Next Article in Journal
Phenotypic and Genetic Analyses of Mastitis, Endometritis, and Ketosis on Milk Production and Reproduction Traits in Chinese Holstein Cattle
Previous Article in Journal
Association between IGF-1 and IGFBPs in Blood and Follicular Fluid in Dairy Cows Under Field Conditions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 16
10.3390/ani14162371
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

A New Species of Murina (Chiroptera: Vespertilionidae) from Yunnan, China †

by
Xin Mou
1,
Yishun Qian
1,
Mei Li
2,
Biao Li
2,
Xiong Luo
2 and
Song Li
1,3,*
1
Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650223, China
2
Conservation Area Management Committee of Guanyin Shan Provincial Nature Reserve, Yuanyang 662400, China
3
Yunnan Key Laboratory of Biodiversity Information, Kunming Institute of Zoology, Chinese Academy of Sciences, Kunming 650201, China
*
Author to whom correspondence should be addressed.
†
urn:lsid:zoobank.org:act:4A2FE176-DF69-417B-BFFF-CFBE02C10B7D.
Animals 2024, 14(16), 2371; https://doi.org/10.3390/ani14162371
Submission received: 2 July 2024 / Revised: 2 August 2024 / Accepted: 9 August 2024 / Published: 15 August 2024
(This article belongs to the Section Wildlife)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

In this paper, a new Murina species is described from Yunnan, China, based on morphological and molecular evidence. Genetically, the new species is most closely related to M. chrysochaetes. Morphologically, the new species can be distinguished from M. chrysochaetes and all other congeners by a combination of morphological characteristics. The discovery of the new species brings the total number of recognized species of the genus Murina to 42, of which 22 occur in China.

Abstract

During an examination of various specimens previously collected from different locations and times, we discovered seven Murina specimens that had been collected in May 2023 from the Guanyinshan Provincial Nature Reserve, Yuanyang, Yunnan, China. Based on the assessment of morphological characteristics and molecular data analysis, these specimens were determined to represent a previously unidentified species, designated Murina yuanyang sp. nov.

1. Introduction

Members of the genus Murina, belonging to the subfamily Murininae within the family Vespertilionidae, are characterized by distinct tubular nostrils that extend laterally from the muzzle. In terms of dentition, they possess two well-developed upper and lower premolars, with a tendency for reduced complexity in molar structures [1]. Corbet and Hill [2] classified Murina into two groups, the ‘suilla-group’ and ‘cyclotis-group’, based on the relative size of the crown area of canines, the first and second upper premolars, and the position of the incisors [2,3,4,5,6,7,8,9,10,11,12]. However, these two morphogroups do not represent separate phylogenetic lineages and will therefore be referred to hereafter as the ‘suilla-type’ and the ‘cyclotis-type’. In contrast, the genus Harpiocephalus can be distinguished from Murina by a combination of body size (forearm length usually greater than 44.1 mm) and craniodental structure (the skull is more heavily built with the rostrum relatively shorter, broader, more abrupt and truncated anteriorly, and the third upper molar (M3) is highly reduced) [13]. Harpiola and Murina can also be distinguished based on the following diagnostic characteristics: the heights of the inner (I2) and outer upper incisors (I3) each measure two-thirds the height of the upper canines (C1) (vs. half in Murina); the height of the upper toothrow gradually decreases sequentially from C1 to the first premolar (P2) and then to the second premolar (P4), with each tooth maintaining similar volumes (vs. a noticeably smaller P2 compared to the other two teeth in Murina); the height and volume of the lower canine (C1), first premolar (P2), and second premolar (P4) are similar (vs. significantly smaller P2 than C1 in Murina); and C1 is strongly bifid with well-developed additional cusps (vs. very small secondary cingular cusps in Murina) [14,15].
Simmons [16] confirmed the presence of 17 species within the Murina genus. Since then, enhanced capture techniques and advances in molecular approaches have led to the description of various new species within the genus [1,4,5,6,7,8,9,10,11,12,14,17,18,19,20,21]. At present, 41 species are listed in the Global Biodiversity Information Facility (GBIF), with 21 species distributed in China according to the Catalogue of Mammals in China [22].
During an examination of various specimens previously collected from different locations and times, we identified seven Murina specimens collected in May 2023 from the Guanyinshan Provincial Nature Reserve, Yuanyang, Yunnan, China, all belonging to the family Vespertilionidae. Morphologically, the specimens exhibited external characteristics typical of the Murininae subfamily, including distinct tubular nostrils that are separated from each other and protrude laterally from the muzzle. Their smaller size, atypical for the genus Harpiocephalus, and distinct dental proportions (height of I2 and I3 less than half the height of C1 and height and size of P2 significantly smaller than C1 and P4), atypical for the genus Harpiola, suggested an affiliation with the genus Murina. However, their unique morphological features were inconsistent with any currently identified Murina species in China. Thus, based on morphological characteristics and molecular data, these specimens were identified as a new species, described herein as Murina yuanyang sp. nov.

2. Materials and Methods

2.1. Sample Collection

Specimens of Murina yuanyang sp. nov. include two adult males and five adult females, collected in the Guanyinshan Provincial Nature Reserve, Yuanyang, Yunnan, China, in May 2023. The voucher specimens are stored at the Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ, CAS), Kunming, China, under field collection numbers KIZ20230415, 20230424, 20230426, 20230449, 20230450, 20230492, and 20230498.

2.2. Measurements

External measurements were taken using a digital caliper accurate to 0.01 mm, measuring 10 indices, including head–body length (HB): from tip of snout to anus; tail length (TL): from anus to tip of tail; ear length (E): from lower edge of external auditory meatus to tip of pinna; hindfoot length (HF): from extremity of heel to tip of longest toe, not including claws; tibia length (TIB): from knee joint to ankle; forearm length (FA): from elbow to carpus with wings folded; and length of metatarsal of second, third, fourth, and fifth digits (MET2, MET3, MET4, and MET5, respectively): from carpus to end of respective metacarpals. Body weight (WT) was measured using an electronic scale accurate to 0.1 g.
Cranial and dental measurements were taken with a digital caliper to the nearest 0.01 mm under a stereomicroscope by Xin Mou in three independent measurements and finally averaged, with craniodental measurement definitions shown in Table 1.

2.3. Molecular Analyses

Total genomic DNA was extracted from muscle samples using the TSINGKE TSP202-50 Trelief ® Hi-Pure Animal Genomic DNA Kit (Tsingke Biotech, Beijing, China) following the manufacturer’s protocols. The mitochondrial cytochrome oxidase subunit 1 (COI) gene sequence was amplified and sequenced using the following primer pair: BIF: TCAACCAACCACAAAGACATTGGCAC; BIR: TAGACTTCTGGGTGGCCAAAGAATCA. Polymerase chain reaction (PCR) was conducted in a total volume of 50 μL, including template DNA (1 μL), each primer (10 pM, 2 μL), and GOLD mix (Green-TSINGKE TSE101) (45 μL). The PCR procedure consisted of initial denaturation at 94 °C for 2 min, 5 cycles with denaturation at 94 °C for 30 s, annealing at 50 °C for 40 s, extension at 72 °C for 1 min, 35 cycles with denaturation at 94 °C for 30 s, annealing at 55 °C for 40 s, extension at 72 °C for 1 min, with a final extension at 72 °C for 10 min, and 4 °C for renaturation. The PCR products were analyzed by agarose gel electrophoresis and purified using the Trelief® DNA Gel Extraction Kit (Tsingke Biotech, Beijing, China). Finally, purified samples were sequenced using an ABI 3730XL DNA Analyzer (USA) at Tsingke Biotech (Beijing, China). The sequencing files were checked and assembled using SeqMan in Lasergene v7.1 (DNASTAR Inc., Madison, WI, USA).
The COI sequences were compared to 32 subfamily Murininae species sequences downloaded from the National Center for Biotechnology Information (NCBI) database using PhyloSuite v1.2.2 [23], with their accession numbers listed in Table 2. All sequences were aligned using the ClustalW algorithm [24] with default parameters in MEGA11 [25] and were truncated to 657 bp. The uncorrected p-distances were calculated using the pairwise distance parameter in the distance module in MEGA11 with a bootstrap procedure of 1000 replicates, employing the pairwise deletion option to remove ambiguous positions. ModelFinder [26] was used to select the best-fit model based on Bayesian information criterion (BIC). Phylogenetic reconstruction was carried out using Bayesian inference (BI) under the GTR+F+I+G4 model with MrBayes v3.2.6 [27] in PhyloSuite v1.2.2 [24], employing a partition model with two parallel runs and 2,000,000 generations, discarding the initial 25% of sampled data as burn-in. Maximum-likelihood phylogenies were inferred using IQ-TREE [28] under the TPM2u+F+R3 model with 5000 ultrafast bootstraps [29] and the Shimodaira-Hasegawa-like approximate likelihood ratio test [30].

3. Results

3.1. Molecular Phylogenetic

We compared the COI sequences of six specimens (one was not sequenced) with those of 32 subfamily Murininae species (Kerivoula kachinensis and Myotis muricola were used as the outgroup), downloaded from the NCBI database. The species and their GenBank accession numbers are listed in Table 2. All novel sequences were deposited in the NCBI GenBank database under accession numbers PQ179688-179693.
The reconstructed phylogenetic tree revealed that all Murina yuanyang sp. nov. formed a clade and a distinct lineage sister to M. chrysochaetes with a posterior probability of 1 and bootstrap value of 100 (Figure 1). Uncorrected p-distances calculated between these two species ranged from 2.7% to 3.0% (Table 3).

3.2. Systematic Description

Murina yuanyang sp. nov.
Holotype: Field number KIZ20230424, adult female, collected on 21 May 2023. The mitochondrial COI nucleotide sequence was submitted to GenBank under accession number PQ179689.
Type locality: Pinghe, Xiaoxinjie Town, Yuanyang County, Yunnan Province, China (22.990097° N, 102.990097° E, 2434 m).
Paratype: Field number KIZ20230450, adult female, collected in Pinghe, Xiaoxinjie Township, Yuanyang County, Yunnan Province, China (22.990097° N, 102.990097° E, 2434 m) on 22 May 2023. Field number KIZ20230415, adult male, collected in Pinghe, Xiaoxinjie Township, Yuanyang County, Yunnan Province, China (22.991851° N, 103.002188° E, 2412 m) on 21 May 2023. The mitochondrial COI nucleotide sequence of KIZ20230415 was submitted to GenBank under accession number PQ179688.
Etymology: The name yuanyang refers to the type locality of the species.
Measurements: Measurements of the type specimen are shown in Table 4.
Diagnosis: Small-sized Murina species, FA 27.66–30.51 mm and GTL 13.44–14.16 mm (Table 4). Elongated tubular nostrils; third, fourth, and fifth finger metacarpals roughly equal in size; tail vertebrae slightly free at tip; plagiopatagium attached at about one-third from base of claw to base of toe, near base of claw (Figure 2). Fur on back glossy, overall dark golden with deep brown, with clearly demarcated color bands; ventral fur gray-white, with golden color on both sides of chest (Figure 2). Sagittal crest absent, lambdoidal crest not prominent (Figure 3); in lateral view, skull appears slightly elongated with slightly oval braincase, gradually rising with gentle slope from snout to cranial vertex (Figure 3(A3,B3)); palatine wide without distinct concavity (Figure 3(A2,B2,C2)). I2 located in front of I3, clearly visible from side; noticeable gap between I3 and C1; height of P2 less than half that of C1 and P4 (Figure 3(A3,B3,C3)); crown area of P2 slightly smaller than that of C1, less than half crown area of P4; mesostyle of M1 and M2 slightly developed, M3 reduced (Figure 3(A2,B2,C2)). C1 slightly higher than P4, P2 significantly lower than C1 and P4. Basal area of C1 similar to P4 and more than twice basal area of P2. Lower molars belong to nyctalodont type (Figure 3(A5,B5,C5)).
Description: Body: Small-sized Murina species, HB 31.37–36.34 mm, WT 3.4–4.7 g, FA 27.66–30.51 mm, GTL 13.44–14.16 mm (Table 4). Nostrils tubular, opening sideways and relatively long (Figure 2). Snout darker than nostrils. Ear length 11.85–14.77 mm, overall shape oval, upper part forms rounded arch, not pointed, deep gray in color, color at base slightly lighter than upper part, approaching gray-white. Ear tragus long and pointed, vertical on inside, curved outwards on outside, narrow at top and wider at bottom, reaching approximately half height of ear. Third, fourth, and fifth metacarpals approximately equal in length, second metacarpal slightly shorter than third, fourth, and fifth. Tail 23.89–31.58 mm (Table 4), shorter than head–body length, slightly free at tip (Figure 2). Plagiopatagium attached at about one-third from base of claw to base of toe, near base of claw (Figure 2).
Fur: Dorsal fur of holotype dark gold mixed with deep brown throughout, with four distinct bands of color on hairs. Base dark brown, middle light brown, upper-middle part with narrow dark brown or blackish brown band, top yellow-brown, sometimes golden yellow. Overall color of back appears slightly mottled and uneven. Short golden hairs on forearms and sparse yellow-brown hairs on interdigital membranes. Ventral side gray-white throughout, with base of hairs dark gray to gray and top gray-white. Neck and anal region whiter, with slight golden color on sides of chest. Relatively sparse gray-white hairs with slight sheen on interdigital membranes. Facial hair short, gray-brown mixed with golden yellow. Other specimens exhibit slight variations in dorsal fur color, appearing golden or yellowish, with distribution and characteristics of ventral and other fur similar to holotype (Figure 2).
Skull: Overall skull relatively small, GTL 13.44–14.16 mm. Sagittal crest absent, lambdoid crest prominent. In dorsal view, braincase almost circular; zygomatic arches weak and slender, gradually widening from front to back, with widest point at root of zygomatic arch; posterior margin of skull slightly prominent; slight downward concavity in middle from snout to frontal region. In lateral view, skull appears slightly elongated with slightly oval braincase; height from snout to parietal shows upward trend, with gradually increasing slope from snout to frontal, and gradually decreasing slope from frontal to parietal, resulting in slight depression between snout and frontal, with slight protrusion at frontal; zygomatic arch rises gradually from anterior to posterior. In ventral view, palatine wide without any obvious concavity, ending at midpoint of C1; basisphenoid pits tear-drop shaped, extending posteriorly to anterior half of cochlea. Mandible 8.09–8.69 mm. In lateral view, almost straight between coronoid process and condyle, without any depression, slight concavity between condyle and angle; angle short and wide, lower surface of the mandibular dentary forms obvious depression in front of angle; mental foramina clearly visible (Figure 3).
Dentition: Dental formula: I −   2   3 1   2   3 C 1 1 P M −   2 −   4 −   2 −   4 M = 34 . In maxilla, I2 positioned in front of I3, I2 clearly visible in lateral view; crown area of P2 slightly smaller than that of C1, less than half crown area of P4; species belongs to ‘suilla-type’ based on these characteristics. Upper tooth rows converge slightly anteriorly, with PWC1C1 1.42–1.78 mm and PWM3M3 2.63–2.86 mm. I2 and I3 heights approximately equal, with crown area of I2 approximately half that of I3. I2 with two cusps, smaller secondary cusp located behind primary cusp. Posterior external face of I2 in contact with anterior internal face of I3, with noticeable gap between I3 and C1. C1 and P4 heights approximately equal, C1 slightly elongated and lacking secondary cusps, P4 wider. C1 appears slightly circular when viewed from occlusal perspective, with crown area less than half that of P4. P2 smaller and compressed, wider than long, distinctly oval-shaped, height close to half that of C1 and P4. Mesostyle of M1 and second upper molars (M2) not well developed; paracone, metacone, and protocone well developed, with metacone slightly higher than paracone; trigon basin open and talon well developed, with antero-external valley area significantly smaller than that of postero-external valley. M3 reduced, with only parastyle, paracone, and protocone. Single commissure connecting parastyle and paracone. In mandible, first, second and third lower incisors (I1, I2, and I3) tricuspid and of equal size, but outer cusp of I3 relatively less distinct; slight overlap of outer cusps of I1, I2, and I3; C1 contains pointed cusp on anterior inner margin, which touches outer cusp of I3, making C1 slightly higher than I3 in lateral view, with gradual increase in height from I1 to C1. C1 slightly higher than P4, P2 significantly lower than C1 and P4. Basal area of C1 similar to P4 and more than twice basal area of P2. In lateral view, trigonid of M1 and lower second molar (M2) and M3 clearly tricuspid, with height of metaconid and paraconid approximately two-thirds that of protoconid; talonid of M1 and M2 bicuspid, with entoconid and hypoconid clearly separated from trigonid and lower than metaconid and paraconid, with heights approximately equal to metaconid and paraconid. Talonid of M3 reduced. Lower molars nyctalodont type, with entoconid and hypoconid connected by postcristid (Figure 3).
Comparisons: Based on its dentition, Murina yuanyang sp. nov. clearly belongs to the ‘suilla-type’ (maxillary toothrows clearly convergent anteriorly; I2 anterior to I3; I2 clearly visible from lateral view; crown area of P2 half that of P4) and can be distinguished from all species in the ‘cyclotis-type’. Based on the reconstructed phylogenetic tree, Murina yuanyang sp. nov. formed a monophyletic group with M. chrysochaetes and was distantly related to other species. Therefore, our comparison focuses primarily on species closely related in the phylogenetic tree and on ‘suilla-type’ species lacking COI sequences.
Comparison with M. chrysochaetes: At the molecular level, Murina yuanyang sp. nov. is most closely related to M. chrysochaetes, but exhibits some differences in morphology and cranial structure. Measurement data for FA and TIB show that Murina yuanyang sp. nov. is slightly larger in body size than M. chrysochaetes, and the HB, TL, E, and HF of the female specimens also showed longer HF and E and significantly different HB and TL ratios (HB/TL ratios were 1.23 and 1.67, respectively) compared with IEBR-M6020 and S186699 (both female). In terms of skull size, both male and female Murina yuanyang sp. nov. are slightly smaller than Murina chrysochaetes (values of STOTL, GTL, CBL, ZYW, BCW). From PWC1C1/PWM3M3 and C1C1W/M3M3W, the values of male Murina yuanyang sp. nov. are 0.59 and 0.67, respectively, and female are 0.60 and 0.69, respectively, while the values of S186699 (female) are 0.66 and 0.74, respectively, which is consistent with the observation from the specimen comparison that the maxillary teeth of Murina yuanyang sp. nov. converge more anteriorly than the holotype of Murina chrysochaetes. The value of CPH shows that Murina chrysochaetes has a higher coronoid process. In terms of external morphology, Murina yuanyang sp. nov. has longer tubular nostrils. On the dorsal side, Murina yuanyang sp. nov. is generally dark gold mixed with deep brown, with four color bands on the back, while M. chrysochaetes has a mixture of black and gold stripes and tricolored fur on the back [18]. On the ventral side, Murina yuanyang sp. nov. shows a golden hue on the sides of the thorax, while M. chrysochaetes has golden guard hairs from the thorax to lower abdomen, giving it an overall golden appearance. The wing and tail membranes of Murina yuanyang sp. nov. are black, in contrast to those of M. chrysochaetes, which are brown. Regarding the skull structure, the rostrum of Murina yuanyang sp. nov. is relatively long, with a gentler forehead slope, resulting in a more elliptical skull shape in lateral view. In contrast, the rostrum of M. chrysochaetes is short and the forehead slope is abrupt, producing a round shape in lateral view. The zygomatic arch of Murina yuanyang sp. nov. is thicker and smoother compared to that of M. chrysochaetes, which is thinner and shows a slight concavity. In the mandible, Murina yuanyang sp. nov. has a wider and more robust angle. C1 of Murina yuanyang sp. nov. slightly higher than P4 and basal area of C1 similar to P4, while C1 of M. chrysochaetes is the same height as P4 but exceeds it in basal area. Furthermore, C1 of M. chrysochaetes is recurved, whereas C1 of Murina yuanyang sp. nov. is straighter, with the talons of M1 and M2 more developed (Figure 3 and Figure 4A).
Comparison with M. harpioloides: Murina yuanyang sp. nov. and M. harpioloides show similarities in morphometric data, including WT, HB, TL, and FA; however, the skull and tooth measurements of Murina yuanyang sp. nov. are slightly smaller than those of M. harpioloides (Table 4). Notably, in the ventral view of the skull, the talons of M1 and M2 of Murina yuanyang sp. nov. are more developed, and M3 is slightly fuller with a different angle compared to M. harpioloides. The curvature at the posterior part of the pterygoid differs significantly between the two species. In the occlusal view of the mandible, P4 of Murina yuanyang sp. nov. is more elliptical, M1 and M2 are slenderer, and the talonid appears sharper; the angle formed by the paracristid and protocristid of M2 is larger than that of M. harpioloides. From the lingual view, C1 of M. harpioloides is more pointed and narrows more obviously in the middle (Figure 3 and Figure 4B).
Comparison with M. eleryi and M. aurata: Eger and Lim [18] identified M. chrysochaetes as most similar in size and appearance to M. eleryi and M. aurata, although with a smaller body size. Murina yuanyang sp. nov. is slightly larger than M. chrysochaetes, but still smaller than M. eleryi and M. aurata, with comparatively smaller skull measurements (Table 4). Furey et al. [7] distinguished M. eleryi from M. aurata based on larger and longer canines, a feature that also differentiates Murina yuanyang sp. nov. from M. eleryi. In addition, the mesostyles on M1 and M2 are much less developed in Murina yuanyang sp. nov. than M. eleryi. Male Murina yuanyang sp. nov. specimens also have longer CM3L and CM3L compared to the male holotype and paratype of M. aurata, while GTL, CBL, and MDL measurements are significantly shorter, indicating a larger ratio of maxillary and mandibular canine–molar length relative to skull length in Murina yuanyang sp. nov. Furthermore, Murina yuanyang sp. nov. can be distinguished from M. aurata by the relative positions of I2 and I3, development of the tooth bases, shape of P2, and width of the gap between P2 and P4. Morphologically, Murina yuanyang sp. nov. has longer tubular nostrils and dark golden fur with brown stripes, differing from the golden fur of M. aurata described by Milne-Edwards [32] and the varying yellow-brown to gray-brown to copper-red shades of M. eleryi described by Furey [7] (Figure 3 and Figure 4C,D).
Comparison with other ‘suilla-type’ species without COI sequences: Other ‘suilla-type’ species lacking COI sequences include M. beelzebub, M. bicolor, M. fanjingshanensis, M. ryukyuana, and M. tenebrosa. According to Maeda and Matsumura [33], Kuo et al. [8], Csorba et al. [6], and He et al. [20], these species are classified as medium- to large-sized within the Murina genus (Table 5), distinguishing them from the smaller-sized Murina yuanyang sp. nov.
Distribution and habitat: The Murina yuanyang sp. nov. specimens were captured at two different locations in Pinghe, Xiaoxin Street, Yuanyang County, Yunnan Province, China (22.99° N, 103.00° E and 22.99° N, 102.99° E). The habitat consists of a mid-mountain evergreen broad-leaved forest at elevations of 2412 m and 2434 m, respectively. The area features a well-closed canopy, abundant shrubs, and several small streams. Although there are no known caves in the area, the forest contains many large trees with hollows. It is suspected that this insectivorous bat primarily roosts during the day in tree hollows or beneath the dense canopy.

4. Discussion

We conducted an in-depth analysis of these seven unique specimens using both morphological and molecular approaches.
At the molecular level, we sequenced the COI gene and the mitochondrial cytochrome B (Cyt b) gene in some specimens. Since the holotype specimen of M. chrysochaetes, which is the closest relative of Murina yuanyang sp. nov., has only COI sequences, and there are more COI sequences than Cyt b available for species of the genus Murina, we finally chose the COI sequence for molecular analysis. We used these sequences to calculate the uncorrected p-distances among species and reconstruct their phylogenetic relationships. In the resulting phylogenetic tree, all Murina yuanyang sp. nov. formed a clade and a distinct lineage sister to M. chrysochaetes with a posterior probability of 1 and a bootstrap value of 100, respectively, indicating that Murina yuanyang sp. nov. and Murina chrysochaetes have a differentiated but close phylogenetic relationship. However, the uncorrected p-distance between Murina yuanyang sp. nov. and M. chrysochaetes was 2.7–3.0%, a value that is only greater than that between M. leucogaster and M. shuipuensis (2.6%) (Table 2). Avise [34] found that intraspecific genetic differentiation is typically less than 2%, with most cases falling below 1%. Hebert et al. [35] reported that over 98% of species pairs exhibit more than 2% sequence divergence, and later suggested that the standard threshold for species divergence should be 10 times the average genetic distance within a species [36]. In this study, the minimum genetic distance between Murina yuanyang sp. nov. and M. chrysochaetes was 2.7%, significantly higher than 10 times the average intraspecific genetic distance of 0.1% for Murina yuanyang sp. nov. This distance also exceeds the 2% divergence threshold described by Hebert et al. [35].
Morphologically, we described and compared Murina yuanyang sp. nov. with two genetically close species, M. chrysochaetes and M. harpioloides, and two morphologically similar species, M. eleryi and M. aurata, as well as other members of the ‘suilla-type’ lacking COI sequences. Murina yuanyang sp. nov. can be distinguished from M. beelzebub, M. bicolor, M. fanjingshanensis, M. ryukyuana, and M. tenebrosa by body size; from M. eleryi by skull size, C1, development of the mesostyles on M1 and M2, and fur color; from M. aurata by fur color, skull size, ratio of maxillary and mandibular canine–molar length relative to skull length, the relative positions of I2 and I3, development of the tooth bases, shape of P2, and width of the gap between P2 and P4; from M. harpioloides by skull and tooth size and tooth structure; and from M. chrysochaetes by tubular nares, fur on the back and abdomen, rostrum, the slope of the forehead, zygomatic arches, C1, height and base area of C1 and P4, and measurements. The other species were not compared morphologically in detail, either because they belong to the cyclotis-type species or because they are far away from the p-distance of Murina yuanyang sp. nov. Given the widespread sexual dimorphism in the subfamily Murininae, we used the same-sex specimens when comparing the Murina yuanyang sp. nov. with the above species in the Comparison section. The sexual dimorphism of Murina yuanyang sp. nov. is mainly manifested in the external and cranial dimensions, the slope of the forehead, and the shape of P2.
Although Murina yuanyang sp. nov. and M. chrysochaetes can be clearly distinguished by morphological characteristics, and there are indeed valid species with a small genetic distance in the Murina, the reason for the small genetic distance between them deserves further study. For sister taxa M. recondita and M. gracilis, Kuo et al. [37] confirmed that the introgression of mitochondrial DNA did exist in the two species in history by studying their differentiation history (this introgression has ceased at present), and explained the possible reasons for this phenomenon, which is of great reference value for the situation between Murina yuanyang sp. nov. and M. chrysochaetes. To determine whether there is an introgression of mitochondrial DNA between Murina yuanyang sp. nov. and M. chrysochaetes, as well as their differentiation history and population dynamics, an in-depth study needs to be conducted. This will require more experimental material.

5. Conclusions

A new species of the Murina, Murina yuanyang sp. nov., is described in this paper, based on seven specimens collected from the Guanyinshan Provincial Nature Reserve, Yuanyang, Yunnan, China. Currently, the new species is known only from its type locality. The local ecological environment is relatively well maintained [38], and this species is less threatened at present.

Author Contributions

Conceptualization, X.M. and S.L.; methodology, X.M. and S.L.; software, X.M. and Y.Q.; validation, all authors.; formal analysis, X.M. and S.L.; investigation, all authors; resources, M.L., B.L., X.L., and S.L.; data curation, X.M.; writing—original draft preparation, X.M.; writing—review and editing, X.M. and S.L.; visualization, X.M. and Y.Q.; supervision, S.L.; project administration, S.L.; funding acquisition, S.L. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Survey of Chiroptera Species Diversity and Distribution in Northwest and Southwest of China (2021FY100302),the Project of Yuanyang Guanyinshan Provincial Nature Reserve Integrative Scientific Expedition (E2HX105B) and the Position of Bioclassonomist of Chinese Academy of Sciences (CAS-TAX-24-055).

Institutional Review Board Statement

Ethical review and approval were waived for this study due to the specimens and preserved tissue samples are from the collections of Kunming Natural History Museum of Zoology, Kunming Institute of Zoology, Chinese Academy of Sciences (KIZ, CAS), and do not involve any harm to living animals.

Informed Consent Statement

Not applicable.

Data Availability Statement

All data are presented in this article.

Acknowledgments

We thank the forest rangers of Guanyinshan Provincial Nature Reserve for their assistance in re-investigating the habitat of the specimens and the field work. We would like to thank our workmates for their help and advice in writing and submitting the article.

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. Francis, C.M.; Eger, J.L. A review of tube-nosed bats (Murina) from Laos with a description of two new species. Acta Chiropt. 2012, 14, 15–38. [Google Scholar] [CrossRef]
  2. Corbet, G.B.; Hill, J.E. The Mammals of the Indomalayan Region: A Systematic Review; Oxford University Press: New York, UK, 1992; pp. 148–149. [Google Scholar]
  3. Koopman, K.F. Chiroptera: Systematics. In Handbook of Zoology; Niethammer, J., Schliemann, H., Starck, D., Eds.; Walter de Gruyter: Berlin, Germany, 1994; Volume 8, p. 217. [Google Scholar]
  4. Csorba, G.; Bates, P.J.J. Description of a new species of Murina from Cambodia (Chiroptera: Vespertilionidae: Murininae). Acta Chiropterol. 2005, 7, 1–7. [Google Scholar] [CrossRef]
  5. Csorba, G.; Thong, D.V.; Bates, P.J.J.; Furey, N.M. Description of a new species of Murina from Vietnam (Chiroptera: Vespertilionidae: Murininae). Occas. Pap. Tex. Tech Univ. Mus. 2007, 268, 1–12. [Google Scholar] [CrossRef]
  6. Csorba, G.; Son, N.S.; Saveng, I.; Furey, N.M. Revealing cryptic bat diversity: Three new Murina and redescription of Murina tubinaris from southeast Asia. J. Mammal. 2011, 92, 891–904. [Google Scholar] [CrossRef]
  7. Furey, N.M.; Thong, V.D.; Bates, P.J.J.; Csorba, G. Description of a new species belonging to the Murina ‘suilla-group’ (Chiroptera: Vespertilionidae: Murininae) from north Vietnam. Acta Chiropterol. 2009, 11, 225–236. [Google Scholar] [CrossRef]
  8. Kuo, H.C.; Fang, Y.P.; Csorba, G.; Lee, L.L. Three new species of Murina (Chiroptera: Vespertilionidae) from Taiwan. J. Mammal. 2009, 90, 980–991. [Google Scholar] [CrossRef]
  9. Soisook, P.; Karapan, S.; Satasook, C.; Bates, P.J.J. A new species of Murina (Mammalia: Chiroptera: Vespertilionidae) from peninsular Thailand. Zootaxa 2013, 4, 567–579. [Google Scholar] [CrossRef] [PubMed]
  10. Son, N.T.; Csorba, G.; Tu, V.T.; Thong, V.D.; Wu, Y.; Harada, M.; Oshida, T.; Endo, H.; Motokawa, M. A new species of the genus Murina (Chiroptera: Vespertilionidae) from the Central Highlands of Vietnam with a review of the subfamily Murininae in Vietnam. Acta Chiropterol. 2015, 17, 201–232. [Google Scholar] [CrossRef]
  11. Chen, J.; Liu, T.; Deng, H.Q.; Xiao, N.; Zhou, J. A new species of Murina bats was discovered in Guizhou Province, China. Cave Res. 2017, 2, 1. Available online: https://www.researchgate.net/publication/282651837 (accessed on 8 August 2024).
  12. Zeng, X.; Chen, J.; Deng, H.Q.; Xiao, N.; Zhou, J. A new species of Murina from China (Chiroptera: Vespertilionidae). Ekoloji 2018, 103, 9–16. [Google Scholar]
  13. Bates, P.J.J.; Harrison, D.L. Bats of the Indian Subcontinent; Harrison Zoological Museum: Kent, UK, 1997; p. 258. [Google Scholar]
  14. Kuo, H.C.; Fang, Y.P.; Csorba, G.; Lee, L.L. The definition of Harpiola (Vespertilionidae: Murininae) and the description of a new species from Taiwan. Acta Chiropterol. 2006, 8, 11–19. [Google Scholar] [CrossRef]
  15. Li, S.; Mou, X.; Li, M.C.; Li, F.Y.; Li, M.; Li, B.; Li, M.J.; Luo, X.; Csorba, G.; Kuo, H.C. New records of Harpiola isodon (Chiroptera, Vespertilionidae) from the Chinese mainland. Biodivers. Data J. 2024, 12, e120670. [Google Scholar] [CrossRef] [PubMed]
  16. Simmons, N.B. Order Chiroptera. In Mammal Species of the World: A Taxonomic and Geographic Reference; Wilson, D.E., Reeder, D.M., Eds.; Johns Hopkins University Press: Baltimore, MD, USA, 2005; pp. 312–529. [Google Scholar]
  17. Kruskop, S.V.; Eger, J.L. A new species of tube-nosed bat Murina (Vespertilionidae: Chiroptera) from Vietnam. Acta Chiropterol. 2008, 10, 213–220. [Google Scholar] [CrossRef]
  18. Eger, J.L.; Lim, B.K. Three new species of Murina from southern China (Chiroptera: Vespertilionidae). Acta Chiropterol. 2011, 13, 227–243. [Google Scholar] [CrossRef]
  19. Ruedi, M.; Biswas, J.; Csorba, G. Bats from the wet: Two new species of tube-nosed bats (Chiroptera: Vespertilionidae) from Meghalaya, India. Rev. Suisse. Zool. 2012, 119, 111–135. [Google Scholar] [CrossRef]
  20. He, F.; Xiao, N.; Zhou, J. A new species of Murina from China (Chiroptera: Vespertilionidae). Cave Res. 2015, 2, 1–6. Available online: https://www.researchgate.net/publication/327928653 (accessed on 8 August 2024).
  21. Yu, W.H.; Csorba, G.; Wu, Y. Tube-nosed variations–a new species of the genus Murina (Chiroptera: Vespertilionidae) from China. Zool. Res. 2020, 41, 70–77. [Google Scholar] [CrossRef] [PubMed]
  22. Wei, F.W.; Yang, Q.S.; Wu, Y.; Jiang, X.L.; Liu, S.Y.; Li, B.G.; Yang, G.; Li, M.; Zhou, J.; Li, S.; et al. Catalogue of mammals in China (2021). Acta Theriol. Sin. 2021, 41, 487–501. [Google Scholar] [CrossRef]
  23. Zhang, D.; Gao, F.; Jakovlić, I.; Zou, H.; Zhang, J.; Li, W.X.; Wang, G.T. PhyloSuite: An integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Mol. Ecol. Resour. 2020, 20, 348–355. [Google Scholar] [CrossRef]
  24. Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
  25. Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [PubMed]
  26. Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed]
  27. Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed]
  28. Nguyen, L.T.; Schmidt, H.A.; von Haeseler, A.; Minh, B.Q. IQ-TREE: A fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Mol. Biol. Evol. 2015, 32, 268–274. [Google Scholar] [CrossRef] [PubMed]
  29. Minh, B.Q.; Nguyen, M.A.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef] [PubMed]
  30. Guindon, S.; Dufayard, J.F.; Lefort, V.; Anisimova, M.; Hordijk, W.; Gascuel, O. New algorithms and methods to estimate maximum-likelihood phylogenies: Assessing the performance of PhyML 3.0. Syst. Biol. 2010, 59, 307–321. [Google Scholar] [CrossRef] [PubMed]
  31. Son, N.T.; Motokawa, M.; Oshida, T.; Thong, V.D.; Csorba, G.; Endo, H. Multivariate analysis of the skull size and shape in tube-nosed bats of the genus Murina (Chiroptera: Vespertilionidae) from Vietnam. Mammal Study 2015, 40, 79–94. [Google Scholar] [CrossRef]
  32. Milne-Edwards, M.A. Recherches Pour Servir à L’histoire Naturelle des Mammifères: Comprenant des Considérations sur la Classification de ces Animaux; G. Masson, 1868–1874: Paris, France, 1868; Volume 2, pp. 250–252. [Google Scholar]
  33. Maeda, K.; Matsumura, S. Two new species of vespertilionid bats, Myotis and Murina (Vespertilionidae: Chiroptera) from Yanbaru, Okinawa Island, Okinawa Prefecture, Japan. Zoolog. Sci. 1998, 15, 301–307. [Google Scholar] [CrossRef]
  34. Avise, J.C. Phylogeography: The History and Formation of Species; Harvard University Press: Cambridge, MA, USA, 2000. [Google Scholar]
  35. Hebert, P.D.; Ratnasingham, S.; deWaard, J.R. Barcoding animal life: Cytochrome c oxidase subunit 1 divergences among closely related species. Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270 (Suppl. S1), S96–S99. [Google Scholar] [CrossRef]
  36. Hebert, P.D.N.; Cywinska, A.; Ball, S.L.; deWaard, J.R. Biological identifications through DNA barcodes. Proc. R. Soc. London. Ser. B Biol. Sci. 2003, 270, 313–321. [Google Scholar] [CrossRef]
  37. Kuo, H.C.; Chen, S.F.; Fang, Y.P.; Cotton, J.A.; Parker, J.D.; Csorba, G.; Lim, B.K.; Eger, J.L.; Chen, C.H.; Chou, C.H.; et al. Speciation processes in putative island endemic sister bat species: False impressions from mitochondrial DNA and microsatellite data. Mol. Ecol. 2015, 24, 5910–5926. [Google Scholar] [CrossRef] [PubMed]
  38. Liu, S.; Mo, M.; Li, M.; Li, B.; Luo, X.; Rao, D.; Li, S. Description of a new species of the Pareas hamptoni Complex from Yunnan, China, with Confirmation of P. hamptoni Sensu Stricto in China (Squamata, Pareidae). Animals 2024, 14, 421. [Google Scholar] [CrossRef] [PubMed]
Animals 14 02371 g001
Figure 1. Bayesian phylogenetic tree of Murina species based on COI fragments. Node numbers before “/” indicate Bayesian posterior probabilities (values below 0.90 not shown) and numbers after “/” indicate ultrafast bootstrap support for maximum-likelihood analyses (values below 70 not shown).
Figure 1. Bayesian phylogenetic tree of Murina species based on COI fragments. Node numbers before “/” indicate Bayesian posterior probabilities (values below 0.90 not shown) and numbers after “/” indicate ultrafast bootstrap support for maximum-likelihood analyses (values below 70 not shown).
Animals 14 02371 g001
Animals 14 02371 g002
Figure 2. External morphology of Murina yuanyang sp. nov. (A) Holotype (KIZ20230424); (B) paratype (KIZ20230450); (C) paratype (KIZ20230415, specimens soaked in alcohol). (1) = Dorsal view; (2) = ventral view; (3) = lateral view. Scale = 10 mm.
Figure 2. External morphology of Murina yuanyang sp. nov. (A) Holotype (KIZ20230424); (B) paratype (KIZ20230450); (C) paratype (KIZ20230415, specimens soaked in alcohol). (1) = Dorsal view; (2) = ventral view; (3) = lateral view. Scale = 10 mm.
Animals 14 02371 g002
Animals 14 02371 g003
Figure 3. Skull of Murina yuanyang sp. nov. (A) Holotype (KIZ20230424); (B) paratype (KIZ20230450); (C) paratype (KIZ20230415). (1) = Dorsal view of skull; (2) = ventral view of skull; (3) = lateral view of skull; (4) = lateral view of mandible; (5) = occlusal view of mandible. Scale = 2 mm.
Figure 3. Skull of Murina yuanyang sp. nov. (A) Holotype (KIZ20230424); (B) paratype (KIZ20230450); (C) paratype (KIZ20230415). (1) = Dorsal view of skull; (2) = ventral view of skull; (3) = lateral view of skull; (4) = lateral view of mandible; (5) = occlusal view of mandible. Scale = 2 mm.
Animals 14 02371 g003
Animals 14 02371 g004
Figure 4. Lateral view of skulls from principal species within the Murina genus for comparative analysis, sourced from the literature. (A) M. chrysochaetes [18]; (B) M. harpioloides [17]; (C) M. eleryi [1,7]; (D) M. aurata [7]. (1) = maxilla; (2) = mandible. Scale = 2 mm.
Figure 4. Lateral view of skulls from principal species within the Murina genus for comparative analysis, sourced from the literature. (A) M. chrysochaetes [18]; (B) M. harpioloides [17]; (C) M. eleryi [1,7]; (D) M. aurata [7]. (1) = maxilla; (2) = mandible. Scale = 2 mm.
Animals 14 02371 g004
Table 1. List of cranial and dental measurements used in this study.
Table 1. List of cranial and dental measurements used in this study.
CharacterDefinitions
STOTLtotal length of skull: from anterior rim of alveolus of I2 to most projecting point of occipital region
GTLgreatest length of skull: from anterior aspect of I2 to most prominent point of occipital region
CBLcondylobasal length: from exoccipital condyle to posterior rim of alveolus of I2
CCLcondylocanine length: from exoccipital condyle to most anterior part of C1
ZYWzygomatic width: greatest width of skull across zygomatic arches
BCWbraincase width: greatest width of braincase
BCHbraincase height: skull placed horizontally, measuring from horizontal plane to highest point of cranium
IOWinterorbital width: least width of interorbital constriction
POWwidth of postorbital constriction: least width of postorbital constriction
MAWmastoid width: greatest distance across mastoid region
BOWbasioccipital width: least distance between cochleae
CM3Lupper canine–molar length: from anterior of C1 to posterior of M3 crown
IM3Lmaxillary toothrow length: from anterior point of I2 to back of M3 crown
CP4Lupper canine–premolar length: from anterior of C1 to posterior of P4 crown
M1M3Lupper molar length: from anterior of first upper molar (M1) to posterior of M3
PWC1C1anterior palatal width: least distance between inner borders of C1
PWM3M3posterior palatal width: least distance between inner borders of M3
C1C1Wupper canine width: greatest width of outer borders of C1
M3M3Wupper molar greatest width: greatest width of outer borders of M3
MDLgreatest length of mandible: from anterior point of first lower incisor (I2) to most posterior part of condyle
MLmandible length: from anterior rim of alveolus of I2 to most posterior part of condyle
CPHcoronoid process height: least distance from apex of coronoid process to indentation of lower border of ramus mandibula
CM3Llower canine–molar length: from anterior of C1 to posterior of third lower molar (M3) crown
IM3Lmandibular toothrow length: from anterior point of I2 to back of M3 crown
CP4Llower canine–premolar length: from anterior of lower canine to back of posterior P4 crown
M1M3Llower molar length: from anterior of first lower molar (M1) to the posterior of M3.
Table 2. Species and GenBank accession numbers of sequences used in phylogenetic reconstruction.
Table 2. Species and GenBank accession numbers of sequences used in phylogenetic reconstruction.
TaxonAccession NumberTaxonAccession Number
Harpiocephalus harpiaHM540274Murina huttoniJQ601452
Harpiola isodonHM540286 Murina jaintianaMF537346
Kerivoula kachinensisMZ438743 Murina jinchuiMN549070
Murina aeneaHM540928Murina kontumensisKT820760
Murina annamiticaHM540969Murina leucogasterHM540988
Murina balaensisKY034093Murina lorelieaeJN082179
Murina chrysochaetesHM540986Murina peninsularisHM540972
Murina cyclotisJF443973Murina putaKT982277
Murina eleryiKT762293Murina reconditaKJ198687
Murina feaeKF772778Murina rongjiangensisMN549085
Murina fionaeHM540965Murina rozendaaliKY034110
Murina gracilisKJ198567Murina shuipuensisJN082180
Murina guilleniKY034137Murina suillaKY034090
Murina harpioloidesJF443974Murina tubinarisHM541000
Murina harrisoniMN549045Murina ussuriensisHQ974648
Murina hilgendorfiJF442833Murina walstoniHM540957
Murina hkakaboraziensisMF537343Myotis muricolaMW054913
Table 3. Uncorrected p-distances (%) between species calculated from 657 bp COI gene fragment. Values less than or equal to p-distances between our specimen and M. chrysochaetes are underlined.
Table 3. Uncorrected p-distances (%) between species calculated from 657 bp COI gene fragment. Values less than or equal to p-distances between our specimen and M. chrysochaetes are underlined.
No.Taxon1234567891011121314
1M. yuanyang sp. Nov. (KIZ20230415)
2M. yuanyang sp. Nov. (KIZ20230424)0.0
3M. yuanyang sp. Nov. (KIZ20230426)0.00.0
4M. yuanyang sp. Nov. (KIZ20230449)0.00.00.0
5M. yuanyang sp. Nov. (KIZ20230492)0.00.00.00.0
6M. yuanyang sp. Nov. (KIZ20230498)0.30.30.30.30.3
7M. chrysochaetes2.72.72.72.72.73.0
8M. harpioloides9.09.09.09.09.09.39.4
9M. eleryi16.316.316.316.316.316.317.216.5
10M. leucogaster17.017.017.017.017.017.416.916.016.6
11M. rongjiangensis16.616.616.616.616.616.917.016.015.74.3
12M. shuipuensis17.517.517.517.517.517.817.716.416.12.64.1
13M. gracilis17.817.817.817.817.817.818.817.59.617.516.617.0
14M. recondita19.119.119.119.119.119.120.018.610.718.417.217.54.2
Table 4. Weight (g) and external and cranial measurements (mm) of Murina species. Abbreviations and definitions of measurement values are provided in Section 2. “♂” indicate male, “♀” indicate female, “*” indicate the means of IEBR-M6020 and S186699.
Table 4. Weight (g) and external and cranial measurements (mm) of Murina species. Abbreviations and definitions of measurement values are provided in Section 2. “♂” indicate male, “♀” indicate female, “*” indicate the means of IEBR-M6020 and S186699.
CharacterMurina yuanyang sp. nov.Murina chrysochaetesMurina harpioloides Holotype, ♀, Kruskop and Eger [17]Murina eleryi
Holotype, ♂, Furey et al. [7]		Murina aurata
Holotype, ♂ Paratype, ♂
Mean (n = 2)
Eger and Lim [18]
Holotype (KIZ20230424)Paratype (KIZ20230450)♂ (n = 2)
Mean, KIZ20230415 (Paratype), KIZ20230492		♀ (n = 5)
Mean ± SD,
Min–Max		Holotype, ♂, Eger and Lim [18] IEBR-M6020, ♀/S186699, ♀, Son et al. [10,31]
WT4.24.73.5, 3.6, 3.44.3 ± 0.3, 3.8–4.73.04.0 *4.24.0-
HB35.0536.3433.66, 31.37, 35.9434.82 ± 1.52, 32.11–36.34-40.0 *35.0--
TL31.5827.9925.57, 23.89, 27.2528.39 ± 1.64, 26.92–31.58-24.0 *30.528.7-
E12.9913.1113.09, 12.77, 13.4013.25 ± 0.82, 12.27–14.77-12.0 *12.312.6-
HF7.888.526.49, 6.83, 6.147.66 ± 0.75, 6.25–8.52-5.5 *-6.2-
TIB13.4813.5712.86, 12.56, 13.1613.15 ± 0.43, 12.37–13.5710.9212.6 *-14.712.00
FA29.829.6427.81, 27.96, 27.6629.83 ± 0.35, 29.53–30.5126.3528.6 *29.728.429.14
MET225.5625.5522.36, 22.82, 21.8924.46 ± 1.00, 23.06–25.56-----
MET327.9028.0925.15, 24.48, 25.7927.39 ± 0.60, 26.58–28.0925.43--26.225.99
MET427.1827.7925.09, 24.59, 25.5926.99 ± 0.68, 25.78–27.7924.53--25.526.46
MET527.4927.4625.34, 24.95, 25.7327.21 ± 0.28, 26.71–27.4924.50--26.126.81
STOTL13.8413.7913.54, 13.31, 13.7713.90 ± 0.10, 13.79–14.07-14.57/14.72-14.62-
GTL14.1313.9513.72, 13.44, 14.0014.09 ± 0.07, 13.95–14.1614.05--14.9014.20
CBL12.6812.4612.18, 12.02,12.3512.58 ± 0.12, 12.41–12.7212.45-13.0212.8912.56
CCL12.1212.0511.75, 11.58, 11.9312.10 ± 0.09, 11.94–12.22--12.3412.59-
ZYW7.737.707.46, 7.41,7.527.69 ± 0.13, 7.44–7.817.858.41-7.847.59
BCW6.956.976.92, 6.91, 6.937.00 ± 0.08, 6.93–7.156.987.287.217.117.15
BCH6.786.566.79, 6.59, 6.986.62 ± 0.09, 6.51–6.78-6.335.815.77-
IOW3.843.803.73, 3.67, 3.783.79 ± 0.06, 3.68–3.86-4.174.124.27-
POW3.933.903.91, 3.88, 3.933.94 ± 0.05, 3.88–4.014.26-4.09-4.17
MAW7.387.387.21, 7.18, 7.237.31 ± 0.10, 7.12–7.387.077.627.427.077.14
BOW1.501.381.32, 1.28, 1.351.40 ± 0.06, 1.30–1.50-1.39-1.22-
CM3L4.514.544.41, 4.43, 4.384.53 ± 0.06, 4.45–4.634.365.44/4.664.684.504.27
IM3L5.285.295.18, 5.13, 5.235.28 ± 0.07, 5.22–5.40-----
CP4L2.002.112.03, 2.06,2.002.07 ± 0.04, 2.00–2.12-2.02-2.07-
M1M3L2.732.682.67, 2.63, 2.712.69 ± 0.04, 2.62–2.74-2.88---
PWC1C11.781.711.53, 1.42, 1.631.68 ± 0.07, 1.55–1.78-1.99-1.65-
PWM3M32.732.762.69, 2.63, 2.752.80 ± 0.05, 2.73–2.86-3.013.102.59-
C1C1W3.223.283.11, 3.01, 3.213.21 ± 0.08, 3.06–3.283.183.633.393.213.18
M3M3W4.744.624.60, 4.61, 4.594.67 ± 0.04, 4.62–4.74-4.934.884.62-
MDL8.768.758.32, 8.21, 8.438.75 ± 0.13, 8.51–8.918.42---8.59
ML8.418.428.12, 8.09, 8.158.49 ± 0.13, 8.34–8.69-9.30/9.949.319.55-
CPH2.862.932.64, 2.52, 2.762.83 ± 0.09, 2.69–2.933.063.513.322.862.87
CM3L5.034.934.76, 4.81, 4.714.93 ± 0.05, 4.88–5.034.365.085.134.894.64
IM3L5.485.565.34, 5.32, 5.365.57 ± 0.09, 5.46–5.70-----
CP4L2.011.921.88, 1.85, 1.911.92 ± 0.06, 1.85–2.01-1.83-1.82-
M1M3L3.343.423.20, 3.16, 3.243.36 ± 0.05, 3.29–3.42-3.33---
Table 5. Comparison of body size of Murina yuanyang sp. nov. and other ‘suilla-type’ species lacking COI sequences.
Table 5. Comparison of body size of Murina yuanyang sp. nov. and other ‘suilla-type’ species lacking COI sequences.
SizeFASTOTLGTL
Murina yuanyang sp. nov.
(n = 7)		Small27.66–30.5113.31–14.0713.44–14.16
M. beelzebub, holotype
Csorba et al. [6]		Medium33.716.54
M. bicolor
Kuo et al. [8] (n = 8)		Large37.2–41.6-18.00–19.54
M. fanjingshanensis
He et al. [20] (n = 3)		Large40.60–41.44-18.39–19.05
M. ryukyuana
Maeda and Matsumura [32] (n = 4)		Medium35.5–37.0-18.30–18.65
M. tenebrosa
Kuo et al. [8]		Medium33.8-16.81
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Mou, X.; Qian, Y.; Li, M.; Li, B.; Luo, X.; Li, S. A New Species of Murina (Chiroptera: Vespertilionidae) from Yunnan, China. Animals 2024, 14, 2371. https://doi.org/10.3390/ani14162371

AMA Style

Mou X, Qian Y, Li M, Li B, Luo X, Li S. A New Species of Murina (Chiroptera: Vespertilionidae) from Yunnan, China. Animals. 2024; 14(16):2371. https://doi.org/10.3390/ani14162371

Chicago/Turabian Style

Mou, Xin, Yishun Qian, Mei Li, Biao Li, Xiong Luo, and Song Li. 2024. "A New Species of Murina (Chiroptera: Vespertilionidae) from Yunnan, China" Animals 14, no. 16: 2371. https://doi.org/10.3390/ani14162371

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop