1. Introduction
Shrimps have historically been among the most widely traded aquatic commodities, constituting 17% of the global value of all aquatic product exports in 2022, playing a crucial role in the aquaculture sector of many countries [
1,
2,
3]. The
Kuruma shrimp,
Penaeus japonicus, is a key species in both trade and aquaculture, extensively cultivated in the Indo-West Pacific region, including China, Australia, the Philippines, and Japan, due to its high commercial value and palatable flavor [
4,
5,
6,
7]. With increasing market demand and a decline in wild catch, aquaculture has become pivotal in meeting the demand for this high-valued seafood [
8,
9].
The nutritional aspects comprise one of the most critical components in aquaculture production, as these influence biological performance and enterprise profitability [
10]. In the early stages of
P. japonicus cultivation, commonly used live foods include frozen squids, oysters, clams, mussels, and polychaetes. These feeds are rich in EPA, DHA, and protein, making them easily digestible and absorbed by the shrimp, thereby promoting their growth [
11,
12,
13]. However, scaling up cultivation has raised challenges with live feed supply and biosecurity, limiting industry growth [
14]. Consequently, to enable a scientific, high-quality, and sustainable shrimp culture, researchers employed refined test diets to reveal the nutritional requirements of
P. japonicus for adequate proteins, lipids, carbohydrates, minerals, and vitamins, like other aquatics [
15,
16]. Building upon previous research on the nutritional requirements of
P. japonicus, researchers have extensively investigated the effects of varying nutrient compositions [
17,
18,
19] and nutrient sources [
8,
9,
20,
21] on the growth, immunity, and digestion of
P. japonicus. These studies have contributed to the formulation of numerous compounded diets for
P. japonicus, thereby supporting the rapid expansion of the Kuruma shrimp culture. Nevertheless, some studies have found that shrimp-fed formulated feeds grow more slowly than those fed live feeds during the juvenile stage of the species [
22,
23]. However, comparative studies on live feed and formulated feed for shrimp are still limited.
A vast number of analytical techniques and monitoring methods have shed light on the nutritional performance of experimental diets and feeding regimes designed for aquatic organisms at different life stages growing under a variety of production systems [
10]. As shrimp are generally reared in large groups in water, macro and micro methods have been used to study their growth, nutrition, and molting under group-rearing conditions [
24,
25,
26,
27]. However, some results, especially for metrics such as feed-influenced survival rates, can be inaccurate due to uncontrolled intraspecific interactions, including cannibalism of the shrimp [
28]. Aquatic organism studies have employed individual-rearing methods to reduce the impact of confounding factors like group competition and enable the accurate monitoring of each individual’s growth and feeding performance, thus improving the accuracy of experimental results [
29,
30,
31,
32]. In shrimp, researchers have employed individual-rearing methods to collect growth and feeding information of individual shrimp, which has been used for the precise evaluation of feed efficiency traits. This approach has been successfully applied in breeding programs for
Litopenaeus vannamei and
Fenneropenaeus chinensis [
27,
31,
33]. However, there is a lack of research evaluating shrimp feed using individual-rearing methods, particularly concerning the growth and feed of
P. japonicus.
This study employed the individual-rearing method to compare the effects of live feed (sandworms Perinereis aibuhitensis) and formulated pellet diets on development and feeding performance of P. japonicus and analyze their individual variation. A feeding trail with three different feeding regimes was conducted with shrimp fed either sandworms exclusively, a formulated pellet diet only, or a mix of a sandworm-formulated diet. The objectives were to (1) use the individual-rearing method to assess the effects of sandworms, formulated diet, and mixed feeding on P. japonicus growth, digestion, immunity, intestine microbiota, and feeding behavior; (2) Use the individual-rearing method to collect more precise data on the growth and feeding of P. japonicus and to confirm that the strategy can be used to evaluate the growth and feed of this species.
2. Materials and Methods
2.1. Animals Acquisition
All P. japonicus shrimps were obtained from a full-sib family in an aquaculture farm in Dongshan (Zhangzhou, China) in November 2022 and acclimated in environmentally controlled small tanks with a recirculating water system with aerated seawater at 26 °C and salinity of 31‰ prior to experimentation in the National Observation and Research Station for the Taiwan Strait Marine Ecosystem, Dongshan Swire Marine Station (Zhangzhou, China). The in situ seawater supply system provided filtered, flowthrough seawater, and shrimps were fed the right amount of bait daily at 17:00.
2.2. Culture System and Experimental Design
The individual-rearing system was used during the experiment. There were 3 independent tanks (116 cm × 36 cm × 15 cm) with a water volume of about 62 L per tank. Twenty-four separate spaces (145 mm × 120 mm × 150 mm) were created in each tank using plastic plates with holes (
Figure 1A). The three tanks had a common experimental environment, except for their daily diets, since pipes connected them in series and used pumps to support an adequate exchange in water flow to create a stable internal circulation system (
Figure 1B). The temperature was maintained at 26.0 °C ± 0.5 °C, and seawater was exchanged by 80% daily.
Prior to the experiment, each tank was randomly loaded with 20 healthy shrimp (2.16 ± 0.18 g in body weight; the remaining 4 separate spaces were used to place heating rods and air stones). After being placed in the tanks, all shrimps had a one-week adaptation to the experimental environment. The experiment then proceeded for 4 weeks. Dead shrimp and molts were promptly removed. Three diet groups—the first, a diet of 1.2 mm diameter formulated pellet diets (group F) purchased from Fujian Haida Feed Co., Ltd. (Zhangzhou, China), known for its high protein content, widely used by local farmers, and can remain stable in pellet form for at least one day; the second, live food (P. aibuhitensis, group N) purchased from an aquaculture farm in Dongshan (Zhangzhou, Fujian); the third, a 1:1 mixture of pellet diets and live food (by wet weight, group NF)—were created during the experiment. These diets were hand-fed to different tanks at 17:30 each day according to these shrimps’ inactive habits. Taking each tank as a unit, feed for each individual was stored independently. During the experiment, an appropriate feed dose per meal was ensured for their apparent satiation, and the amount of daily feed intake of the shrimp was equal to the weight difference between the feed supply and the remaining diets. The remaining bio-diets were also recorded in the same way. Based on previous breeding and experimental experiences, the live food was all fresh P. aiibuhitensis, which was disinfected with iodophor to eliminate potential pathogens and washed with clean water before feeding. The remaining pellet diets were thoroughly dried and weighed. The number of shrimps in each group was counted at the end of the experiment to determine each group’s survival rate.
Following 24 h of starvation after the feeding trial, the animals were weighed individually. Subsequently, 15 shrimp were then randomly taken from each tank, and the entire body surface was disinfected using some drenched cotton dipped in 75% ethanol. The shrimps were then dissected on ice to collect the hepatopancreas, intestine, and muscle samples, and all of these samples were stored at −80 °C for analysis of the enzyme and immunity activities. In addition, the pellet diets and live foods were collected to analyze the nutrient composition.
2.3. Growth Performance
Body weight (BW) was recorded for all animals at the start (IBW) and end (FBW) of the experiment, respectively. During the experiment, the molting time was recorded to calculate the molt cycle of every animal. The daily feed intake (DFI) and feed intake (FI) of each animal were also recorded. The body weight gain (BWG), body weight gain rate (WGR), specific growth rate (SGR), feed efficiency ratio (FER), and protein efficiency rate (PER) were calculated as follows:
2.4. Analysis of Enzyme Activity and Antioxidant Capacity
The hepatopancreas was used to analyze the immunological, digestive, and antioxidant enzymes. The total antioxidant capacity (T-AOC and colorimetry), total superoxide dismutase (T-SOD and hydroxylamine method), malondialdehyde (MDA and thiobarbituric acid (TBA)), catalase (CAT and ammonium molybdate method), glutathione Peroxidase (GSH-Px and colorimetric method), reduced glutathione (GSH and microplate method), alkaline phosphatase (AKP and visible light colorimetry), phenoloxidase (PO and competition method), lysozyme (LZM and turbidimetry), lipase (LPS and colorimetry), Trypsin (colorimetry), and α-amylase (AMS and starch-iodine colorimetry) were measured using respective kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China) according to the manufacturer’s instructions.
2.5. Dietary Proximate Composition Analysis
The proximate composition of the diets was evaluated according to the standard procedure published in AOAC [
34]. In brief, moisture was determined with the drying method at 105 °C, crude protein (nitrogen × 6.25) was analyzed by the Kjeldahl method after acid digestion, and crude lipid was determined by Soxhlet extraction.
2.6. Dietary Amino Acid and Fatty Acids Composition
Freeze-dried diet samples (approximately 100 mg) were put into tubes with 25 mL trichloroacetic acid (5 g/100 mL) and then kept at 4 °C for 2 h. Approximately 0.4 mL of the supernatant was collected after centrifugation (15,000 rmp, 30 min, 4 °C) and filtered through a 0.22 μm membrane, and then analyzed for free amino acid composition using an L-8900 amino acid analyzer (Hitachi, Japan).
The diet samples (approximately 200 mg) were added to a 10 mL glass tube with 3 mL chloroform/methanol (2:1 by volume). The extracted fats were mixed with 2 mL KOH-methanol (c = 0.5 mol/L) and reacted in 50 °C water for 10 min. After cooling for 3 min, 2 mL of BF3-methanol solution (w = 10%) was added to the mixture and incubated in a water bath at 80 °C for 20 min. Then, 1 mL n-hexane and 2 mL saturated NaCl solution were added to the above mixture. The solution was shaken vigorously to promote layer separation and centrifuged at 1500 rpm for 5 min, and the supernatant was filtered through a 0.22 μm ultrafiltration membrane and collected in a 1.5 mL ampoule bottle. Finally, the obtained fatty acid methyl esters were analyzed using a GC2010 plus gas chromatograph (Shimadzu, Japan). Methyl tridecanoate (Sigma, St. Louis, MO, USA) served as the internal standard. The results were presented as the relative percentages of each fatty acid (% total fatty acids).
2.7. Intestinal Microbial Analysis
Total bacterial DNA from all shrimp intestine samples was extracted by the CTAB method. The V4–V5 region of 16S rRNA genes was amplified by PCR using primers 515F (5′GTGCCAGCMGCCGCGGTAA 3′) and 806R (5′CCGTCAATTCCTTTGAGTTT 3′). Sequencing libraries were generated using a TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, Inc., San Diego, USA). The library was checked with Qubit, and a real-time PCR was used for quantification. A bioanalyzer was also used for size distribution detection. Quantified libraries were pooled and sequenced on Illumina platforms according to an effective library concentration and the amount of data required. The sequences obtained in this study are available in the NCBI SRA database with the accession number PRJNA1059777.
Quality filtering of the raw tags was performed using the fastp (Version0.23.1) software to obtain high-quality clean tags [
35]. The tags were compared with the reference database (Silva database (16S/18S),
https://www.arb-silva.de/ (accessed on 24 February 2023); Unite Database (ITS),
https://unite.ut.ee/ (accessed on 24 February 2023)) using UCHIME Algorithm (
http://www.drive5.com/usearch/manual/uchime_algo.html (accessed on 24 February 2023)) to detect chimera sequences, and then the chimera sequences were moved and the effective tags were finally obtained [
36]. For the obtained Effective Tags, denoise was performed with the DADA2 module in the QIIME2 software (Version QIIME2-202006) to obtain initial ASVs (Amplicon Sequence Variants), and then ASVs with an abundance of less than 5 were filtered out [
37]. Species annotation was performed using the QIIME2 software based on the silva database (
https://www.arb-silva.de/ (accessed on 24 February 2023)), and the taxa relative abundances of community compositions in samples were identified at different levels (phylum, class, order, family, and genus), respectively, and displayed with R software (version 4.2.3).
Alpha diversity indices, including Chao1, Shannon indexes, Simpson, and Dominance, were calculated by the QIIME2 software. The beta diversity among bacterial communities was evaluated using un-weighted Unifrac distances and visualized via non-metric multi-dimensional scaling (nMDS), which was plotted in R software. In addition, we screened ASVs with a relative abundance greater than 0.1% and calculated microbial co-occurrence network metrics using the WGCNA package, and the co-occurrence networks were assessed using the R package igraph 1.2.6 and visualized using Gephi 0.10.
2.8. Statistical Analysis
All of the statistical analyses were performed using SPSS software (version 21.0). After verifying normality and homogeneity of variances using Levene’s test, one-way ANOVA was used to evaluate the effects of different diets. Differences between treatments were compared using Tukey’s test when the effect was significant (p < 0.05). Differences are denoted as significant at p < 0.05, very significant at p < 0.01, and extremely significant at p < 0.001. Levene’s test for equality of variances was performed to ensure homogeneity of variances. The relationships between the final weight, specific growth rate, protein efficient rate, and average daily food intake versus the initial weight in P. japonicus and the relationship between the feed conversion ratio and daily feed intake versus individuals’ specific growth rate were calculated using Pearson’s correlation analysis. Results are shown as the mean ± standard deviation (S.D.).
5. Conclusions
P. japonicus requires balanced nutrition for optimum growth. Despite the high protein content in commercial feed, it may not sufficiently fulfill all growth requirements. Our findings demonstrate that live food enhances shrimp growth, digestion, and immunity, and even a small addition of live food to the commercial diet significantly improves growth and immune function in P. japonicus. To our knowledge, this study is the first detailed investigation into how live and formulated feeds differently influence the intestinal microbiota composition in Kuruma shrimp (P. japonicus). The results indicate that feeding live feed increases the relative abundance of beneficial bacteria while decreasing opportunistic pathogens compared to formulated feed. Additionally, complementary feeding of live feed promoted a more tightly packed and complex network of intestinal flora in shrimp, enhancing their response to complex environmental changes.
Individual-rearing has proven effective in assessing the growth, feeding performance, and feed evaluation of P. japonicus. This approach allows for detailed growth and feeding data collection from individual shrimp, reducing the influence of non-dietary factors. Consequently, it offers a novel method for feed assessments and enables the exploration of individual growth and feeding variations. Additionally, the daily feed intake of P. japonicus shows consistent cyclical changes aligned with their molting cycle. These insights suggest that the nutritional profile of commercial feed is insufficient compared to live food, and the strategic inclusion of live food can significantly improve culture efficiency. The method of individual-rearing can effectively evaluate the growth and feeding performance of P. japonicus and conduct feed evaluation studies. Adjusting the diet based on the shrimp’s molting cycle could also optimize feed usage and enhance culture outcomes.