Investigation of Tick-Borne Pathogens in Ixodes Ticks from Bosnia and Herzegovina
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Study Area and Tick Collection
2.2. Morphological Identification of Ticks and Tick Pooling Procedure
2.3. Molecular Identification of Pathogens
2.4. Data Analysis
3. Results
3.1. Tick Species Distribution
3.2. Pathogen Detection and Identification of Tick Pools
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Parola, P.; Raoult, D. Ticks and Tickborne Bacterial Diseases in Humans: An Emerging Infectious Threat. Clin. Infect. Dis. 2001, 32, 897–928. [Google Scholar] [CrossRef] [PubMed]
- Ogden, N.H.; Mechai, S.; Margos, G. Changing Geographic Ranges of Ticks and Tick-Borne Pathogens: Drivers, Mechanisms and Consequences for Pathogen Diversity. Front. Cell. Infect. Microbiol. 2013, 3, 46. [Google Scholar] [CrossRef] [PubMed]
- Estrada-Pena, A.; de la Fuente, J. The ecology of ticks and epidemiology of tick-borne viral diseases. Antivir. Res. 2014, 108, 104–128. [Google Scholar] [CrossRef] [PubMed]
- Estrada-Peña, A.; Farkas, R.; Jaenson, T.G.T.; Koenen, F.; Madder, M.; Pascucci, I.; Salman, M.; Tarrés-Call, J.; Jongejan, F. Association of Environmental Traits with the Geographic Ranges of Ticks (Acari: Ixodidae) of Medical and Veterinary Importance in the Western Palearctic. A Digital Data Set. Exp. Appl. Acarol. 2012, 59, 351–366. [Google Scholar] [CrossRef] [PubMed]
- Zubriková, D.; Wittmann, M.; Hönig, V.; Švec, P.; Víchová, B.; Essbauer, S.; Dobler, G.; Grubhoffer, L.; Pfister, K. Prevalence of Tick-Borne Encephalitis Virus and Borrelia burgdorferi sensu lato in Ixodes ricinus Ticks in Lower Bavaria and Upper Palatinate, Germany. Ticks Tick Borne Dis. 2020, 11, 101375. [Google Scholar] [CrossRef] [PubMed]
- Smith, F.D.; Wall, L.E.R. Prevalence of Babesia and Anaplasma in Ticks Infesting Dogs in Great Britain. Vet. Parasitol. 2013, 198, 18–23. [Google Scholar] [CrossRef] [PubMed]
- Rizzoli, A.; Silaghi, C.; Obiegala, A.; Rudolf, I.; Hubálek, Z.; Földvári, G.; Plantard, O.; Vayssier-Taussat, M.; Bonnet, S.; Špitalská, E.; et al. Ixodes ricinus and Its Transmitted Pathogens in Urban and Peri-Urban Areas in Europe: New Hazards and Relevance for Public Health. Front. Public Health 2014, 2, 251. [Google Scholar] [CrossRef] [PubMed]
- Petersen, J.M.; Mead, P.S.; Schriefer, M.E. Francisella tularensis: An Arthropod-Borne Pathogen. Vet. Res. 2008, 40, 07. [Google Scholar] [CrossRef]
- Krumpálová, Z.; Mangová, B.; Purgatová, S.; Didyk, Y.M.; Kazimírová, M. Molecular Characterisation of Three Ixodes (Pholeoixodes) Species (Ixodida, Ixodidae) and the First Record of Ixodes (Pholeoixodes) kaiseri from Slovakia. ZooKeys 2023, 1158, 147–162. [Google Scholar] [CrossRef]
- Santos-Silva, M.M.; Beati, L.; Santos, A.S.; De Sousa, R.; Núncio, M.S.; Melo, P.; Santos-Reis, M.; Fonseca, C.; Formosinho, P.; Vilela, C.; et al. The Hard-Tick Fauna of Mainland Portugal (Acari: Ixodidae): An Update on Geographical Distribution and Known Associations with Hosts and Pathogens. Exp. Appl. Acarol. 2011, 55, 85–121. [Google Scholar] [CrossRef]
- Karbowiak, G.; Stanko, M.; Miterpaková, M.; Hurníková, Z.; Víchová, B. Ticks (Acari: Ixodidae) Parasitizing Red Foxes (Vulpes vulpes) in Slovakia and New Data About Subgenus Pholeoixodes Occurrence. Acta Parasitol. 2020, 65, 636–643. [Google Scholar] [CrossRef] [PubMed]
- Abdullah, S.; Helps, C.; Tasker, S.; Newbury, H.; Wall, R. Ticks Infesting Domestic Dogs in the UK: A Large-Scale Surveillance Programme. Parasites Vectors 2016, 9, 391. [Google Scholar] [CrossRef] [PubMed]
- Jameson, L.J.; Medlock, J.M. Tick Surveillance in Great Britain. Vector Borne Zoonotic Dis. 2011, 11, 403–412. [Google Scholar] [CrossRef] [PubMed]
- Ogden, N.H.; Cripps, P.; Davison, C.C.; Owen, G.; Parry, J.M.; Timms, B.J.; Forbes, A.B. The Ixodid Tick Species Attaching to Domestic Dogs and Cats in Great Britain and Ireland. Med. Vet. Entomol. 2000, 14, 332–338. [Google Scholar] [CrossRef] [PubMed]
- Gern, L.; Rouvinez, E.; Toutoungi, L.N.; Godfroid, E. Transmission Cycles of Borrelia burgdorferi sensu lato Involving Ixodes ricinus and/or I. hexagonus Ticks and the European Hedgehog, Erinaceus Europaeus, in Suburban and Urban Areas in Switzerland. Folia Parasitol. 1997, 44, 309–314. [Google Scholar]
- Estrada-Peña, A.; Oteo, J.A.; Estrada-Peña, R.; Gortázar, C.; Osácar, J.J.; Moreno, J.A.; Castell, J. Borrelia burgdorferi sensu lato in Ticks (Acari: Ixodidae) from Two Different Foci in Spain. Exp. Appl. Acarol. 1995, 19, 173–180. [Google Scholar] [CrossRef] [PubMed]
- Boldis, V.; Kocianová, E.; Strus, J.; Tusek-Znidaric, M.; Sparagano, O.A.; Stefanidesová, K.; Spitalska, E. Rickettsial agents in Slovakian ticks (Acarina, Ixodidae) and their ability to grow in Vero and L929 cell lines. Ann. N. Y. Acad. Sci. 2008, 1149, 281–285. [Google Scholar] [CrossRef] [PubMed]
- Barradas, P.F.; Mesquita, J.R.; Mateus, T.L.; Ferreira, P.; Amorim, I.; Gärtner, F.; de Sousa, R. Molecular detection of Rickettsia spp. in ticks and fleas collected from rescued hedgehogs (Erinaceus europaeus) in Portugal. Exp. Appl. 2021, 83, 449–460. [Google Scholar] [CrossRef] [PubMed]
- Najm, N.A.; Meyer-Kayser, E.; Hoffmann, L.; Herb, I.; Fensterer, V.; Pfister, K.; Silaghi, C. A molecular survey of Babesia spp. and Theileria spp. in red foxes (Vulpes vulpes) and their ticks from Thuringia, Germany. Ticks Tick Borne Dis. 2014, 5, 386–391. [Google Scholar] [CrossRef]
- Keyte, S.; Abdullah, S.; James, K.; Newbury, H.; Helps, C.; Tasker, S.; Wall, R. Prevalence and distribution of Anaplasma phagocytophilum in ticks collected from dogs in the United Kingdom. Vet Rec. 2021, 188, 1–7. [Google Scholar] [CrossRef]
- Kapo, N.; Bogdanović, I.Z.; Gagović, E.; Žekić, M.; Veinović, G.; Sukara, R.; Mihaljica, D.; Adžić, B.; Kadriaj, P.; Cvetkovikj, A.; et al. Ixodid Ticks and Zoonotic Tick-Borne Pathogens of the Western Balkans. Parasites Vectors 2024, 17, 45. [Google Scholar] [CrossRef] [PubMed]
- Omeragić, J.; Haračić, S.Š.; Soldo, D.K.; Kapo, N.; Fejzić, N.; Škapur, V.; Medlock, J. Distribution of Ticks in Bosnia and Herzegovina. Ticks Tick-Borne Dis. 2022, 13, 101870. [Google Scholar] [CrossRef] [PubMed]
- Krčmar, S. Diversity, Ecology, and Seasonality of Hard Ticks (Acari: Ixodidae) in Eastern Croatia. J. Vector Ecol. 2019, 44, 18–29. [Google Scholar] [CrossRef]
- Omeragić, J. Investigation of Ticks of the Ixodidae Family in Bosnia and Herzegovina. Ph.D. Thesis, University of Sarajevo—Veterinary Faculty, Sarajevo, Bosnia and Herzegovina, 2008. [Google Scholar]
- Omeragić, J. Ixodid ticks in Bosnia and Herzegovina. Exp. Appl. Acarol. 2011, 53, 301–309. [Google Scholar] [CrossRef] [PubMed]
- Omeragić, J.; Zuko, A.; Jazić, A. The effect of various factors for the development of ticks and tick-borne diseases in Bosnia and Herzegovina. In Proceedings of the 2nd Conference on Neglected Vectors and Vector-Borne Diseases (EURNEGVEC) with Management Committee and Working Group Meetings of the Cost Action TD1303, Izmir, Turkey, 31 March–2 April 2015. [Google Scholar]
- Lasić, L.; Ušanović, L.; Ćakić, S.; Hanjalić, J.; Kalamujić Stroil, B. First molecular detection of Borrelia burgdorferi sensu lato in Ixodes ricinus ticks collected from humans in the Sarajevo Canton (Bosnia and Herzegovina). Syst. Appl. Acarol. 2020, 25, 169172. [Google Scholar] [CrossRef]
- Hodžić, A.; Fuehrer, H.P.; Duscher, G.G. First Molecular Evidence of Zoonotic Bacteria in Ticks in Bosnia and Herzegovina. Transbound. Emerg. Dis. 2016, 64, 1313–1316. [Google Scholar] [CrossRef] [PubMed]
- Zlobin, V.I.; Adeljšin, R.A.; Golubović, S.; Tešanović, M.; Verhozina, M.M.; Kozlova, I.V.; Belikov, S.I. Molecular epidemiology of tick-borne encephalitis virus. In Proceedings of the 3rd Congress of Infectious Disease Specialists in Bosnia and Herzegovina with International Participation, Banja Luka, Bosnia and Herzegovina, 2–5 November 2006; Naučne Medicinske Komunikacije: Banja Luka, Bosnia and Herzegovina, 2006; pp. 11–14. [Google Scholar]
- Stevanović, O.; Jurković, D.; Polkinghorne, A.; Ćeleš, A.; Ilić, T.; Dimitrijević, S.; Nedić, D.; Beck, R. Molecular Detection of Babesia divergens and Mycoplasma wenyonii Infection in Cattle from Bosnia and Herzegovina. Parasitol. Res. 2020, 119, 1423–1427. [Google Scholar] [CrossRef] [PubMed]
- Salomon, J.; Hamer, S.A.; Swei, A. A Beginner’s Guide to Collecting Questing Hard Ticks (Acari: Ixodidae): A Standardized Tick Dragging Protocol. J. Insect Sci. 2020, 20, 11. [Google Scholar] [CrossRef] [PubMed]
- General Requirements for the Competence of Testing and Calibration Laboratories. Available online: https://www.isbih.gov.ba/en/standard/305987 (accessed on 15 February 2024).
- Estrada-Pena, A.; Bouattour, A.; Camicas, J.L.; Walker, A.R. Ticks of Domestic Animals in the Mediterranean Region: A Guide to Identification of Species; University of Zaragoza: Zaragoza, Spain, 2004; p. 131. ISBN 8-4962141-84. [Google Scholar]
- Estrada-Peña, A.; Mihalca, A.D.; Petney, T.N. Ticks of Europe and North Africa: A Guide to Species Identification; Springer International Publishing: Berlin/Heidelberg, Germany, 2018. [Google Scholar] [CrossRef]
- Labruna, M.B.; Whitworth, T.; Horta, M.C.; Bouyer, D.H.; McBride, J.W.; Pinter, A.; Popov, V.; Gennari, S.M.; Walker, D.H. Rickettsia species infecting Amblyomma cooperi ticks from an area in the state of São Paulo, Brazil, where Brazilian spotted fever is endemic. J. Clin. Microbiol. 2004, 42, 90–98. [Google Scholar] [CrossRef]
- Øines, Ø.; Radzijevskaja, J.; Paulauskas, A.; Rosef, O. Prevalence and Diversity of Babesia spp. in Questing Ixodes ricinus Ticks from Norway. Parasites Vectors 2012, 5, 1–8. [Google Scholar] [CrossRef]
- Ivacic, L.; Reed, K.D.; Mitchell, P.D.; Ghebranious, N. A LightCycler TaqMan Assay for Detection of Borrelia burgdorferi sensu lato in Clinical Samples. Diagn. Microbiol. Infect. Dis. 2007, 57, 137–143. [Google Scholar] [CrossRef] [PubMed]
- Courtney, J.W.; Kostelnik, L.M.; Zeidner, N.S.; Massung, R.F. Multiplex Real-Time PCR for Detection of Anaplasma phagocytophilum and Borrelia burgdorferi. J. Clin. Microbiol. 2004, 42, 3164–3168. [Google Scholar] [CrossRef] [PubMed]
- Fracasso, G.; Grillini, M.; Grassi, L.; Gradoni, F.; Rold, G.D.; Bertola, M. Effective Methods of Estimation of Pathogen Prevalence in Pooled Ticks. Pathogens 2023, 12, 557. [Google Scholar] [CrossRef] [PubMed]
- Estrada-Peña, A.; Cevidanes, A.; Sprong, H.; Millán, J. Pitfalls in Tick and Tick-Borne Pathogens Research, Some Recommendations and a Call for Data Sharing. Pathogens 2021, 10, 712. [Google Scholar] [CrossRef] [PubMed]
- Punda-Polić, V.; Leko-Grbić, J.; Radulović, S. Prevalence of Antibodies to Rickettsiae in the North-Western Part of Bosnia and Herzegovina. Eur. J. Epidemiol. 1995, 11, 697–699. [Google Scholar] [CrossRef]
- Papić, L. Contribution to the Knowledge of Cattle Piroplasmosis and Its Vectors in the Bugojno Region. Master Thesis, University of Sarajevo—Veterinary Faculty, Sarajevo, Bosnia and Herzegovina, 1976. [Google Scholar]
- Hodžić, A.; Alić, A.; Fuehrer, H.P.; Harl, J.; Wille-Piazzai, W.; Duscher, G. A Molecular Survey of Vector-Borne Pathogens in Red Foxes (Vulpes vulpes) from Bosnia and Herzegovina. Parasites Vectors 2015, 8, 88. [Google Scholar] [CrossRef]
- Hodžić, A.; Alić, A.; Duscher, G.G. High Diversity of Blood-Associated Parasites and Bacteria in European Wild Cats in Bosnia and Herzegovina: A Molecular Study. Ticks Tick-Borne Dis. 2018, 9, 589–593. [Google Scholar] [CrossRef]
- Omeragić, J.; Hrvat, H.; Crnkić, Ć. Occurrence of protozoa in dogs in the area of Tuzla. In International Congress on One World-One Health-One Vision; VETistanbul Group: Sarajevo, Bosnia and Herzegovina, 2015; pp. 14–15. [Google Scholar]
- Majkić, M.; Kovačević, V.; Kovčević, D. The prevalence of canine babesiosis in the territory of the municipality of Teslić. Vet. J. Rebublic Srp. 2015, 2, 191–299. [Google Scholar]
- Hrvat, H. Study of Protozoa from the Class Sporozoea and Zoomastigophorea in Dogs in the Northeastern Bosnia Area. Master Thesis, University of Sarajevo, Sarajevo, Bosnia and Herzegovina, 2015. [Google Scholar]
- Ćoralić, A.; Gabrielli, S.; Zahirović, A.; Stojanović, N.M.; Milardi, G.L.; Jažić, A.; Zuko, A.; Čamo, D.; Otašević, S. First Molecular Detection of Babesia canis in Dogs from Bosnia and Herzegovina. Ticks Tick-Borne Dis. 2018, 9, 363–368. [Google Scholar] [CrossRef]
- Colella, V.; Huggins, L.; Hodžić, A.; Galon, C.; Traub, R.; Alić, A.; Iatta, R.; Halos, L.; Otranto, D.; Vayssier-Taussat, M.; et al. High-throughput Microfluidic Real-time PCR for the Simultaneous Detection of Selected Vector-borne Pathogens in Dogs in Bosnia and Herzegovina. Transbound. Emerg. Dis. 2022, 69, e2943–e2951. [Google Scholar] [CrossRef]
- Atif, F.A. Alpha proteobacteria of genus Anaplasma (Rickettsiales: Anaplasmataceae): Epidemiology and characteristics of Anaplasma species related to veterinary and public health importance. Parasitology 2016, 143, 659–685. [Google Scholar] [CrossRef] [PubMed]
- Probst, J.; Springer, A.; Fingerle, V.; Strube, C. Frequency of Anaplasma phagocytophilum, Borrelia spp., and coinfections in Ixodes ricinus ticks collected from dogs and cats in Germany. Parasites Vectors 2024, 17, 87. [Google Scholar] [CrossRef] [PubMed]
- The Institute of Public Health of the Federation of Bosnia and Herzegovina. Available online: https://www.zzjzfbih.ba/ (accessed on 15 February 2024).
- The Institute of Public Health of the Republic of Srpska. Available online: https://www.phi.rs.ba/ (accessed on 15 February 2024).
Pathogen | Primer (100 pmol/µL) | Oligonucleotide Sequence (5’–3’) | Final Conc./25 µL | Amplicon Size (bp) | Ref. |
---|---|---|---|---|---|
Rickettsia spp. | Rspp-F | GAGAGAAAATTATATCCAAATGTTGAT | 450 nM | 100 | 34 |
Rspp-R | AGGGTCTTCGTGCATTTCTT | ||||
Rspp-P | [CY5]-CATTGTGCCATCCAGCCTACGGT-[BHQ2] | 150 nM | |||
Babesia spp. | Bab-F | CAGCTTGACGGTAGGGTATTGG | 1 µM | 20 | 35 |
Bab-R | TCGAACCCTAATTCCCCGTTA | ||||
Bab-P | [YAKYE]- CGAGGCAGCAACGG-[BHQ1] | 500 nM | |||
B. burgdorferi s.l. | Bbsl_ospA-F | AATATTTATTGGGAATAGGTCTAA | 600 nM | 59 | 36 |
Bbsl_ospA-R | CACCAGGCAAATCTACTGA | ||||
Bbsl_ospA-P | [FAM]-TTAATAGCATGTAAGCAAAATGTTAGCA-[BHQ1] | 100 nM | |||
A. phagocytophilum | Apmsp2-F: | ATGGAAGGTAGTGTTGGTTATGGTATT | 900 nM | 77 | 37 |
Apmsp2-R | TTGGTCTTGAAGCGCTCGTA | ||||
Apmsp2-P | [CY5]-TGGTGCCAGGGTTGAGCTTGAGATTG-[BHQ2] | 125 nM |
No. of Tested Tick Pools | Rickettsia spp. | Babesia spp. | A. phagocytophilum | B. burgdorferi s.l. | |||||
---|---|---|---|---|---|---|---|---|---|
No. of Positive Pools | MIR (95% CI) | No. of Positive Pools | MIR (95% CI) | No. of Positive Pools | MIR (95% CI) | No. of Positive Pools | MIR (95% CI) | ||
Western and Southwestern Bosnia | |||||||||
Dogs | 90 | 28 ♀ | 8.9 (5.8–12.0) | 0 | 0 | 43 ♀ | 13.7 (9.9–17.4) | 0 | 0 |
13 ♂ | 4.1 (1.9–6.3) | 3 ♂ | 0.9 (0.0–2.0) | ||||||
Cats | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Cattle | 6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Sheep | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Goats | 7 | 0 | 0 | 0 | 0 | 5 ♀ | 20.4 (6.8–40.7) | 0 | 0 |
Herzegovina | |||||||||
Dogs | 42 | 21 ♀ | 14.3 (8.6–19.9) | 0 | 0 | 17 ♀ | 11.6 (6.4–16.7) | 0 | 0 |
Cats | 6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Cattle | 6 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Sheep | 3 | 1 ♀ | 9.5 (0.0–26.1) | 0 | 0 | 0 | 0 | 0 | 0 |
Goats | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Central Bosnia | |||||||||
Dogs | 59 | 8 ♀ | 3.9 (1.2–6.5) | 0 | 0 | 20 ♀ | 9.7 (5.6–13.7) | 15 ♀ | 7.3 (3.7–10.8) |
5 ♂ | 2.4 (0.3–4.5) | ||||||||
Cats | 6 | 1 ♀ | 4.8 (0.0–13.9) | 0 | 0 | 0 | 0 | 1 ♀ | 4.8 (0.0–13.9) |
Cattle | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Sheep | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Goats | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Eastern Bosnia | |||||||||
Dogs | 72 | 0 | 0 | 0 | 0 | 34 ♀ | 13.5 (9.3–17.7) | 22 ♀ | 8.7 (5.3–12.2) |
Cats | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Cattle | 18 | 0 | 0 | 0 | 0 | 15 ♀ | 23.8 (14.0–34.3) | 0 | 0 |
Sheep | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Goats | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Northern and Northeastern Bosnia | |||||||||
Dogs | 82 | 15 ♀ | 5.2 (2.7–7.8) | 40 ♀ | 16 (11.8–20.3) | 0 | 0 | 13♀ | 4.5 (2.1–6.9) |
7 ♂ | 2.4 (0.7–4.2) | ||||||||
Cats | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Cattle | 10 | 0 | 0 | 6 | 17.1 (10.8–21.3) | 7 ♀ | 20 (6.8–33.3) | 0 | 0 |
Sheep | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Goats | 4 | 1 ♀ | 7.1 (0.0–20.6) | 0 | 0 | 0 | 0 | 0 | 0 |
Total | 431 | 95 | 6.3 (5.0–7.5) | 46 | 3.1 (2.2–3.9) | 133 | 8.8 (7.4–10.4) | 51 | 3.4 (2.5–4.3) |
No. of Pools Tested | Rickettsia spp. | Babesia spp. | A. phagocytophilum | B. burgdorferi s.l. | |||||
---|---|---|---|---|---|---|---|---|---|
No. of Positive Pools | MIR (95% CI) | No. of Positive Pools | MIR (95% CI) | No. of Positive Pools | MIR (95% CI) | No. of Positive Pools | MIR (95% CI) | ||
Western and Southwestern Bosnia | 8 | 0 | 0 | 8 ♀ | 100 (100) | 0 | 0 | 0 | 0 |
Herzegovina | 5 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Central Bosnia | 4 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Eastern Bosnia | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Northern and Northeastern Bosnia | 2 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
Total | 19 | 0 | 0 | 8 | 3.6 (2.3–4.6) | 0 | 0 | 0 | 0 |
Co-Detection of Different Pathogens | No. of Co-Infection Pool, (MIR) | No. of Co-Infection Pool, (MIR) | No. of Co-Infection Pool, (MIR) |
---|---|---|---|
Dogs | Cats | Goat | |
B. burgdorferi s.l. + A. phagocytophilum | 1 ♀, 0.08 | 0 | 0 |
B. burgdorferi s.l. + Rickettsia spp. | 0 | 1 ♀, 5.5 | 0 |
Rickettsia spp. + A. phagocytophilum | 2 ♀, 0.16 | 0 | 1 ♀, 6.6 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Omeragić, J.; Kapo, N.; Goletić, Š.; Softić, A.; Terzić, I.; Šabić, E.; Škapur, V.; Klarić Soldo, D.; Goletić, T. Investigation of Tick-Borne Pathogens in Ixodes Ticks from Bosnia and Herzegovina. Animals 2024, 14, 2190. https://doi.org/10.3390/ani14152190
Omeragić J, Kapo N, Goletić Š, Softić A, Terzić I, Šabić E, Škapur V, Klarić Soldo D, Goletić T. Investigation of Tick-Borne Pathogens in Ixodes Ticks from Bosnia and Herzegovina. Animals. 2024; 14(15):2190. https://doi.org/10.3390/ani14152190
Chicago/Turabian StyleOmeragić, Jasmin, Naida Kapo, Šejla Goletić, Adis Softić, Ilma Terzić, Emina Šabić, Vedad Škapur, Darinka Klarić Soldo, and Teufik Goletić. 2024. "Investigation of Tick-Borne Pathogens in Ixodes Ticks from Bosnia and Herzegovina" Animals 14, no. 15: 2190. https://doi.org/10.3390/ani14152190