Follicular Atresia in Buffalo: Cocaine- and Amphetamine-Regulated Transcript (CART) and the Underlying Mechanisms
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Experimental Design
2.2. Materials, Supplies, and Chemicals
2.3. Classification of Follicles as Healthy or Atretic and Sample Collection
2.4. Assessment of Estradiol and Progesterone Levels in Follicles
2.5. RNA Isolation and Complementary DNA (cDNA) Synthesis
2.6. Cloning and Homology Assessment of Buffalo CART Partial cDNA
2.7. Relative Quantification of Gene Expression
2.8. GC Collection, Culture, and Treatment
2.9. Cell Apoptosis Assay
2.10. Immunofluorescence Analysis of AKT and β-Catenin Proteins
2.11. Western Blot Analysis of the Tested Proteins
2.12. Statistical Analyses
3. Results
3.1. Analysis of CART Nucleotide Sequence Homology between Buffalo and Other Species
3.2. Expression Patterns of CART and Related Genes in Relation to Follicle Health Status
3.3. Effects of Different Doses of CART and/or FSH on Estradiol Production in Cultured Buffalo GCs In Vitro
3.4. Effect of CART on Estradiol Production in the Presence or Absence of FSH
3.5. Treatment with CART Increases Apoptosis in Buffalo GCs
3.6. GC Treatment with CART Alters the Expression Patterns of Genes Involved in Cell Survival, GC Steroidogenesis, and Apoptosis
3.7. Differential Modulation of the AKT/GSK3β/β-Catenin Signaling Pathway by CART in the Presence or Absence of FSH
3.8. CART Regulation of the FSH-Stimulated AKT/GSK3β/β-Catenin Signaling Pathway in Buffalo GCs at the Protein Level
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Bjersing, L. Maturation, morphology, and endocrine function of the ovarian follicle. Adv. Exp. Med. Biol. 1982, 147, 1–14. [Google Scholar]
- Morita, Y.; Tilly, J.L. Oocyte apoptosis: Like sand through an hourglass. Dev. Biol. 1999, 213, 1–17. [Google Scholar] [CrossRef] [PubMed]
- Bao, B.; Garverick, H.A. Expression of steroidogenic enzyme and gonadotropin receptor genes in bovine follicles during ovarian follicular waves: A review. J. Anim. Sci. 1998, 76, 1903–1921. [Google Scholar] [CrossRef]
- Beg, M.A.; Ginther, O.J. Follicle selection in cattle and horses: Role of intrafollicular factors. Reproduction 2006, 132, 365–377. [Google Scholar] [CrossRef]
- Adams, G.; Pierson, R. Bovine model for study of ovarian follicular dynamics in humans. Theriogenology 1995, 43, 113–120. [Google Scholar] [CrossRef]
- Hsueh, A.J.; Billig, H.; Tsafriri, A. Ovarian follicle atresia: A hormonally controlled apoptotic process. Endocr. Rev. 1994, 15, 707–724. [Google Scholar] [PubMed]
- Hughes, F.M., Jr.; Gorospe, W.C. Biochemical identification of apoptosis (programmed cell death) in granulosa cells: Evidence for a potential mechanism underlying follicular atresia. Endocrinology 1991, 129, 2415–2422. [Google Scholar] [CrossRef] [PubMed]
- Palumbo, A.; Yeh, J. In situ localization of apoptosis in the rat ovary during follicular atresia. Biol. Reprod. 1994, 51, 888–895. [Google Scholar] [CrossRef] [PubMed]
- Tilly, J.L.; Hsueh, A.J. Microscale autoradiographic method for the qualitative and quantitative analysis of apoptotic DNA fragmentation. J. Cell. Physiol. 1993, 154, 519–526. [Google Scholar] [CrossRef]
- Yuan, S.; Wen, J.; Cheng, J.; Shen, W.; Zhou, S.; Yan, W.; Shen, L.; Luo, A.; Wang, S. Age-associated up-regulation of EGR1 promotes granulosa cell apoptosis during follicle atresia in mice through the NF-kappaB pathway. Cell Cycle 2016, 15, 2895–2905. [Google Scholar] [CrossRef]
- Manikkam, M.; Rajamahendran, R. Progesterone-induced atresia of the proestrous dominant follicle in the bovine ovary: Changes in diameter, insulin-like growth factor system, aromatase activity, steroid hormones, and apoptotic index. Biol. Reprod. 1997, 57, 580–587. [Google Scholar] [CrossRef]
- Yang, M.Y.; Rajamahendran, R. Involvement of apoptosis in the atresia of nonovulatory dominant follicle during the bovine estrous cycle. Biol. Reprod. 2000, 63, 1313–1321. [Google Scholar] [CrossRef]
- Zhao, S.; Saito, H.; Wang, X.; Saito, T.; Kaneko, T.; Hiroi, M. Effects of gonadotropin-releasing hormone agonist on the incidence of apoptosis in porcine and human granulosa cells. Gynecol. Obstet. Investig. 2000, 49, 52–56. [Google Scholar] [CrossRef] [PubMed]
- Tilly, J.L.; Kowalski, K.I.; Johnson, A.L.; Hsueh, A.J. Involvement of apoptosis in ovarian follicular atresia and postovulatory regression. Endocrinology 1991, 129, 2799–2801. [Google Scholar] [CrossRef] [PubMed]
- Woods, D.C.; Johnson, A.L. Regulation of follicle-stimulating hormone-receptor messenger RNA in hen granulosa cells relative to follicle selection. Biol. Reprod. 2005, 72, 643–650. [Google Scholar] [CrossRef] [PubMed]
- Yuan, W.; Giudice, L.C. Programmed cell death in human ovary is a function of follicle and corpus luteum status. J. Clin. Endocrinol. Metab. 1997, 82, 3148–3155. [Google Scholar]
- Barnett, K.R.; Schilling, C.; Greenfeld, C.R.; Tomic, D.; Flaws, J.A. Ovarian follicle development and transgenic mouse models. Hum. Reprod. Update 2006, 12, 537–555. [Google Scholar] [CrossRef]
- Matsuda, F.; Inoue, N.; Manabe, N.; Ohkura, S. Follicular growth and atresia in mammalian ovaries: Regulation by survival and death of granulosa cells. J. Reprod. Dev. 2012, 58, 44–50. [Google Scholar] [CrossRef]
- Sanders, E.J.; Wride, M.A. Programmed cell death in development. Int. Rev. Cytol. 1995, 163, 105–173. [Google Scholar]
- Peter, A.T.; Dhanasekaran, N. Apoptosis of granulosa cells: A review on the role of MAPK-signalling modules. Reprod. Domest. Anim. 2003, 38, 209–213. [Google Scholar] [CrossRef]
- Shen, M.; Liu, Z.; Li, B.; Teng, Y.; Zhang, J.; Tang, Y.; Sun, S.C.; Liu, H. Involvement of FoxO1 in the effects of follicle-stimulating hormone on inhibition of apoptosis in mouse granulosa cells. Cell Death Dis. 2014, 5, e1475. [Google Scholar] [CrossRef] [PubMed]
- Gilley, J.; Coffer, P.J.; Ham, J. FOXO transcription factors directly activate bim gene expression and promote apoptosis in sympathetic neurons. J. Cell Biol. 2003, 162, 613–622. [Google Scholar] [CrossRef] [PubMed]
- Reddy, P.; Shen, L.; Ren, C.; Boman, K.; Lundin, E.; Ottander, U.; Lindgren, P.; Liu, Y.X.; Sun, Q.Y.; Liu, K. Activation of Akt (PKB) and suppression of FKHRL1 in mouse and rat oocytes by stem cell factor during follicular activation and development. Dev. Biol. 2005, 281, 160–170. [Google Scholar] [CrossRef] [PubMed]
- Lin, F.; Fu, Y.H.; Han, J.; Shen, M.; Du, C.W.; Li, R.; Ma, X.S.; Liu, H.L. Changes in the expression of Fox O1 and death ligand genes during follicular atresia in porcine ovary. Genet. Mol. Res. 2014, 13, 6638–6645. [Google Scholar] [CrossRef]
- Regan, S.L.P.; Knight, P.G.; Yovich, J.L.; Leung, Y.; Arfuso, F.; Dharmarajan, A. Granulosa Cell Apoptosis in the Ovarian Follicle-A Changing View. Front. Endocrinol. 2018, 9, 61. [Google Scholar] [CrossRef]
- Rogge, G.; Jones, D.; Hubert, G.W.; Lin, Y.; Kuhar, M.J. CART peptides: Regulators of body weight, reward and other functions. Nat. Rev. Neurosci. 2008, 9, 747–758. [Google Scholar] [CrossRef]
- Vrang, N. Anatomy of hypothalamic CART neurons. Peptides 2006, 27, 1970–1980. [Google Scholar] [CrossRef]
- Smith, G.W.; Sen, A.; Folger, J.K.; Ireland, J.J. Putative role of cocaine- and amphetamine-regulated transcript (CARTPT) in dominant follicle selection in cattle. Soc. Reprod. Fertil. Suppl. 2010, 67, 105–117. [Google Scholar] [CrossRef]
- Lv, L.; Jimenez-Krassel, F.; Sen, A.; Bettegowda, A.; Mondal, M.; Folger, J.K.; Lee, K.B.; Ireland, J.J.; Smith, G.W. Evidence supporting a role for cocaine- and amphetamine-regulated transcript (CARTPT) in control of granulosa cell estradiol production associated with dominant follicle selection in cattle. Biol. Reprod. 2009, 81, 580–586. [Google Scholar] [CrossRef]
- Folger, J.K.; Jimenez-Krassel, F.; Ireland, J.J.; Lv, L.; Smith, G.W. Regulation of granulosa cell cocaine and amphetamine regulated transcript (CART) binding and effect of CART signaling inhibitor on granulosa cell estradiol production during dominant follicle selection in cattle. Biol. Reprod. 2013, 89, 137. [Google Scholar] [CrossRef]
- Sen, A.; Bettegowda, A.; Jimenez-Krassel, F.; Ireland, J.J.; Smith, G.W. Cocaine- and amphetamine-regulated transcript regulation of follicle-stimulating hormone signal transduction in bovine granulosa cells. Endocrinology 2007, 148, 4400–4410. [Google Scholar] [CrossRef] [PubMed]
- Sen, A.; Lv, L.; Bello, N.; Ireland, J.J.; Smith, G.W. Cocaine- and amphetamine-regulated transcript accelerates termination of follicle-stimulating hormone-induced extracellularly regulated kinase 1/2 and Akt activation by regulating the expression and degradation of specific mitogen-activated protein kinase phosphatases in bovine granulosa cells. Mol. Endocrinol. 2008, 22, 2655–2676. [Google Scholar] [PubMed]
- Huang, Y.; Yao, X.L.; Meng, J.Z.; Liu, Y.; Jiang, X.L.; Chen, J.W.; Li, P.F.; Ren, Y.S.; Liu, W.Z.; Yao, J.B.; et al. Intrafollicular expression and potential regulatory role of cocaine- and amphetamine-regulated transcript in the ovine ovary. Domest. Anim. Endocrinol. 2016, 54, 30–36. [Google Scholar] [CrossRef] [PubMed]
- Li, P.; Meng, J.; Jing, J.; Hao, Q.; Zhu, Z.; Yao, J.; Lyu, L. Study on the relationship between expression patterns of cocaine-and amphetamine regulated transcript and hormones secretion in porcine ovarian follicles. Biol. Res. 2018, 51, 6. [Google Scholar] [CrossRef] [PubMed]
- Santiago, L.; Daniels, G.; Wang, D.; Deng, F.M.; Lee, P. Wnt signaling pathway protein LEF1 in cancer, as a biomarker for prognosis and a target for treatment. Am. J. Cancer Res. 2017, 7, 1389–1406. [Google Scholar] [PubMed]
- Sunderland, S.J.; Crowe, M.A.; Boland, M.P.; Roche, J.F.; Ireland, J.J. Selection, dominance and atresia of follicles during the oestrous cycle of heifers. J. Reprod. Fertil. 1994, 101, 547–555. [Google Scholar] [CrossRef] [PubMed]
- Cheng, J.; Pan, Y.; Yang, S.; Wei, Y.; Lv, Q.; Xing, Q.; Zhang, R.; Sun, L.; Qin, G.; Shi, D.; et al. Integration of transcriptomics and non-targeted metabolomics reveals the underlying mechanism of follicular atresia in Chinese buffalo. J. Steroid Biochem. Mol. Biol. 2021, 212, 105944. [Google Scholar] [CrossRef] [PubMed]
- Sohel, M.M.H.; Konca, Y.; Akyuz, B.; Arslan, K.; Sariozkan, S.; Cinar, M.U. Concentration dependent antioxidative and apoptotic effects of sulforaphane on bovine granulosa cells in vitro. Theriogenology 2017, 97, 17–26. [Google Scholar] [CrossRef] [PubMed]
- Amin, A.; Gad, A.; Salilew-Wondim, D.; Prastowo, S.; Held, E.; Hoelker, M.; Rings, F.; Tholen, E.; Neuhoff, C.; Looft, C.; et al. Bovine embryo survival under oxidative-stress conditions is associated with activity of the NRF2-mediated oxidative-stress-response pathway. Mol. Reprod. Dev. 2014, 81, 497–513. [Google Scholar] [CrossRef]
- Lei, X.; Cui, K.; Li, Z.; Su, J.; Jiang, J.; Zhang, H.; Liu, Q.; Shi, D. BMP-1 participates in the selection and dominance of buffalo follicles by regulating the proliferation and apoptosis of granulosa cells. Theriogenology 2016, 85, 999–1012. [Google Scholar] [CrossRef]
- Kobayashi, Y.; Jimenez-Krassel, F.; Li, Q.; Yao, J.; Huang, R.; Ireland, J.J.; Coussens, P.M.; Smith, G.W. Evidence that cocaine- and amphetamine-regulated transcript is a novel intraovarian regulator of follicular atresia. Endocrinology 2004, 145, 5373–5383. [Google Scholar] [CrossRef] [PubMed]
- Baerwald, A.R.; Adams, G.P.; Pierson, R.A. Ovarian antral folliculogenesis during the human menstrual cycle: A review. Hum. Reprod. Update 2012, 18, 73–91. [Google Scholar] [CrossRef] [PubMed]
- Hutz, R.J.; Dierschke, D.J.; Wolf, R.C. Estradiol-induced follicular atresia in rhesus monkeys is not prevented by exogenous gonadotropins. Am. J. Primatol. 1991, 23, 247–255. [Google Scholar] [CrossRef] [PubMed]
- Yu, Y.S.; Sui, H.S.; Han, Z.B.; Li, W.; Luo, M.J.; Tan, J.H. Apoptosis in granulosa cells during follicular atresia: Relationship with steroids and insulin-like growth factors. Cell Res. 2004, 14, 341–346. [Google Scholar] [CrossRef] [PubMed]
- Roymans, D.; Slegers, H. Phosphatidylinositol 3-kinases in tumor progression. Eur. J. Biochem. 2001, 268, 487–498. [Google Scholar] [CrossRef]
- Romorini, L.; Garate, X.; Neiman, G.; Luzzani, C.; Furmento, V.A.; Guberman, A.S.; Sevlever, G.E.; Scassa, M.E.; Miriuka, S.G. AKT/GSK3beta signaling pathway is critically involved in human pluripotent stem cell survival. Sci. Rep. 2016, 6, 35660. [Google Scholar] [CrossRef] [PubMed]
- Asselin, E.; Wang, Y.; Tsang, B.K. X-linked inhibitor of apoptosis protein activates the phosphatidylinositol 3-kinase/Akt pathway in rat granulosa cells during follicular development. Endocrinology 2001, 142, 2451–2457. [Google Scholar] [CrossRef] [PubMed]
- Choi, J.; Jo, M.; Lee, E.; Choi, D. AKT is involved in granulosa cell autophagy regulation via mTOR signaling during rat follicular development and atresia. Reproduction 2014, 147, 73–80. [Google Scholar] [CrossRef]
- Baumgarten, S.C.; Convissar, S.M.; Zamah, A.M.; Fierro, M.A.; Winston, N.J.; Scoccia, B.; Stocco, C. FSH Regulates IGF-2 Expression in Human Granulosa Cells in an AKT-Dependent Manner. J. Clin. Endocrinol. Metab. 2015, 100, E1046–E1055. [Google Scholar] [CrossRef]
- Racaud-Sultan, C.; Vergnolle, N. GSK3beta, a Master Kinase in the Regulation of Adult Stem Cell Behavior. Cells 2021, 10, 225. [Google Scholar] [CrossRef]
- Pap, M.; Cooper, G.M. Role of glycogen synthase kinase-3 in the phosphatidylinositol 3-Kinase/Akt cell survival pathway. J. Biol. Chem. 1998, 273, 19929–19932. [Google Scholar] [CrossRef] [PubMed]
- Liu, M.; Huang, X.; Tian, Y.; Yan, X.; Wang, F.; Chen, J.; Zhang, Q.; Zhang, Q.; Yuan, X. Phosphorylated GSK-3beta protects stress-induced apoptosis of myoblasts via the PI3K/Akt signaling pathway. Mol. Med. Rep. 2020, 22, 317–327. [Google Scholar] [CrossRef] [PubMed]
- Jamieson, C.; Sharma, M.; Henderson, B.R. Regulation of beta-catenin nuclear dynamics by GSK-3beta involves a LEF-1 positive feedback loop. Traffic 2011, 12, 983–999. [Google Scholar] [CrossRef] [PubMed]
- Lustig, B.; Behrens, J. The Wnt signaling pathway and its role in tumor development. J. Cancer Res. Clin. Oncol. 2003, 129, 199–221. [Google Scholar] [CrossRef] [PubMed]
- Patel, P.; Woodgett, J.R. Glycogen Synthase Kinase 3: A Kinase for All Pathways? Curr. Top. Dev. Biol. 2017, 123, 277–302. [Google Scholar]
Gene Symbol | Primer Sequence (5′-3′) | Product Size (bp) | Accession No. |
---|---|---|---|
BAX | F:GTCTGAAGCGCATCGGAGAT R:GATGGTCCTGATCAACTCGGG | 224 | XM_025269476.1 |
BCL2 | F:AGCGGGAGTTCAGTGTGACT R:AATCGGATGCACTCGTTAGG | 118 | XM_025273634.1 |
AKT | F:AAGAGGCAGGAGGAGGAGAC R:CCCAGCAGCTTCAGGTACTC | 140 | NM_001290841.1 |
CYP19A1 | F:GCTTTTGGAAGTGCTGAACC R:ATCCAGTGAGCAGCAGGACT | 98 | XM_025295054.1 |
CARTPT | F:CTCTGAGCTCTTGCCCATCT R:TGCGCTCCCACCTTTTATAG | 104 | XM_006078190.2 |
β-Catenin | F: GATACCCAGCGTCGTACATC R: TCCTTGTCCTGAGCAAGTTC | 242 | XM_025272907.3 |
β-actin | F: GTCACCAACTGGGACGACAT R: GGTCTCGAACATGATCTGGGT | 153 | XM_025274489.3 |
GAPDH | F: CCTGCCAAGTATGATGAGA R: AGGTAGAAGAGTGAGTGT | 130 | XM_006065800.4 |
Species | E-Value/Random Matching Possibility | Similarity to CART Buffalo Gene (%) | Reference Sequence |
---|---|---|---|
Domestic Cattle (Bos taurus) | 0 | 100 | AY603972.1 |
American Bison (Bison bison) | 7.00 × 10−107 | 100 | XM_010853569.1 |
Wild Yak (Bos mutus) | 0 | 98 | CP027088.1 |
Sheep (Ovis aries) | 4.00 × 10−99 | 98 | XM_015101190.1 |
Bactrian Camel (Camelus bactrianus) | 7.00 × 10−74 | 91 | XM_010949313.1 |
Dromedary Camel (Camelus dromedarius) | 1.00 × 10−73 | 91 | XM_010974976.1 |
Macaque Monkey (Macaca mulatta) | 2.00 × 10−57 | 90 | NM_001265877.1 |
Horse (Equus caballus) | 2.00 × 10−54 | 85 | XM_023618226.1 |
Donkey (Equus asinus) | 1.00 × 10−53 | 85 | XM_014851944.1 |
Human (Homo sapiens) | 3.00 × 10−180 | 81 | NG_015988.1 |
Wild Boar (Sus scrofa) | 0 | 78 | EF581838.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yang, C.; Zheng, H.; Amin, A.; Faheem, M.S.; Duan, A.; Li, L.; Xiao, P.; Li, M.; Shang, J. Follicular Atresia in Buffalo: Cocaine- and Amphetamine-Regulated Transcript (CART) and the Underlying Mechanisms. Animals 2024, 14, 2138. https://doi.org/10.3390/ani14152138
Yang C, Zheng H, Amin A, Faheem MS, Duan A, Li L, Xiao P, Li M, Shang J. Follicular Atresia in Buffalo: Cocaine- and Amphetamine-Regulated Transcript (CART) and the Underlying Mechanisms. Animals. 2024; 14(15):2138. https://doi.org/10.3390/ani14152138
Chicago/Turabian StyleYang, Chunyan, Haiying Zheng, Ahmed Amin, Marwa S. Faheem, Anqin Duan, Lingyu Li, Peng Xiao, Mengqi Li, and Jianghua Shang. 2024. "Follicular Atresia in Buffalo: Cocaine- and Amphetamine-Regulated Transcript (CART) and the Underlying Mechanisms" Animals 14, no. 15: 2138. https://doi.org/10.3390/ani14152138