Comparison of PCR, Nested PCR, and RT-LAMP for Rapid Detection of Feline Calicivirus Infection in Clinical Samples
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Construction of Positive Control Plasmids
2.3. Conventional PCR and Nested PCR
2.4. RT-LAMP Primer Design
2.5. RT-LAMP Assay
2.6. Validation of RT-LAMP Assay
2.7. Application of RT-LAMP Assay in Clinical Samples
2.8. Sequencing and Analysis
2.9. Statistical Analysis
3. Results
3.1. Optimization of RT-LAMP Assay
3.2. Specificity Evaluation of RT-LAMP Assay
3.3. Assessment of Sensitivity of Conventional PCR, Nested PCR, and RT-LAMP Assays
3.4. Evaluation of RT-LAMP Assay for Detection of FCV in Clinical Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Bannasch, M.J.; Foley, J.E. Epidemiologic evaluation of multiple respiratory pathogens in cats in animal shelters. J. Feline Med. Surg. 2005, 7, 109–119. [Google Scholar] [CrossRef]
- Helps, C.R.; Lait, P.; Damhuis, A.; BjÖrnehammar, U.; Bolta, D.; Brovida, C.; Chabanne, L.; Egberink, H.; Ferrand, G.; Fontbonne, A.; et al. Factors associated with upper respiratory tract disease caused by feline herpesvirus, feline calicivirus, Chlamydophila felis and Bordetella bronchiseptica in cats: Experience from 218 European catteries. Vet. Rec. 2005, 156, 669–673. [Google Scholar] [CrossRef]
- Pereira, J.d.J.; Baumworcel, N.; Fioretti, J.M.; Domingues, C.F.; de Moraes, L.F.; Marinho, R.d.S.S.; Vieira, M.C.R.; Pinto, A.M.V.; de Castro, T.X. Molecular characterization of feline calicivirus variants from multicat household and public animal shelter in Rio de Janeiro, Brazil. Braz. J. Microbiol. 2018, 49, 777–784. [Google Scholar] [CrossRef]
- Smertina, E.; Urakova, N.; Strive, T.; Frese, M. Calicivirus RNA-Dependent RNA Polymerases: Evolution, Structure, Protein Dynamics, and Function. Front. Microbiol. 2019, 10, 1280. [Google Scholar] [CrossRef] [PubMed]
- Symes, S.J.; Job, N.; Ficorilli, N.; Hartley, C.A.; Browning, G.F.; Gilkerson, J.R. Novel assay to quantify recombination in a calicivirus. Vet. Microbiol. 2015, 177, 25–31. [Google Scholar] [CrossRef] [PubMed]
- Bhella, D.; Gatherer, D.; Chaudhry, Y.; Pink, R.; Goodfellow, I.G. Structural insights into calicivirus attachment and uncoating. J. Virol. 2008, 82, 8051–8058. [Google Scholar] [CrossRef] [PubMed]
- Radford, A.D.; Willoughby, K.; Dawson, S.; McCracken, C.; Gaskell, R.M. The capsid gene of feline calicivirus contains linear B-cell epitopes in both variable and conserved regions. J. Virol. 1999, 73, 8496–8502. [Google Scholar] [CrossRef]
- Carter, M.J.; Milton, I.D.; Meanger, J.; Bennett, M.; Gaskell, R.M.; Turner, P.C. The complete nucleotide sequence of a feline calicivirus. Virology 1992, 190, 443–448. [Google Scholar] [CrossRef]
- Geissler, K.; Schneider, K.; Truyen, U. Mapping neutralizing and non-neutralizing epitopes on the capsid protein of feline calicivirus. J. Vet. Med. B Infect. Dis. Vet. Public Health 2002, 49, 55–60. [Google Scholar] [CrossRef]
- Abd-Eldaim, M.M.; Wilkes, R.P.; Thomas, K.V.; Kennedy, M.A. Development and validation of a TaqMan real-time reverse transcription-PCR for rapid detection of feline calicivirus. Arch. Virol. 2009, 154, 555–560. [Google Scholar] [CrossRef]
- Alan, D.R.; Karen, P.C.; Susan, D.; Carol, J.P.; Rosalind, M.G. Feline calicivirus. Vet. Res. 2007, 38, 319–335. [Google Scholar] [CrossRef]
- Hofmann-Lehmann, R.; Hosie, M.J.; Hartmann, K.; Egberink, H.; Truyen, U.; Tasker, S.; Belák, S.; Boucraut-Baralon, C.; Frymus, T.; Lloret, A.; et al. Calicivirus Infection in Cats. Viruses 2022, 14, 937. [Google Scholar] [CrossRef]
- Wardley Rc Fau-Povey, R.C.; Povey, R.C. The clinical disease and patterns of excretion associated with three different strains of feline caliciviruses. Res. Vet. Sci. 1977, 23, 7–14. [Google Scholar] [CrossRef]
- Murphy, F.A.; Gibbs, E.P.J.; Horzinek, M.C.; Studdert, M.J. Veterinary Virology, 3rd ed.; Elsevier Science: San Diego, CA, USA, 1999; pp. 536–538. [Google Scholar]
- Berger, A.; Willi, B.; Meli, M.L.; Boretti, F.S.; Hartnack, S.; Dreyfus, A.; Lutz, H.; Hofmann-Lehmann, R. Feline calicivirus and other respiratory pathogens in cats with Feline calicivirus-related symptoms and in clinically healthy cats in Switzerland. BMC Vet. Res. 2015, 11, 282. [Google Scholar] [CrossRef]
- Hurley, K.F.; Sykes, J.E. Update on feline calicivirus: New trends. Vet. Clin. N. Am. Small Anim. Pract. 2003, 33, 759–772. [Google Scholar] [CrossRef]
- Monné Rodriguez, J.; Köhler, K.; Kipar, A. Calicivirus co-infections in herpesvirus pneumonia in kittens. Vet. J. 2018, 236, 1–3. [Google Scholar] [CrossRef] [PubMed]
- TerWee, J.; Lauritzen, A.Y.; Sabara, M.; Dreier, K.J.; Kokjohn, K. Comparison of the primary signs induced by experimental exposure to either a pneumotrophic or a ‘limping’ strain of feline calicivirus. Vet. Microbiol. 1997, 56, 33–45. [Google Scholar] [CrossRef] [PubMed]
- Monné Rodriguez, J.M.; Soare, T.; Malbon, A.; Blundell, R.; Papoula-Pereira, R.; Leeming, G.; Köhler, K.; Kipar, A. Alveolar macrophages are the main target cells in feline calicivirus-associated pneumonia. Vet. J. 2014, 201, 156–165. [Google Scholar] [CrossRef]
- Slaviero, M.; Ehlers, L.P.; Argenta, F.F.; Savi, C.; Lopes, B.C.; Pavarini, S.P.; Driemeier, D.; Sonne, L. Causes and Lesions of Fatal Pneumonia in Domestic Cats. J. Comp. Pathol. 2021, 189, 59–71. [Google Scholar] [CrossRef]
- Phongroop, K.; Rattanasrisomporn, J.; Piewbang, C.; Tangtrongsup, S.; Rungsipipat, A.; Techangamsuwan, S. Molecular epidemiology and strain diversity of circulating feline Calicivirus in Thai cats. Front. Vet. Sci. 2024, 11, 1377327. [Google Scholar] [CrossRef]
- Wardley, R.C. Feline calicivirus carrier state a study of the host/virus relationship. Arch. Virol. 1976, 52, 243–249. [Google Scholar] [CrossRef] [PubMed]
- Radford, A.D.; Addie, D.; Belák, S.; Boucraut-Baralon, C.; Egberink, H.; Frymus, T.; Gruffydd-Jones, T.; Hartmann, K.; Hosie, M.J.; Lloret, A.; et al. Feline Calicivirus Infection: ABCD Guidelines on Prevention and Management. J. Feline Med. Surg. 2009, 11, 556–564. [Google Scholar] [CrossRef] [PubMed]
- Cao, N.; Tang, Z.; Zhang, X.; Li, W.; Li, B.; Tian, Y.; Xu, D. Development and Application of a Triplex TaqMan Quantitative Real-Time PCR Assay for Simultaneous Detection of Feline Calicivirus, Feline Parvovirus, and Feline Herpesvirus 1. Front. Vet. Sci. 2022, 8, 792322. [Google Scholar] [CrossRef] [PubMed]
- Abayli, H.; Can-Sahna, K.; Özbek, R.; Karaca Bekdik, İ. Feline Calicivirus Prevalence among Cats in Turkey’s Kayseri Province. Isr. J. Vet. Med. 2020, 75, 94–99. [Google Scholar]
- Ye, J.; Li, Z.; Sun, F.Y.; Guo, L.; Feng, E.; Bai, X.; Cheng, Y. Development of a triple NanoPCR method for feline calicivirus, feline panleukopenia syndrome virus, and feline herpesvirus type I virus. BMC Vet. Res. 2022, 18, 379. [Google Scholar] [CrossRef]
- Kim, S.J.; Park, Y.H.; Park, K.T. Development of a novel reverse transcription PCR and its application to field sample testing for feline calicivirus prevalence in healthy stray cats in Korea. J. Vet. Sci. 2020, 21, e71. [Google Scholar] [CrossRef]
- Marsilio, F.; Martino, B.D.; Decaro, N.; Buonavoglia, C. A novel nested PCR for the diagnosis of calicivirus infections in the cat. Vet. Microbiol. 2005, 105, 1–7. [Google Scholar] [CrossRef]
- Marmiroli, N.; Maestri, E. Chapter 6-Polymerase chain reaction (PCR). In Food Toxicants Analysis; Picó, Y., Ed.; Elsevier: Amsterdam, The Netherlands, 2007; pp. 147–187. [Google Scholar]
- Falchieri, M.; Brown, P.A.; Catelli, E.; Naylor, C.J. Avian metapneumovirus RT-nested-PCR: A novel false positive reducing inactivated control virus with potential applications to other RNA viruses and real time methods. J. Virol. Methods 2012, 186, 171–175. [Google Scholar] [CrossRef]
- Radford, A.D.; Bennett, M.; McArdle, F.; Dawson, S.; Turner, P.C.; Glenn, M.A.; Gaskell, R.M. The use of sequence analysis of a feline calicivirus (FCV) hypervariable region in the epidemiological investigation of FCV related disease and vaccine failures. Vaccine 1997, 15, 1451–1458. [Google Scholar] [CrossRef]
- Chander, Y.; Tiwari, A.; Sajja, S.; Ramakrishnan, M.; Faaberg, K.; Goyal, S. A TaqManR RT-PCR assay for the detection of Feline calicivirus. Int. J. Virol. 2007, 3, 100–106. [Google Scholar] [CrossRef]
- Notomi, T.; Okayama, H.; Masubuchi, H.; Yonekawa, T.; Watanabe, K.; Amino, N.; Hase, T. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000, 28, e63. [Google Scholar] [CrossRef] [PubMed]
- Paik, I.; Ngo, P.H.T.; Shroff, R.; Maranhao, A.C.; Walker, D.J.F.; Bhadra, S.; Ellington, A.D. Multi-modal engineering of Bst DNA polymerase for thermostability in ultra-fast LAMP reactions. bioRxiv 2021. [Google Scholar] [CrossRef]
- Tomita, N.; Mori, Y.; Kanda, H.; Notomi, T. Loop-mediated isothermal amplification (LAMP) of gene sequences and simple visual detection of products. Nat. Protoc. 2008, 3, 877–882. [Google Scholar] [CrossRef]
- Mori, Y.; Nagamine, K.; Tomita, N.; Notomi, T. Detection of Loop-Mediated Isothermal Amplification Reaction by Turbidity Derived from Magnesium Pyrophosphate Formation. Biochem. Biophys. Res. Commun. 2001, 289, 150–154. [Google Scholar] [CrossRef]
- Mori, Y.; Kitao, M.; Tomita, N.; Notomi, T. Real-time turbidimetry of LAMP reaction for quantifying template DNA. J. Biochem. Biophys. Methods 2004, 59, 145–157. [Google Scholar] [CrossRef]
- Rapichai, W.; Saejung, W.; Khumtong, K.; Boonkaewwan, C.; Tuanthap, S.; Lieberzeit, P.A.; Choowongkomon, K.; Rattanasrisomporn, J. Development of Colorimetric Reverse Transcription Loop-Mediated Isothermal Amplification Assay for Detecting Feline Coronavirus. Animals 2022, 12, 2075. [Google Scholar] [CrossRef]
- Saejung, W.; Khumtong, K.; Rapichai, W.; Ratanabunyong, S.; Rattanasrisomporn, A.; Choowongkomon, K.; Rungsuriyawiboon, O.; Rattanasrisomporn, J. Detection of feline immunodeficiency virus by neutral red-based loop-mediated isothermal amplification assay. Vet. World 2024, 17, 72–81. [Google Scholar] [CrossRef]
- Dąbrowska, J.; Karamon, J.; Kochanowski, M.; Gottstein, B.; Cencek, T.; Frey, C.F.; Müller, N. Development and comparative evaluation of different LAMP and PCR assays for coprological diagnosis of feline tritrichomonosis. Vet. Parasitol. 2019, 273, 17–23. [Google Scholar] [CrossRef]
- Sheng, L.; Xue, Q.; Xu, S.; Can, F.; Yao, N.; Zou, M.; Teng, Q.; Li, Y.; El-Ashram, S.; Ji, Y.; et al. Rapid and visual detection of Toxoplasma gondii oocyst in cat feces using loop-mediated isothermal amplification (LAMP) assay. Sci. Rep. 2023, 13, 17269. [Google Scholar] [CrossRef]
- Yi, S. Rapid Detection of Feline Calicivirus and Feline Herpesvirus by Duplex Nested RT-PCR. Pak. Vet. J. 2018, 38, 346–352. [Google Scholar] [CrossRef]
- Li, L.; Liu, Z.; Shi, J.; Yang, M.; Yan, Y.; Fu, Y.; Shen, Z.; Peng, G. The CDE region of feline Calicivirus VP1 protein is a potential candidate subunit vaccine. BMC Vet. Res. 2024, 20, 80. [Google Scholar] [CrossRef] [PubMed]
- Whelan, J.A.; Russell, N.B.; Whelan, M.A. A method for the absolute quantification of cDNA using real-time PCR. J. Immunol. Methods 2003, 278, 261–269. [Google Scholar] [CrossRef]
- Morozov, V.A.; Morozov, A.V.; Denner, J. New PCR diagnostic systems for the detection and quantification of porcine cytomegalovirus (PCMV). Arch. Virol. 2016, 161, 1159–1168. [Google Scholar] [CrossRef] [PubMed]
- Fernandez, M.; Manzanilla, E.G.; Lloret, A.; León, M.; Thibault, J.-C. Prevalence of feline herpesvirus-1, feline calicivirus, Chlamydophila felis and Mycoplasma felis DNA and associated risk factors in cats in Spain with upper respiratory tract disease, conjunctivitis and/or gingivostomatitis. J. Feline Med. Surg. 2016, 19, 461–469. [Google Scholar] [CrossRef]
- Liu, C.; Liu, Y.; Qian, P.; Cao, Y.; Wang, J.; Sun, C.; Huang, B.; Cui, N.; Huo, N.; Wu, H.; et al. Molecular and serological investigation of cat viral infectious diseases in China from 2016 to 2019. Transbound. Emerg. Dis. 2020, 67, 2329–2335. [Google Scholar] [CrossRef] [PubMed]
- Phongroop, K.; Rattanasrisomporn, J.; Tangtrongsup, S.; Rungsipipat, A.; Piewbang, C.; Techangamsuwan, S. High-resolution melting analysis for simultaneous detection and discrimination between wild-type and vaccine strains of feline calicivirus. Vet. Q. 2023, 43, 1–12. [Google Scholar] [CrossRef]
- Słomka, M.; Sobalska-Kwapis, M.; Wachulec, M.; Bartosz, G.; Strapagiel, D. High Resolution Melting (HRM) for High-Throughput Genotyping—Limitations and Caveats in Practical Case Studies. Int. J. Mol. Sci. 2017, 18, 2316. [Google Scholar] [CrossRef]
- Nagamine, K.; Watanabe, K.; Ohtsuka, K.; Hase, T.; Notomi, T. Loop-mediated Isothermal Amplification Reaction Using a Nondenatured Template. Clin. Chem. 2001, 47, 1742–1743. [Google Scholar] [CrossRef]
- Tanner, N.A.; Zhang, Y.; Evans, T.C., Jr. Visual Detection of Isothermal Nucleic Acid Amplification Using pH-Sensitive Dyes. Biotechniques 2015, 58, 59–68. [Google Scholar] [CrossRef]
- Wang, Y.; Dai, J.; Liu, Y.; Yang, J.; Hou, Q.; Ou, Y.; Ding, Y.; Ma, B.; Chen, H.; Li, M.; et al. Development of a Potential Penside Colorimetric LAMP Assay Using Neutral Red for Detection of African Swine Fever Virus. Front. Microbiol. 2021, 12, 609821. [Google Scholar] [CrossRef]
- Binns, S.H.; Dawson, S.; Speakman, A.J.; Cuevas, L.E.; Hart, C.A.; Gaskell, C.J.; Morgan, K.L.; Gaskell, R.M. A Study of Feline Upper Respiratory Tract Disease with Reference to Prevalence and Risk Factors for Infection with Feline Calicivirus and Feline Herpesvirus. J. Feline Med. Surg. 2000, 2, 123–133. [Google Scholar] [CrossRef] [PubMed]
- Magouz, A.; Lokman, M.S.; Albrakati, A.; Elmahallawy, E.K. First Report of Isolation and Molecular Characterization of Felid Herpesvirus-1 from Symptomatic Domestic Cats in Egypt. Vet. Sci. 2022, 9, 81. [Google Scholar] [CrossRef]
- Foster, S.F.; Barrs, V.R.; Martin, P.; Malik, R. Pneumonia associated with Mycoplasma spp in three cats. Aust. Vet. J. 1998, 76, 460–464. [Google Scholar] [CrossRef] [PubMed]
- Helps, C.; Reeves, N.; Egan, K.; Howard, P.; Harbour, D. Detection of Chlamydophila felis and feline herpesvirus by multiplex real-time PCR analysis. J. Clin. Microbiol. 2003, 41, 2734–2736. [Google Scholar] [CrossRef]
- Hartmann, A.; Hartmann, K. Treatment and management of Chlamydophila felis infections in cats. Tierärztliche Praxis. Ausg. K Kleintiere/Heimtiere 2010, 38, 217–226. [Google Scholar] [CrossRef]
- Hoskins, J.D.; Williams, J.; Roy, A.F.; Peters, J.C.; McDonough, P. Isolation and characterization of Bordetella bronchiseptica from cats in southern Louisiana. Vet. Immunol. Immunopathol. 1998, 65, 173–176. [Google Scholar] [CrossRef] [PubMed]
- Foley, J.E.; Rand, C.; Bannasch, M.J.; Norris, C.R.; Milan, J. Molecular epidemiology of feline bordetellosis in two animal shelters in California, USA. Prev. Vet. Med. 2002, 54, 141–156. [Google Scholar] [CrossRef]
- Cai, Y.; Fukushi, H.; Koyasu, S.; Kuroda, E.; Yamaguchi, T.; Hirai, K. An Etiological Investigation of Domestic Cats with Conjunctivitis and Upper Respiratory Tract Disease in Japan. J. Vet. Med. Sci. 2002, 64, 215–219. [Google Scholar] [CrossRef]
- Meli, M.L.; Berger, A.; Willi, B.; Spiri, A.M.; Riond, B.; Hofmann-Lehmann, R. Molecular detection of feline calicivirus in clinical samples: A study comparing its detection by RT-qPCR directly from swabs and after virus isolation. J. Virol. Methods 2018, 251, 54–60. [Google Scholar] [CrossRef]
- Campillay-Véliz, C.P.; Carvajal, J.J.; Avellaneda, A.M.; Escobar, D.; Covián, C.; Kalergis, A.M.; Lay, M.K. Human Norovirus Proteins: Implications in the Replicative Cycle, Pathogenesis, and the Host Immune Response. Front. Immunol. 2020, 11, 961. [Google Scholar] [CrossRef] [PubMed]
- Fu, R.; Sha, Y.; Xu, X.; Liu, S.-B. Advancements in the loop-mediated isothermal amplification technique for the rapid detection of plant viruses in various crops. Physiol. Mol. Plant Pathol. 2024, 130, 102229. [Google Scholar] [CrossRef]
- Sahoo, P.R.; Sethy, K.; Mohapatra, S.; Panda, D. Loop mediated isothermal amplification: An innovative gene amplification technique for animal diseases. Vet. World 2016, 9, 465–469. [Google Scholar] [CrossRef] [PubMed]
- Panno, S.; Matic, S.; Tiberini, A.; Caruso, A.G.; Bella, P.; Torta, L.; Stassi, R.; Davino, A.S. Loop Mediated Isothermal Amplification: Principles and Applications in Plant Virology. Plants 2020, 9, 461. [Google Scholar] [CrossRef]
- Lin, M.; Li, Z.; Lin, Q.; Wang, P.; Liu, W.; Yuan, J.; Hong, Z.; Chen, Y. Development and clinical application of a rapid and visual loop-mediated isothermal amplification test for tetM gene in Clostridioides difficile strains cultured from feces. Int. J. Infect. Dis. 2022, 122, 676–684. [Google Scholar] [CrossRef] [PubMed]
Primer Name | Sequence (5′-3′) | Ref. |
---|---|---|
FCV-F3 a | GACCCYRATCTGCCTCTA | This work |
FCV-B3 a | TTGACRCTGGTRTGRAAKG | |
FCV-FIP a (F1c-F2) | CRATSACRCCRCCAACCAT-TCGACTYGAGGCKGATG | |
FCV-BIP a (B1c-B2) | GARCCYAGYGCCCARATGTC-TCCCAYTCAGARTCRACRC | |
FCV-LF a | CRGGTGMYGTGATWGACCC | |
FCV-LB a | GCWGCTGATATGGCCACMGG | |
FCV-Cali1 b | CAACCTGCGCTAACGTGCTTA | [24] |
FCV-Cali2 b | CAGTGACAATACACCCAGAAG | |
FCV-Cali3 c | TGGTGATGATGAATGGGCATC | |
FCV-Cali4 c | ACACCAGAGCCAGAGATAGA |
Method | Detection Limit |
---|---|
RT-LAMP | 14.3 × 101 copies/μL |
Nested PCR | 11.8 × 101 copies/μL |
Conventional PCR | 11.8 × 102 copies/μL |
Result | No. of Samples with Indicated Results Based on | ||
---|---|---|---|
RT-LAMP | Nested PCR | Conventional PCR | |
Positive | 17 | 17 | 1 |
Negative | 37 | 37 | 53 |
Total | 54 | 54 | 54 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khamsingnok, P.; Rapichai, W.; Rattanasrisomporn, A.; Rungsuriyawiboon, O.; Choowongkomon, K.; Rattanasrisomporn, J. Comparison of PCR, Nested PCR, and RT-LAMP for Rapid Detection of Feline Calicivirus Infection in Clinical Samples. Animals 2024, 14, 2432. https://doi.org/10.3390/ani14162432
Khamsingnok P, Rapichai W, Rattanasrisomporn A, Rungsuriyawiboon O, Choowongkomon K, Rattanasrisomporn J. Comparison of PCR, Nested PCR, and RT-LAMP for Rapid Detection of Feline Calicivirus Infection in Clinical Samples. Animals. 2024; 14(16):2432. https://doi.org/10.3390/ani14162432
Chicago/Turabian StyleKhamsingnok, Piyamat, Witsanu Rapichai, Amonpun Rattanasrisomporn, Oumaporn Rungsuriyawiboon, Kiattawee Choowongkomon, and Jatuporn Rattanasrisomporn. 2024. "Comparison of PCR, Nested PCR, and RT-LAMP for Rapid Detection of Feline Calicivirus Infection in Clinical Samples" Animals 14, no. 16: 2432. https://doi.org/10.3390/ani14162432