
A: TGTGCTTGCGGTAGTGGC
CD36S: AAAGAACTATTGTGGGGCTA60JF690773.1
A: TATGTGTCAATTATGGCGACT
S. sense primer; A. antisense primer.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Xing, J.; Zheng, J.; Cui, S.; Wang, J.; Wang, Y.; Li, Y.; Zhu, J.; Lin, Y. Nuclear Receptor Subfamily 4 Group A Member 1 (NR4A1) Promotes the Adipogenesis of Intramuscular Preadipocytes through PI3K/AKT Pathway in Goats. Animals 2024, 14, 2051. https://doi.org/10.3390/ani14142051

AMA Style

Xing J, Zheng J, Cui S, Wang J, Wang Y, Li Y, Zhu J, Lin Y. Nuclear Receptor Subfamily 4 Group A Member 1 (NR4A1) Promotes the Adipogenesis of Intramuscular Preadipocytes through PI3K/AKT Pathway in Goats. Animals. 2024; 14(14):2051. https://doi.org/10.3390/ani14142051

Chicago/Turabian Style

Xing, Jiani, Jianying Zheng, Sheng Cui, Jinling Wang, Yong Wang, Yanyan Li, Jiangjiang Zhu, and Yaqiu Lin. 2024. "Nuclear Receptor Subfamily 4 Group A Member 1 (NR4A1) Promotes the Adipogenesis of Intramuscular Preadipocytes through PI3K/AKT Pathway in Goats" Animals 14, no. 14: 2051. https://doi.org/10.3390/ani14142051

APA Style

Xing, J., Zheng, J., Cui, S., Wang, J., Wang, Y., Li, Y., Zhu, J., & Lin, Y. (2024). Nuclear Receptor Subfamily 4 Group A Member 1 (NR4A1) Promotes the Adipogenesis of Intramuscular Preadipocytes through PI3K/AKT Pathway in Goats. Animals, 14(14), 2051. https://doi.org/10.3390/ani14142051

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop