Effects of a Nutraceutical Treatment on the Intestinal Microbiota of Sled Dogs
Abstract
:Simple Summary
Abstract
1. Introduction
Aim of the Study
2. Material and Methods
2.1. Ethic Statement
2.2. Product Characteristics
2.3. Animals and Study Design
2.4. Diet
2.5. Microbiological Analysis and Dysbiosis Index
2.6. Statistical Analysis
3. Results
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Swanson, K.S.; Dowd, S.E.; Suchodolski, J.S.; Middelbos, I.S.; Vester, B.M.; Barry, K.A.; Nelson, K.E.; Torralba, M.; Henrissat, B.; Coutinho, P.M.; et al. Phylogenetic and gene-centric metagenomics of the canine intestinal microbiome reveals similarities with humans and mice. ISME J. 2011, 5, 639–649. [Google Scholar] [CrossRef] [PubMed]
- Tun, H.M.; Brar, M.S.; Khin, N.; Jun, L.; Kin-Hi Hui, R.; Dowd, S.E.; Chi-Ching Leung, F. Gene-centric metagenomics analysis of feline intestinal microbiome using 454 junior pyrosequencing. J. Microbiol. Methods 2012, 88, 369–376. [Google Scholar] [CrossRef] [PubMed]
- Deusch, O.; O’Flynn, C.; Colyer, A.; Morris, P.; Allaway, P.; Jones, P.G.; Swanson, K.S. Deep Illumina-Based Shotgun Sequencing Reveals Dietary Effects on the Structure and Function of the Fecal Microbiome of Growing Kittens. PLoS ONE 2014, 9, e101021. [Google Scholar] [CrossRef] [PubMed]
- Tsilimigras, M.C.B.; Fodor, A.; Jobin, C. Carcinogenesis and therapeutics: The microbiota perspective. Nat. Microbiol. 2019, 2, 17008. [Google Scholar] [CrossRef] [PubMed]
- Simpson, H.L.; Campbell, B.J. Review article: Dietary fibre–microbiota interactions. Aliment. Pharmacol. Ther. 2015, 42, 158–179. [Google Scholar] [CrossRef] [PubMed]
- Guan, Z.W.; Yu, E.Z.; Feng, Q. Soluble Dietary Fiber, One of the Most Important Nutrients for the Gut Microbiota. Molecules 2021, 26, 6802. [Google Scholar] [CrossRef] [PubMed]
- Bielik, V.; Kolisek, M. Bioaccessibility and Bioavailability of Minerals in Relation to a Healthy Gut Microbiome. Int. J. Mol. Sci. 2021, 22, 6803. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.; Kalainy, S.; Baskota, N.; Chiang, D.; Deehan, E.C.; McDougall, C.; Tandon, P.; Martinez, I.; Cervera, C.; Walter, J.; et al. Faecal microbiota from patients with cirrhosis has a low capacity to ferment non-digestible carbohydrates into short-chain fatty acids. Liver Int. 2019, 39, 1437–1447. [Google Scholar] [CrossRef] [PubMed]
- Kanauchi, O.; Holdings, K.; Matsumoto, Y.; Matsumura, M.; Fukuoka, M. The Beneficial Effects of Microflora, Especially Obligate Anaerobes, and Their Products on the Colonic Environment in Inflammatory Bowel Disease. Curr. Pharm. Des. 2005, 11, 1047–1053. [Google Scholar] [CrossRef] [PubMed]
- Ni, J.; Wu, G.D.; Albenberg, L.; Tomov, V.T. Gut microbiota and IBD: Causation or correlation? Nat. Rev. Gastroenterol. Hepatol. 2017, 14, 573–584. [Google Scholar] [CrossRef] [PubMed]
- Weiss, G.A.; Hennet, T. Mechanisms and consequences of intestinal dysbiosis. Review. Cell. Mol. Life Sci. 2017, 74, 2959–2977. [Google Scholar] [CrossRef] [PubMed]
- Levy, M.; Kolodziejczyk, A.; Thaiss, C.A.; Elinav, E. Dysbiosis and the immune system. Nat. Rev. Immunol. 2017, 17, 219–232. [Google Scholar] [CrossRef] [PubMed]
- Takácová, M.; Bomba, A.; Tóthová, C.; Michálová, A.; Turna, H. Any Future for Faecal Microbiota Transplantation as a Novel Strategy for Gut Microbiota Modulation in Human and Veterinary Medicine? Life 2022, 12, 723. [Google Scholar] [CrossRef] [PubMed]
- Guard, B.C.; Barr, J.W.; Reddivari, L.; Klemashevich, C.; Jayaraman, A.; Steiner, J.M.; Vanamala, J.; Suchodolski, J.S. Characterization of Microbial Dysbiosis and Metabolomic Changes in Dogs with Acute Diarrhea. PLoS ONE 2015, 10, e0127259. [Google Scholar] [CrossRef] [PubMed]
- Rummell, L.M.; Steele, M.A.; Templeman, J.R.; Yohe, T.T.; Akhtar, N.; Lambie, J.G.; Singh, P.; Asquith, T.; Verbrugghe, A.; Pearson, W.; et al. A proof of principle study investigating the effects of supplemental concentrated brewer’s yeast on markers of gut permeability, inflammation, and fecal metabolites in healthy non-challenged adult sled dogs. J. Anim. Sci. 2022, 100, skac281. [Google Scholar] [CrossRef] [PubMed]
- Generoso, S.V.; Viana, M.L.; Santos, R.G.; Arantes, R.M.E.; Martins, F.S.; Nicoli, J.R.; Machado, J.A.N.; Correia, M.I.T.D.; Cardoso, V.N. Protection against increased intestinal permeability and bacterial translocation induced by intestinal obstruction in mice treated with viable and heat-killed Saccharomyces boulardii. Eur. J. Nutr. 2011, 50, 261–269. [Google Scholar] [CrossRef] [PubMed]
- White, R.; Atherlyb, T.; Guard, B.; Rossi, G.; Wange, C.; Mosherf, C.; Webbg, C.; Hill, S.; Ackermanni, M.; Sciabarra, P.; et al. Randomized, controlled trial evaluating the effect of multi-strain probiotic on the mucosal microbiota in canine idiopathic inflammatory bowel disease. Gut Microbes 2017, 8, 451–466. [Google Scholar] [CrossRef] [PubMed]
- Tolbert, M.K.; Murphy, M.; Gaylord, L.; Witzel-Rollins, A. Dietary management of chronic enteropathy in dogs. J. Small Anim. Pract. 2022, 63, 425–434. [Google Scholar] [CrossRef] [PubMed]
- Belà, B.; Coman, M.M.; Verdenelli, M.C.; Gramenzi, A.; Pignataro, G.; Fiorini, D.; Silvi, S. In Vitro Assessment of Postbiotic and Probiotic Commercial Dietary Supplements Recommended for Counteracting Intestinal Dysbiosis in Dogs. Vet. Sci. 2024, 11, 19. [Google Scholar] [CrossRef] [PubMed]
- Schmitz, S.; Suchodolski, J.S. Understanding the canine intestinal microbiota and its modification by pro-, pre- and synbiotics what is the evidence? Review. Vet. Med. Sci. 2016, 2, 71–94. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Mazcorro, J.F.; Barcenas-Walls, J.R.; Suchodolski, J.S.; Steiner, J.M. Molecular assessment of the fecal microbiota in healthy cats and dogs before and during supplementation with fructo-oligosaccharides (FOS) and inulin using high-throughput 454-pyrosequencing. PeerJ 2017, 5, e3184. [Google Scholar] [CrossRef] [PubMed]
- Strompfova, V.; Kubašová, I.; Lauková, A. Health benefits observed after probiotic Lactobacillus fermentum CCM 7421 application in dogs. Appl. Microbiol. Biotechnol. 2017, 101, 6309–6319. [Google Scholar] [CrossRef] [PubMed]
- Yang, X.; Wang, C.; Zhang, Z.; Nie, W.; Shang, L. Armored probiotics for oral delivery. Review. Smart Med. 2023, 2, e20230019. [Google Scholar] [CrossRef]
- Adams, C.A. The probiotic paradox: Live and dead cells are biological response modifiers. Nutr. Res. Rev. 2010, 23, 37–46. [Google Scholar] [CrossRef] [PubMed]
- Taverniti, V.; Guglielmetti, S. The immunomodulatory properties of probiotic microorganisms beyond their viability (ghost probiotics: Proposal of paraprobiotic concept). Genes Nutr. 2011, 6, 261–274. [Google Scholar] [CrossRef] [PubMed]
- Goldenberg, J.Z.; Yap, C.; Lytvyn, L.; Lo, C.K.; Beardsley, J.; Mertz, D.; Johnston, B.C. Probiotics for the prevention of Clostridium difficile-associated diarrhea in adults and children. Cochrane Database Syst. Rev. 2017, 12, CD006095. [Google Scholar] [CrossRef] [PubMed]
- Deshpande, G.; Athalye-Jape, G.; Patole, S. Para-probiotics for Preterm Neonates—The Next Frontier. Nutrients 2018, 10, 871. [Google Scholar] [CrossRef] [PubMed]
- Suchodolski, J.S.; Dowd, S.E.; Wilke, V.; Steiner, J.M.; Jergens, A.E. 16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease. PLoS ONE 2012, 7, e39333. [Google Scholar] [CrossRef] [PubMed]
- Minamoto, Y.; Otoni, C.C.; Steelman, S.M.; Büyükleblebici, O.; Steiner, J.M.; Jergens, A.E.; Suchodolski, J.S. Alteration of the fecal microbiota and serum metabolite profiles in dogs with idiopathic inflammatory bowel disease. Gut Microbes 2015, 6, 33–47. [Google Scholar] [CrossRef]
- Panasevich, M.R.; Kerr, K.R.; Dilger, R.N.; Fahey, G.C.J.; Guérin-Deremaux, L.; Lynch, G.L.; Wils, D.; Suchodolski, J.S.; Steer, J.M.; Dowd, S.E.; et al. Modulation of the faecal microbiome of healthy adult dogs by inclusion of potato fibre in the diet. Br. J. Nutr. 2015, 113, 125–133. [Google Scholar] [CrossRef] [PubMed]
- Xenoulis, P.G.; Palculict, B.; Allenspach, K.; Steiner, J.M.; Van House, A.M.; Suchodolski, J.S. Molecular-phylogenetic characterization of microbial communities’ imbalances in the small intestine of dogs with inflammatory bowel disease. FEMS Microbiol. Ecol. 2008, 66, 579–589. [Google Scholar] [CrossRef] [PubMed]
- Suchodolski, J.S.; Xenoulis, P.G.; Paddock, C.G.; Steiner, J.M.; Jergens, A.E. Molecular analysis of the bacterial microbiota in duodenal biopsies from dogs with idiopathic inflammatory bowel disease. Vet. Microbiol. 2010, 142, 394–400. [Google Scholar] [CrossRef] [PubMed]
- Suchodolski, J.S.; Markel, M.E.; Garcia-Mazcorro, J.F.; Unterer, S.; Heilmann, R.M.; Dowd, S.E.; Kachroo, P.; Ivanov, I.; Minamoto, Y.; Dillman, E.M.; et al. The faecal microbiome in dogs with acute diarrhoea and idiopathic inflammatory bowel disease. PLoS ONE 2012, 7, e51907. [Google Scholar] [CrossRef] [PubMed]
- Rossi, G.; Pengo, G.; Caldin, M.; Piccionello, A.P.; Steiner, J.M.; Cohen, N.D.; Jergens, A.E.; Suchodolski, J.S. Comparison of microbiological, histological, and immunomodulatoryparameters in response to treatment with either combination therapy with prednisone and metronidazole or probiotic VSL#3 strains in dogs with idiopathic inflammatory bowel disease. PLoS ONE 2014, 9, e94699. [Google Scholar]
- Honneffer, J.B.; Minamoto, Y.; Suchodolski, J.S. Microbiota alterations in acute and chronic gastrointestinal inflammation of cats and dogs. World J. Gastroenterol. 2014, 20, 16489–16497. [Google Scholar] [CrossRef] [PubMed]
- Vazquez-Baeza, Y.; Hyde, E.R.; Suchodolski, J.S.; Knight, R. Dog and human inflammatory bowel disease rely on overlapping yet distinct dysbiosis networks. Nat. Microbiol. 2016, 1, 16177. [Google Scholar] [CrossRef] [PubMed]
- AlShawaqfeh, M.K.; Wajid, B.; Minamoto, Y.; Markel, M.; Lidbury, J.A.; Steiner, J.M.; Serpedin, E.; Suchodolski, J.S. A dysbiosis index to assess microbial changes in faecal samples of dogs with chronic inflammatory enteropathy. FEMS Microbiol. Ecol. 2017, 93, fix136. [Google Scholar] [CrossRef] [PubMed]
- Pilla, R.; Suchodolski, J.S. The Role of the Canine Gut Microbiome and Metabolome in Health and Gastrointestinal Disease. Review. Front. Vet. Sci. 2020, 6, 498. [Google Scholar] [CrossRef] [PubMed]
- Herstad, K.M.V.; Trosvik, P.; Haaland, A.H.; Haverkamp, T.H.A.; de Muinck, E.J.; Skancke, E. Changes in the fecal microbiota in dogs with acute hemorrhagic diarrhea during an outbreak in Norway. J. Vet. Intern. Med. 2021, 35, 2177–2186. [Google Scholar] [CrossRef] [PubMed]
- Zannoni, A.; Pietra, M.; Gaspardo, A.; Accorsi, P.A.; Barone, M.; Turroni, S.; Laghi, L.; Zhu, C.; Brigidi, P.; Forni, M. Non-invasive Assessment of Fecal Stress Biomarkers in Hunting Dogs During Exercise and at Rest. Front. Vet. Sci. 2020, 7, 126. [Google Scholar] [CrossRef] [PubMed]
- Arpaia, N.; Campbell, C.; Fan, X.; Dikiy, S.; van der Veeken, J.; deRoos, P.; Liu, H.; Cross, J.R.; Pfeffer, K.; Coffer, P.J. Metabolites produced by commensal bacteria promote peripheral regulatory T-cell generation. Nature 2013, 504, 451–455. [Google Scholar] [CrossRef] [PubMed]
- Cherrington, C.A.; Hinton, M.; Pearson, G.R.; Chopra, I. Short-chain organic acids at pH 5.0 kill Escherichia coli and Salmonella spp. without causing membrane perturbation. J. Appl. Bacteriol. 1991, 70, 161–165. [Google Scholar] [CrossRef] [PubMed]
- Ziese, A.L.; Suchodolski, J.S. Impact of changes in gastrointestinal microbiota in canine and feline digestive diseases. Vet. Clin. N. Am. Small Anim. Pract. 2021, 51, 155–169. [Google Scholar] [CrossRef] [PubMed]
- Drolet, R.; Fairbrother, J.M.; Vaillancourt, D. Attaching and effacing Escherichia coli in a goat with diarrhea. Can. Vet. J. 1994, 35, 122–123. [Google Scholar] [PubMed]
- Hammermueller, J.; Kruth, S.; Prescott, J.; Gyles, C. Detection of toxin genes in Escherichia coli isolated from normal dogs and dogs with diarrhea. Can. J. Vet. Res. 1995, 59, 265–270. [Google Scholar] [PubMed]
- Dubreuil, J.D.; Isaacson, R.E.; Schifferli, D.M. Animal enterotoxigenic Escherichia coli. EcoSal Plus 2016, 7, 10–1128. [Google Scholar] [CrossRef] [PubMed]
- Wetterwik, K.J.; Trowald-Wigh, G.; Fernström, L.L.; Krovacek, K. Clostridium difficile in faeces from healthy dogs and dogs with diarrhea. Acta Vet. Scand. 2013, 55, 23. [Google Scholar] [CrossRef] [PubMed]
- Lenoir, M.; Martin, R.; Torres-Maravilla, E.; Chadi, S.; Gonzalez-Davila, P.; Sokol, H.; Langella, P.; Chain, F.; Bermudez-Humaran, L.G. Butyrate mediates anti-inflammatory effects of Faecalibacterium prausnitzii in intestinal epithelial cells through Dact3. Gut Microbes 2020, 12, 1826748. [Google Scholar] [CrossRef] [PubMed]
Components | Quantity (mg) |
---|---|
FOS | 250.00 |
Inulin | 180.00 |
Tyndallized Lactobacillus reuteri DSM 32203 | 100.00 |
Polyphenols | 120.00 |
Microencapsulated butyric acid | 200.00 |
(A) Control Group | ||||
Dogs | Age (Years) | Sex | Body Weight (kg) | Body Condition Score (BCS) |
Damon | 7 | M | 28.00 | 4 |
Deah | 5 | F | 21.40 | 3 |
Fiona | 2 | F | 22.50 | 4 |
Quest | 10 | M | 22.90 | 4 |
Nebula | 2 | F | 22.60 | 4 |
Grace | 2 | F | 20.00 | 4 |
George | 2 | M | 24.30 | 4 |
Double | 5 | F | 20.00 | 4 |
Domitilla | 5 | F | 20.00 | 3 |
Fangio | 2 | M | 25.30 | 3 |
(B) Microbiotal Group | ||||
Dogs | Age (Years) | Sex | Body Weight (kg) | Body Condition Score (BCS) |
Gaston | 8 | M | 26.40 | 3 |
Jolie | 7 | F | 19.10 | 5 |
Desire | 5 | F | 20.50 | 4 |
Anastasia | 9 | F | 22.20 | 4 |
Gail | 2 | M | 23.60 | 3 |
Alex | 9 | M | 26.50 | 4 |
Griffith | 2 | F | 20.40 | 3 |
Smokie | 4 | M | 20.10 | 4 |
Ivon | 7 | F | 17.90 | 3 |
Ferguson | 2 | M | 25.30 | 4 |
Analytical Components | Percentage (%) |
---|---|
Dry matter | 62.40 |
Crude protein | 24.90 |
Crude fats | 29.50 |
Raw ash | 1.90 |
Carbohydrates | 6.20 |
Raw cellulose | 0.01 |
Metabolizable energy (Kcal/Kg) | 3800.00 |
Analytical Components | Percentage (%) |
---|---|
Crude protein | 28.00 |
Raw fiber | 2.60 |
Crude fats | 18.00 |
Raw ash | 7.50 |
Calcium | 1.60 |
Phosphorus | 1.00 |
Omega 3 fatty acids | 0.50 |
Omega 6 fatty acids | 1.70 |
Metabolizable energy (Kcal/Kg) | 4170.00 |
Analytical Components | Percentage (%) |
---|---|
Crude protein | 9.00 |
Crude fats | 1.22 |
Raw fiber | 0.30 |
Raw ash | 6.00 |
(A) Control Group | |||
Dogs | Energy Requirements | BWild (g/d) | Barf Artic Sport (g/d) |
Damon | 1357.00 | 340.00 | 350.00 |
Deah | 1040.00 | 261.00 | 250.00 |
Fiona | 1098.00 | 275.00 | 250.00 |
Quest | 1193.00 | 299.00 | 350.00 |
Nebula | 1136.00 | 285.00 | 250.00 |
Grace | 1040.00 | 261.00 | 250.00 |
George | 1267.00 | 317.00 | 350.00 |
Double | 1079.00 | 270.00 | 250.00 |
Domitilla | 981.00 | 246.00 | 250.00 |
Fangio | 1357.00 | 340.00 | 350.00 |
(B) Microbiotal Group | |||
Dogs | Energy Requirements | BWild (g/d) | Barf Artic Sport (g/d) |
Gaston | 1303.00 | 326.00 | 350.00 |
Jolie | 1001.00 | 251.00 | 250.00 |
Desire | 1060.00 | 266.00 | 250.00 |
Anastasia | 1136.00 | 285.00 | 250.00 |
Gail | 1193.00 | 299.00 | 350.00 |
Alex | 1303.00 | 326.00 | 350.00 |
Griffith | 1001.00 | 251.00 | 250.00 |
Smokie | 1136.00 | 285.00 | 350.00 |
Ivon | 981.00 | 246.00 | 250.00 |
Ferguson | 1230.00 | 308.00 | 350.00 |
qPCR Primers | Sequence (5′–3′) | Target | Annealing (°C) |
---|---|---|---|
Forward | GAAGGCGGCCTACTGGGCAC | Faecalibacterium | 60 |
Reverse | GTGCAGGCGAGTTGCAGCCT | ||
Forward | GGGCTCAACMCMGTATTGCGT | Fusobacteria | 51 |
Reverse | TCGCGTTAGCTTGGGCGCTG | ||
Forward | TCTGATGTGAAAGGCTGGGGCTTA | Blautia | 56 |
Reverse | GGCTTAGCCACCCGACACCTA | ||
Forward | CCTACGGGAGGCAGCAGT | Total bacteria | 59 |
Reverse | ATTACCGCGGCTGCTGG | ||
Forward | CAGACGGGGACAACGATTGGA | Turicibacter | 63 |
Reverse | TACGCATCGTCGCCTTGGTA | ||
Forward | GTTAATACCTTTGCTCATTGA | E. coli | 55 |
Reverse | ACCAGGGTATCTAATCCTGTT | ||
Forward | AGTAAGCTCCTGATACTGTCT | C. hiranonis | 50 |
Reverse | AGGGAAAGAGGAGATTAGTCC | ||
Forward | TTATTTGAAAGGGGCAATTGCT | Streptococcus | 54 |
Reverse | GTGAACTTTCCACTCTCACAC |
(A) Control Group | ||
Dogs | Fecal Score—Beginning of the Study | Fecal Score—End of the Study |
Damon | 2 | 6 |
Deah | 2 | 6 |
Fiona | 2 | 6 |
Quest | 2 | 5 |
Nebula | 2 | 6 |
Grace | 2 | 6 |
George | 2 | 5 |
Double | 2 | 6 |
Domitilla | 2 | 5 |
Fangio | 2 | 5 |
(B) Microbiotal Group | ||
Dogs | Fecal Score—Beginning of the Study | Fecal Score—End of the Study |
Gaston | 2 | 4 |
Jolie | 2 | 4 |
Desire | 2 | 4 |
Anastasia | 2 | 4 |
Gail | 2 | 4 |
Alex | 4 | 6 |
Griffith | 2 | 4 |
Smokie | 2 | 4 |
Ivon | 2 | 4 |
Ferguson | 2 | 4 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Belà, B.; Crisi, P.E.; Pignataro, G.; Fusaro, I.; Gramenzi, A. Effects of a Nutraceutical Treatment on the Intestinal Microbiota of Sled Dogs. Animals 2024, 14, 2226. https://doi.org/10.3390/ani14152226
Belà B, Crisi PE, Pignataro G, Fusaro I, Gramenzi A. Effects of a Nutraceutical Treatment on the Intestinal Microbiota of Sled Dogs. Animals. 2024; 14(15):2226. https://doi.org/10.3390/ani14152226
Chicago/Turabian StyleBelà, Benedetta, Paolo Emidio Crisi, Giulia Pignataro, Isa Fusaro, and Alessandro Gramenzi. 2024. "Effects of a Nutraceutical Treatment on the Intestinal Microbiota of Sled Dogs" Animals 14, no. 15: 2226. https://doi.org/10.3390/ani14152226