Next Article in Journal
Carapace Morphology Variations in Captive Tortoises: Insights from Three-Dimensional Analysis
Previous Article in Journal
Common Causes for Veterinary Visits among Australian Wildlife
Previous Article in Special Issue
Effects of Thyroid Powder on Tadpole (Lithobates catesbeiana) Metamorphosis and Growth: The Role of Lipid Metabolism and Gut Microbiota
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 18
10.3390/ani14182663
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae

by
Graciela María Pérez-Jiménez
1,
Carina Shianya Alvarez-Villagomez
1,
Marcel Martínez-Porchas
2,
Estefanía Garibay-Valdez
2,
César Antonio Sepúlveda-Quiroz
1,3,
Otilio Méndez-Marín
1,
Rafael Martínez-García
1,
Ronald Jesús-Contreras
1,
Carlos Alfonso Alvarez-González
1,* and
Susana del Carmen De la Rosa-García
4,*
1
Laboratorio de Fisiología en Recursos Acuáticos (LAFIRA), División Académica de Ciencias Biológicas, Universidad Juárez Autónoma de Tabasco, Carretera Villahermosa-Cárdenas Km. 0.5, Villahermosa 86039, Tabasco, Mexico
2
Centro de Investigación en Alimentación y Desarrollo, A.C. Biología de Organismos Acuáticos, Hermosillo 83304, Sonora, Mexico
3
Instituto Tecnológico de Villahermosa, Tecnológico Nacional de México, Carretera Villahermosa-Frontera, Km. 3.5, Ciudad Industrial, Villahermosa 86010, Tabasco, Mexico
4
Laboratorio de Microbiología Aplicada (LABMIA), División Académica de Ciencias Biológicas, Universidad Juárez Autónoma de Tabasco, Carretera Villahermosa-Cárdenas Km. 0.5, Villahermosa 86039, Tabasco, Mexico
*
Authors to whom correspondence should be addressed.
Animals 2024, 14(18), 2663; https://doi.org/10.3390/ani14182663
Submission received: 10 August 2024 / Revised: 28 August 2024 / Accepted: 4 September 2024 / Published: 13 September 2024
(This article belongs to the Special Issue Fish Nutrition, Physiology and Management)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Microorganisms isolated from the intestinal microbiota of fish have demonstrated probiotic effects. Considering their beneficial impact on aquaculture, it is essential to develop feeding strategies that ensure the growth and health of aquaculture animals using isolated strains from fish. This study evaluated the effects of the administration of Lactococcus lactis PH3-05, a probiotic bacterium isolated from tropical gar adults (Atractosteus tropicus), on the growth, survival, digestion, intestinal morphology, gene expression, and intestinal microbiota of larvae of the same species. The results showed that supplementation with L. lactis PH3-05 significantly improved growth, survival, and digestive enzyme activity. In addition, this supplementation stimulated the expression of genes associated with the mucosal barrier and the anti-inflammatory response. Although no significant changes were observed in the overall composition of the intestinal microbiota, an increase in the abundance of Lactobacillus was recorded in the group treated with L. lactis. These findings suggest that L. lactis has potential as an indigenous probiotic to improve the health and growth of tropical gar larvae and could be implemented for native species of the region.

Abstract

Probiotics in aquaculture hold promise for enhancing fish health and growth. Due to their increased specificity and affinity for their host, indigenous probiotics may offer isolated and potentially amplified benefits. This study investigated the effects of Lactococcus lactis PH3-05, previously isolated from adults of tropical gar (Atractosteus tropicus), on the growth, survival, digestive enzyme activity, intestinal morphology, expression of barrier and immune genes, and intestinal microbiota composition in the larvae of tropical gar. Larvae were fed with live L. lactis PH3-05 concentrations of 104, 106, and 108 CFU/g for 15 days alongside a control diet without probiotics. Higher concentrations of L. lactis PH3-05 (106 and 108 CFU/g) positively influenced larval growth, increasing hepatocyte area and enterocyte height. The 106 CFU/g dose significantly enhanced survival (46%) and digestive enzyme activity. Notably, the 108 CFU/g dose stimulated increased expression of muc-2 and il-10 genes, suggesting enhanced mucosal barrier function and anti-inflammatory response. Although L. lactis PH3-05 did not significantly change the diversity, structure, or Phylum level composition of intestinal microbiota, which was constituted by Proteobacteria, Bacteroidota, Chloroflexi, and Firmicutes, an increase in Lactobacillus abundance was observed in fish fed with 106 CFU/g, suggesting enhanced probiotic colonization. These results demonstrate that administering L. lactis PH3-05 at 106 CFU/g promotes growth, survival, and digestive health in A. tropicus larvae, establishing it as a promising indigenous probiotic candidate for aquaculture applications.

1. Introduction

The growing demand for fish products has propelled aquaculture to the forefront of global food production to meet human needs [1]. In this context, ensuring the growth of fish during their culture, particularly in the technification processes, is crucial, which necessitates safeguarding the health of the organisms [2,3,4]. Therefore, the recent utilization of pre-and probiotics in balanced feeds as a more suitable alternative to boost the immune system and optimize the intestinal microbiome is significant. This approach has been reported to enhance digestive physiology, increase survival, and improve the health of organisms in culture [5,6,7,8]. The most used probiotic bacteria in aquaculture, many of them indigenous, belong to the genera Bifidobacterium, Enterococcus, Bacillus, Lactobacillus, Lactococcus, Leuconostoc, Pediococcus and Weissella, which have been isolated from the intestinal system of various fish species [9,10,11].
Among all the probiotic bacterial species, Lactococcus lactis stands out as one of the most promising. It is a lactic acid bacterium commonly found in the gastrointestinal tract of many fish species and possesses characteristics that make it a suitable probiotic. It can produce antimicrobial compounds, improve digestibility and nutrient absorption, and modulate immune responses, all contributing to improved fish health [12,13,14,15]. Additionally, this bacterium produces bacteriocins and enhances the biosynthesis of essential amino acids, further promoting fish health [16,17,18]. Given these characteristics, L. lactis holds great potential as an excellent probiotic candidate to promote the well-being of aquatic organisms.
Based on the above, several studies have shown that the inclusion of L. lactis has beneficial effects on survival, weight gain, and disease resistance by improving the immune system, increasing mucosal production, and enhancing intestinal microbial richness and diversity in different fish species. Notably, in the case of Seriola dumerili [19], the administration of L. lactis at a dose of 1010 CFU/g stimulated growth and reduced feed intake. In red seabream (Pagrus major), L. lactis (109 CFU/g) promoted a significant increase in weight, weight gain (WG), specific growth rate (SGR), protein efficiency (PER) and survival, in addition to modulating the intestinal microbiota and strengthening the immune system [20]. Similar results have been obtained in common carp (Cyprinus carpio), where L. lactis (108 CFU/g) improved immunity, resistance to pathogens, and productive parameters [21]. Likewise, in orange-spotted grouper (Epinephelus codes) and bastard halibut (Paralichthys olivaceous), supplementation with L. lactis has been shown to improve intestinal microbial diversity, intestinal barrier function, and growth [22,23].
In Southeastern Mexico, tropical gar (Atractosteus tropicus), a native ancestral fish species of economic and ecological importance, has been commercially cultivated for over 20 years [24]. As part of the development of balanced feeds and their optimization, the inclusion of various prebiotics (inulin, fructo-oligosaccharide, mannan-oligosaccharides, and β-glucans) has been evaluated, which have shown diverse beneficial effects in larvae and juveniles [25,26,27,28,29,30]. Additionally, in juvenile A. tropicus, only the probiotic yeast Debaryomyces hansenii has been evaluated, where no positive effects on growth and physiological variables were observed when included in high concentrations (1014, 1015, and 1016 CFU/Kg feed) in the balanced feed [31]. However, the use of probiotics during the larval stage in A. tropicus has not been evaluated. It is important to note that in A. tropicus, the larval stage shows variable survival rates, possibly due to several factors, such as the low adaptation to balanced food in the weaning process and the high cannibalism that occurs during this period [32,33,34]
On the other hand, a significant study is the one conducted by Méndez-Pérez [35], who characterized the intestinal microbial composition of juvenile and adult A. tropicus, where some bacterial species with probiotic potential were identified, such as Cetobacterium, Aeromonas hydrophila P5, Aeromonas sobria CP DC28, and Lactococcus lactis. This last bacterium was isolated and characterized as a suitable probiotic. Thus, this study evaluated the effects of adding Lactococcus lactis into weaning food on the growth, survival, digestive enzyme activity, gut morphology, and gene expression of A. tropicus larvae.

2. Materials and Methods

2.1. Indigenous Bacteria of A. tropicus

The Applied Microbiology Laboratory (DACBiol-UJAT) provided Lactococcus lactis PH3-05, which was isolated from the intestine of an adult male of A. tropicus (Gene Bank OK178269).

2.2. Obtaining the Bacterial Biomass

Biomass was obtained by a 72h culture in Brain Heart Infusion broth (BHI, Difco, Pittsburgh, PA, USA) with shaking at 140 rpm at 32 °C. The culture was centrifuged at 4000 rpm for 40 min, and the cell pellet was washed twice with sterile saline. The Colony-Forming Units (CFU) of the biomass obtained were quantified [36], and the number of CFU per g of wet biomass was reported. The antagonistic activity of Lactococcus lactis PH3-05 against pathogenic strains of fish was previously tested (Table S1).

2.3. Preparation of Experimental Diets

Four experimental diets were formulated following the protocol of [27]. Three diets were supplemented with L. lactis PH3-05 at 104, 106, and 108 CFU/g concentrations, and a control diet without probiotics (CD) (Table 1). The diets were prepared following the methodology of [37], and the bacteria were incorporated into the diets by dissolving the biomass in 200 mL of sterile water. The pelleted diets were dried at 40 °C for 15 h in a conventional oven and stored at 4 °C until use. The physical characteristics of the experimental diets were subjected to a grinding and sieving process to obtain an adequate particle size (500–800 µm) specifically for the morphological characteristics of the larvae’s mouth, as well as their nutritional requirements in terms of hardness and floatability.
All diets were analyzed for proximate analysis (humidity, ash, lipid, and protein) according to [38].

2.4. Viability of L. lactis PH3-05 in the Experimental Diets

At the beginning and end of the experiment, the CFU/g of bacteria in each experimental diet were quantified to confirm the concentrations and viability. A representative sample was obtained from each diet using the quartering method. One g of the diet was weighed and suspended in 9 mL of saline (0.85%), and exponential dilutions were made from 10−1 to 10−10. An amount of 100 µL of the different dilutions was inoculated in Agar (BHI) and added with an antifungal (natamycin) to reduce the fungi load in the formulated food. The inoculum was homogeneously dispersed with the help of a sterile Drigalsky loop; the plates were incubated for 24 h at 32 °C. Colonies were counted in dilution boxes with 10–30 colonies, and the CFU/g feed was calculated.

2.5. Experimental Design

This experimental design used 1200 A. tropicus larvae 5 days after hatching (DAH), with an average weight of 0.02 ± 0.00 g and total length of 1.81 ± 0.18 cm, obtained from the aquaculture farm “Otot Ibam”, Comalcalco, Tabasco. A total of 100 larvae per treatment were placed in 12 tanks of 70 L capacity, connected to a recirculation system driven by a 1HP water pump connected to a 1500 L reservoir with a biological filter and an automated sand filter and connected to an ultraviolet light lamp to minimize the possible bacterial discharge. Vat temperature (27.1 ± 0.1 °C), dissolved oxygen (5.5 ± 0.2 mg/L), and pH (7.3 ± 0.5) were monitored daily using an oximeter (YSI 85, Yellow Springs, OH, USA) and a potentiometer (HANNA HI 991001, Woonsocket, RI, USA).
Feeding was carried out with co-feeding during the first 5 DAH, providing Artemia sp. nauplii and microparticles of the experimental diets, including the control diet (approx. 350 μm); subsequently, the nauplius supply was eliminated, and only the balanced diets were administered until the end of the bioassay (20 DAH), adjusting the size of the microparticles according to the larvae growth (500–800 µm). Larvae were fed six times daily (00:00, 3:00, 7:00, 11:00, 15:00, and 19:00) until apparent satiation. Each tube was cleaned with partial water replacement daily (30%) after each feeding using the siphoning method. All treatments were evaluated in triplicate.

2.6. Evaluation of Growth and Survival Rate

At the beginning and end of the experiment, each larva was evaluated to determine the wet weight (g) with an analytical balance (Ohaus HH120, precision 120 ± 0.01 g, Shenzhen, China) and total length using photographs analyzed in ImageJ 1.5 software. At the end of the bioassay, the following productive parameters were determined: specific growth rate (SGR), [(ln final weight − ln initial weight)/days] × 100; weight gain (WG), final weight (g) − initial weight (g); and survival rate (S), (number of final fish/number of initial fish) × 100.

2.7. Sample Collection

At the end of the bioassay, the larvae were sacrificed by thermal shock. The head and tail were removed, and the larvae were washed with water. To ensure representativeness, the following samples were obtained per replicate. Three larvae were kept at −80 °C to determine enzyme activity. Three larvae were preserved in RNAse-free tubes for metagenomic analysis, three for gene expression analysis (RNAlater solution, Ambion, Norristown, PA, USA), and three for histological analysis, which were fixed in Davison solution. The study was carried out under the Helsinki Declaration and the protocol authorized by the Ministry of Agriculture, Livestock, Rural Development, Fisheries and Food (SAGARPA), Mexico, NOM-062-Z00-1999 [39].

2.8. Enzyme Activities Quantification

The multienzyme extract was obtained from the pool of three larvae per replicate in 50 mM L−1 Tris-HCl, pH 7.5, using a tissue homogenizer (Ultra Turrex IKA T18 Basic, Staufen, Germany) and centrifuged at 14,000 rpm for 15 min. The supernatant was stored at −80 °C. Soluble protein was quantified using 50 µL Bradford as a substrate and quantified at 592 nm according to the Bradford technique [40]. Acid protease activity was quantified using 1% hemoglobin as a substrate in 0.1 M Glycine HCl buffer, pH 2. The absorbance was measured on a microplate reader (xMark, Bio-Rad, Hercules, CA, USA) at 280 nm, according to [41]. The technique of [42] determined alkaline protea with 1% casein as a substrate and 100 mM Tris-HCl and CaCl2 10 mM at pH 9, and absorbance was measured at 280 nm. Trypsin activity was quantified with 1 mM BAPNA as a substrate (Nα-Benzoyl-DL-Arginine-P-nitroanilide) in 50 mM Tris-HCl and 10 mM CaCl2 at pH 8.2, and absorbance was measured at 410 nm, according to the technique of [43]. Following the method of [44], chymotrypsin activity was determined, SAPNA 1.25 mM was used as a substrate (135 µL) at pH 8.2, and absorbance was measured at 410 nm. Lipase activity was performed with the methodology of [45] using 4-nitrophenyl palmitate as a substrate, pH 7.4, and 6 mM sodium taurocholate, and absorbance was measured at 540 nm. To quantify leucine aminopeptidase activity, 0.1 M leucine p-nitroanilide at pH 7.2 was used as a substrate and quantified at 405 nm absorbance, following the method of [46]. The activities of all enzymes were calculated with the following equations: (1) units per mL (U mL−1) = (Δabs × final volume of the reaction (mL)) × (MEC × time (min) × enzymatic extract volume (mL)−1); (2) units per mg of protein (U mg protein−1) = units per mL × mg of soluble protein−1, where MEC is the molecular extinction coefficient.

2.9. Histological Analysis

The samples were dehydrated in different concentrations of ethyl alcohol (50, 70, 80, 96, and 100%, OH 100%-Xylol). They were then embedded in paraffin. Cross sections of 7 µm thickness were obtained with a sliding microtome (Leica, Reichert-Jung, Hn40, Deer Park, IL, USA) and stained with hematoxylin and eosin (H-E). The slices were examined under a Zeiss optical microscope (Axio-star Plus, Oberkochen, Germany), the photographs were taken with a digital camera (Zeiss, Axiocam MRc 5, Oberkochen, Germany), and the morphometric measurements were taken with Zen 2.3 software. At the intestinal level, the height of the enterocytes (µm) and the number of fatty hepatocytes per area were quantified (50 and 30 measurements per individual, respectively).

2.10. RNA Extraction, Reverse Transcription, and Gene Expression Analysis

Total RNA was extracted using the Trizol technique (Invitrogen, Waltham, MA, USA) according to the manufacturer’s instructions. The concentration and purity of a single RNA were determined in a spectrophotometer (A260/280) (Jenway GenovaNano, Cole-Parmer, Staffordshire, UK). One microgram of RNA was reverse transcribed into cDNA in a thermal cycler (Mastercycle nexus GSX1, Eppendorf, Hamburg, Germany) using the High-Capacity cDNA Reverse Transcription Kit (Maxima First Strand cDNA Synthesis Kit for RT-qPCR, Thermo Scientific, Waltham, MA, USA) in a final volume of 20 µL, following the manufacturer’s recommendations. The expression of two genes associated with intestinal barrier integrity, muc-2 (intestinal mucus layer protein) and zo-2 (tight junction protein), and two immune system genes, il-8 (proinflammatory cytokine) and il-10 (anti-inflammatory cytokine), were evaluated (Table 2). The qPCR reactions were carried out using 5 µL of Eva Green supermix (BioRad, Hercules, CA, USA), 4.5 µL of cDNA, and 0.5 µL of primers mix (3 mM) at a final volume of 10 µL per reaction. The β-actin gene was used as a reference gene [47]. The qPCR was performed on a CFX96TM real-time thermocycler (BioRad, Hercules, CA, USA) using the following conditions: a 10 min denaturation cycle at 95 °C followed by 40 cycles of 15 s at 95 °C and 1 min at 60 °C. Relative gene expression changes were calculated using the 2−ΔΔCT method [48].

2.11. DNA Isolation from Gut Microbiota and Preparation of 16S rRNA Gene Libraries and Sequencing

Genomic DNA extractions were performed using a commercial kit (DNeasy PowerLyzer PowerSoil Kit, QIAGEN, Hilden, Germany). DNA concentration was quantified using the Qubit 3.0 fluorometer and the ds-DNA BR Assay kit (Invitrogen from Thermo Fisher Scientific). DNA integrity was verified by 1% agarose gel electrophoresis.
The V3 hypervariable region of the bacterial 16S rRNA gene was PCR amplified for library preparation using gene-specific primers V3-338f and 533r [49]. PCR amplification and second PCR were performed using the Nextera XT index (Illumina, San Diego, CA, USA). All PCR products were followed by an optimized clean-up step using Agencourt AMPure XP beads according to the protocol published by Illumina. Finally, V3 libraries were sequenced with a MiSeq v3 reagent kit (300 cycles) using the MiniSeq platform (Illumina, San Diego, CA, USA), and 2 × 150 cycles of paired-end sequencing were performed.

2.12. Data Analysis and Statistics

First, normality (Kolmogorov–Smirnov) and homoscedasticity (Bartlett) tests were performed on the growth data, digestive enzyme activities, and histological measurements, all meeting the required assumptions. Consequently, a one-way ANOVA followed by Tukey’s post hoc test was performed. The Kruskal–Wallis test and Nemenyi’s post hoc test were used for gene expression analyses to identify significant differences. All data were statistically analyzed using GraphPad Prism 8 software (GraphPad Software, San Diego, CA, USA) with a significance value of 0.05.

3. Results

3.1. Growth Indexes and Survival Rates

At the end of the bioassay (20 DAH), larvae fed with L. lactis PH3-05 108 CFU/g obtained the highest final weight (0.041± 0.00 g), followed by larvae with 106 CFU/g (0.040 ± 0.00 g) of L. lactis PH3-05. Both treatments showed significant differences (p < 0.05) with larvae fed with L. lactis PH3-05 104 CFU/g and CD (Table 3). The most significant total length was shown in larvae fed with all three L. lactis PH3-05 supplementations (p < 0.05); however, the 108 CFU/g treatment showed the greatest total length (2.38 ± 0.09 cm). SGR and WG were highest in larvae fed with the diets supplemented with 108 CFU/g of L. lactis PH3-05 (2.83 ± 0.003 and 52.14 ± 0.06, respectively), followed by those fed with 106 CFU/g (2.75 ± 0.15 and 50.33 ± 3.50, respectively) of L. lactis, showing significant differences (p < 0.05) with L. lactis 104 CFU/g and CD larvae. The highest survival rate was presented in the larvae of treatment 106 CFU/g of L. lactis PH3-05 with 46.36 ± 4.34%, showing significant differences (p < 0.05) with the rest of the treatments (Table 3).

3.2. Digestive Enzyme Activity

The specific activity of acid and alkaline protease was significantly higher in larvae fed with 106 CFU/g of L. lactis PH3-05 compared to the rest of the treatments (p < 0.05). Regarding CD, trypsin activity was higher (p < 0.05) in larvae fed 108 CFU/g of L. lactis PH3-05. On the other hand, larvae fed 104 and 106 CFU/g of L. lactis PH3-05 showed higher chymotrypsin activity than the rest of the treatments. Likewise, administering 106 CFU/g of L. lactis PH3-05 favored significantly (p < 0.05) higher lipase activity than the rest of the treatments. Finally, leucine aminopeptidase activity showed a significant increase for larvae fed with 104 CFU/g of L. lactis PH3-05 (p < 0.05) for those fed with CD (Table 4).

3.3. Histological Analysis

The livers of the larvae fed with 106 and 108 CFU/g of L. lactis showed a significantly higher percentage of melanomacrophagic centers (MMC) compared to those fed with the CD (p < 0.05) (Table 5). In the intestine, the height of enterocytes was significantly higher in larvae fed with 106 CFU/g of L. lactis (p < 0.05) compared to all other treatments, especially those fed with CD, which exhibited the lowest enterocyte height (Table 5, Figure 1a,b).

3.4. Gene Expression

The relative expression of muc-2 significantly increased (p < 0.05) in larvae fed with 104 and 106 CFU/g of L. lactis compared to the other treatments (Figure 2a). In contrast, zo-2 expression was significantly down-regulated (p < 0.05) in larvae across all three L. lactis supplementation groups (Figure 2b). Additionally, all three L. lactis supplementations induced a significant increase in il-8 expression (p < 0.05) compared to those fed with CD (Figure 2c). However, the relative expression of il-10 also showed a significant increase in larvae fed with 106 and 108 CFU/g of L. lactis (p < 0.05) compared to those fed with the other treatments (Figure 2d).

3.5. Classification and Taxonomy of the Bacterial Taxonomic Profile

The metagenomic analysis was conducted using 16S rRNA gene sequencing, yielding 765,724 sequences. After removing chimeras, 26,679 sequences were classified into 461 OTU (operational taxonomic units).
The alpha diversity indices are presented in Figure 3. According to Chao 1 (p < 0.0897), ACE (p < 0.1331), and Shannon–Weaver (p < 0.2260) estimators, there were no significant differences in alpha diversity larvae fed with the three L. lactis supplementations and the CD.
Figure 4 shows the composition of the intestinal microbiota of A. tropicus larvae, which consists of the phyla Proteobacteria, Bacteroidota, Firmicutes, Chloroflexi, and Desulfobacterota. Proteobacteria was the most dominant Phylum in all treatments. In this aspect, larvae fed 108 CFU/g of L. lactis PH3-05 showed the highest relative abundance of Proteobacteria with 78.92%, followed by those fed with CD (71.35%). In comparison, in larvae fed with 106 CFU/g of L. lactis PH3-05, the abundance was 58.20%, and finally, larvae fed with 104 CFU/g of L. lactis PH3-05 showed the lowest abundance of Proteobacteria with 49.85%.
The highest relative abundance of Bacteroidota was found in larvae fed with CD, with 13.53%, followed by larvae fed with 104 CFU/g of L. lactis, with 13.31%. Finally, the lowest relative abundances were presented in larvae fed with 106 CFU/g of L. lactis (8.14%) and 108 CFU/g of L. lactis (7.93%), respectively. The relative abundance of the phylum Firmicutes was highest in larvae fed 104 CFU/g of L. lactis (12.66%) and 106 CFU/g of L. lactis PH3-05 (7.58%). In contrast, larvae fed the CD and 108 CFU/g of L. lactis PH3-05 showed the lowest relative abundances (5.54% and 4.755%), respectively. The highest abundance of phylum Chloroflexi occurred in larvae fed with 106 CFU/g of L. lactis PH3-05 (14.62%) and 104 CFU/g of L. lactis (9.36%). Again, the lowest relative abundances were obtained with larvae fed with CD and 108 CFU/g of L. lactis (3.82% and 3.54%), respectively.
At the order level, Burkholderiales, Cytophagales, Bacteroidales, Sphinogomonadales, Pseudomonadales, and Lactobacilliales were the most representative in all treatments. The most representative families in all treatments were Oxalobacteraceae, Comamonadaceae, Sphinogomonadaceae, Anaerolineaceae, Pseudomonadaceae, Lactobacilliaceae, and Caulobacteraceae.
Figure 5 shows the relative abundance at the genus level of the intestinal microbiota of A. tropicus larvae, where the most representative genera are Masillia, Sphaerotilus, Vibrio, Sphingomonas, Runella, and, to a lesser extent, Pseudomonas, Lactobacillus, and Brevundimonas. Massillia has the highest relative abundance in larvae fed with 106 CFU/g of L. lactis, PH3-05 31.03%, followed by those fed 108 CFU/g of L. lactis PH3-05 (26.70%). In larvae fed with CD, 21.23% of relative abundance was obtained, and the lowest proportion was for larvae fed with 104 CFU/g of L. lactis PH3-05 (12.94%). The genus Vibrio was present only in larvae fed 108 CFU/g of L. lactis (18.36%) and those fed with CD (8.29%), respectively. The genus Runella presented 4.35% relative abundance in larvae fed with the CD and in smaller proportions in larvae fed with 104 CFU/g and 108 CFU/g of L. lactis (2.12% and 2.22%, respectively), while in larvae fed with 106 CFU/g of L. lactis PH3-05, the presence of this genus was not detected.
The highest relative abundance of the genus Lactobacillus was shown in larvae fed 106 CFU/g of L. lactis PH3-05 (4.29%), and the lowest relative abundance was observed in larvae fed 108 CFU/g of L. lactis PH3-05 (1.09%). Bacteria of the genus Pseudomonas showed a relative abundance of 6.38% in larvae fed with 106 CFU/g of L. lactis PH3-05 and the lowest abundance in larvae fed with 108 CFU/g of L. lactis PH3-05 (1.23%). The genus Sphingomonas recorded the highest relative abundance of the larvae fed with 104 CFU/g (3.82%), 106 CFU/g (6.33%), and 108 CFU/g (4.60%) of L. lactis, while the lowest relative abundance was detected in larvae fed with CD with 2.18%. Bacteria of the genus Brevundimonas presented the highest abundance in larvae fed with 106 CFU/g of L. lactis PH3-05 (3.44%), which decreased in larvae fed with 104 CFU/g (1.42%), CD (1.17%), and 108 CFU/g of L. lactis PH3-05 (1.02%).

3.6. Bacterial Community Structure through Beta Diversity

Our study, based on taxonomic assignment and a multivariate analysis of variance (PERMANOVA) with 4999 permutations, revealed a crucial finding: there were no significant differences in beta diversity indexes between the treatments with L. lactis PH3-05 and the CD.
Figure 6 illustrates the precision of our research methods through principal coordinate analyses (PCoA) with beta diversity indices. The Bray–Curtis similarity (Figure 6a) showed 51.94% clustering (p < 0.105), while the cumulative variance by JACCARD (Figure 6b) showed a value of 34.3% distance between treatments (p < 0.12). The metrics of phylogenetic distances through UNIFRAC presented values of 79.31% and 44.86% of the total variance in the weighted (WEIGHTED p < 0.0212) (Figure 6c) and unweighted (UNWEITHED p < 0.6596) (Figure 6d) analyses, respectively. These measurements confirm that none of the indices showed significant differences between the treatments with L. lactis and the CD.

3.7. Predicted Metabolic Functions of the Intestinal Microbiota from KEGG

An enhanced microbial function was detected in larvae fed with 108 CFU/g of L. lactis compared to those fed with the CD, as determined by Lefse analysis. Enrichment functions included bacterial chemotaxis, the biosynthesis of valine, leucine, and isoleucine, branched dibasic acid-C5 metabolism, flagellar assembly, fatty acid and lipopolysaccharide biosynthesis, pantothenate, and CoA synthesis. Additionally, functions related to D-glutamine and D-glutamate metabolism, biotin metabolism, lipid metabolism, carbon deposition via folate, peptidoglycan biosynthesis, and the sulfur relay system were also enriched. Conversely, larvae fed with the CD exhibited higher microbial functions related to ansamycin synthesis and the degradation of ketone bodies (Figure 7).

4. Discussion

4.1. Growth Indexes and Survival Rate

Probiotics have successfully impacted aquaculture and have been considered a functional feed additive for cultured organisms [50].
Thus, the administration of L. lactis PH3-05 has provided positive results in different fish species, such as Nile tilapia (Oreochromis niloticus), where higher WG and higher survival were obtained [51]. In bastard halibut (Paralichthys olivaceus), including a concentration of 108 CFU/mL favored higher weight gain, feed efficiency, SGR, PER, and condition factor [52]. Likewise, the administration of 108 CFU/g of L. lactis L19 improved the growth, WG, feed efficiency index, SGR, and PER in snakehead fish (Channa argus) [53]. Similarly, a 108 CFU/g concentration of L. lactis HNL12 in humpback grouper (Cromileptes altivelis) favored growth, total length, percentage weight gained, and SGR [54].
The proper administration of L. lactis improves the digestibility and absorption of nutrients provided in the diet, increasing productivity values and survival rates in several fish species [55,56]. In addition, it improves digestive enzymatic activities and promotes more significant growth and development of fish [57].
Because they produce short-chain fatty acids, which enterocytes use as an energetic substrate to maintain intestinal integrity, homeostasis, and digestive function, this result is consistent with our results by significantly promoting final weight, total length, SGR, WG, and survival in fish treated with 106 CFU/g.

4.2. Digestive Enzyme Activity

Certain probiotics, such as L. lactis, have been reported to play a crucial role in the digestion of macronutrients in balanced diets fed to fish, which has been linked to increased hydrolysis and improved nutrient absorption in some fish species [21,58,59]. The presence of L. lactis has also been reported to increase the digestive enzyme activity of fish, in addition to the complementary hydrolysis due to the action of exogenous bacterial enzymes, which favor the hydrolysis of macromolecules (proteins, lipids, and carbohydrates). Thus, the bacterial pre-hydrolysis of feed nutrients and increased digestive enzyme activity in fish improve their growth and enhance their metabolic functions [60,61]. Our study observed that administering 108 CFU/g of L. lactis PH3-05 in A. tropicus larvae significantly decreased digestive enzyme activity (acid protease, alkaline protease, chymotrypsin, lipase, and leucine aminopeptidase) compared to CD-fed larvae.
In this regard, the addition of probiotics has been shown to significantly improve the regulation of amino acids, fatty acids, vitamin metabolism, and digestive enzyme synthesis in fish, offering a promising avenue for enhancing fish nutrition [62]. It has also been shown that the metabolic processes of probiotics can produce exogenous enzymes that benefit the host organism by supplementing digestive enzyme activity and pre-digesting the feed provided to the fish, thereby improving nutrient absorption. However, improved absorption will depend on the appropriate concentration of the probiotic [63]. For example, the use of a probiotic consortium (Bacillus subtilis, Lactobacillus acidophilus, Clostridium butyricum, and the yeast Saccharomyces cerevisiae) in O. niloticus led to an increase in trypsin-like and amylase activities [64].
Similarly, the application of a commercial probiotic (PrimaLac®: L. acidophilus, Lactobacillus casei, Enterococcus faecium, and Bifidobacterium thermophilus) resulted in a significant increase in amylase, protease, and alpha-glucosidase enzyme activities in Caspian white fish (Rutilus frisii kutum) [65]. In the case of L. lactis, when administered in rainbow trout (Oncorhynchus mykiss), trypsin, lipase, and alkaline digestive protease enzyme activities were highly detected [64]. The same is observed in C. carpio, where digestive enzyme activity increased (amylase, lipase, and protease), along with several production parameters, immune system enzymes, and antioxidant activity [66].

4.3. Histological Analysis

Our research found that the use of L. lactis PH3-05 significantly increases the height of the enterocytes in A. tropicus larvae, allowing for a larger nutrient absorption area and, consequently, higher growth. These results align with findings in O. niloticus, where the administration of L. lactis (107−8 CFU/g diet) resulted in increased villi length and muscle layer thickness compared to a diet without probiotics [67]. Similarly, L. lactis administration (108 CFU/g) in the same species increased the density and length of intestinal microvilli compared to the control treatment [54]. In gilthead sea bream (Sparus aurata), the administration of L. lactis (2 and 5 × 109 CFU/kg) reduced intestinal inflammatory processes and improved microbial composition [68].
Additionally, the hepatocyte area in A. tropicus larvae increased with L. lactis (108 CFU/g). These results are consistent with those reported by [69], who observed in vitro that L. lactis increases hepatocyte proliferation and promotes liver cell protection in snakehead (Channa argus). Similarly, in O. niloticus, an increase in lipid accumulation in hepatocytes was observed with commercial probiotics (C.A. growth® and Tonolest®) [70]. Furthermore, our research detected an increase in the presence of MMC in the liver with L. lactis PH3-05 treatments. This finding coincides with observations in O. niloticus when a probiotic (Bacillus spp.) was administered, leading to increased MMC in the spleen. This response is related to the organism’s physiological reaction to the probiotic, which is perceived as a potential pathogen, thus activating the immune system to prevent possible infection [71].
Similarly, in O. niloticus, the number of MMC increased when a commercial symbiotic was supplied, and the fish were challenged with Pseudomonas fluorescens [72]. A similar increase in MMC was observed when juveniles of the same species were supplemented with the probiotic Pseudomonas putida and challenged with Aeromonas hydrophila [73]. Thus, the increase in MMC is associated with the presence of the probiotic and is maximized when fish are challenged with pathogenic bacteria. However, the A. tropicus larvae in our study were not challenged by any known pathogen. Therefore, further research is needed to explore the effect on immune capacity and its relationship with the increase in MMC in this species.

4.4. Gene Expression

Probiotics, known for their potential to modulate the immune system and gut microbiota and their promising antagonistic effect against pathogenic microorganisms [74], represent a significant area of interest in immune health research.
In A. tropicus larvae, the administration of L. lactis PH3-05 (104 and 106 CFU/g) resulted in a significant increase in the relative expression of muc-2, suggesting an enhancement of the protective intestinal barrier. More importantly, this increase also indicates an activation of the immune system, as the mucus layer is the first line of defense against the translocation of toxic or pathogenic organisms. This finding aligns with the observations of [75], who also noted a similar increase in muc-2 expression in response to a different stimulus. The mucus layer, secreted by goblet cells in the epidermis of fish, contains protective elements, such as glycoproteins, lysozymes, and immunoglobulins, among other antimicrobial compounds [76,77]. It serves multiple functions, including resistance and protection against infections, ionic and osmotic regulation, excretion, and nutrition absorption. This boost in mucus production can be interpreted as an active reinforcement of the immune system, highlighting the role of the mucus layer as the primary physical defense against harmful pathogens in the intestinal barrier.
On the other hand, the underexpression of the zo-2 gene in larvae fed with L. lactis PH3-05 is a significant finding. This under-expression may be promoting the synthesis of beneficial metabolites, such as bacteriocins, γ-aminobutyric acid, ornithine, exopolysaccharides, and mannitol, among others [78], thereby eliminating the need for larvae to express zo-2. As a result, larvae fed with L. lactis PH3-05 experienced better growth. This finding is particularly noteworthy as a decrease in the expression of the zo-2 gene has been reported to reduce intestinal function and can cause certain intestinal disorders in fish [79], which did not occur in A. tropicus. These results significantly enhance our understanding of the regulatory mechanisms of tight junction proteins, which are crucial in strengthening the intestinal barrier in A. tropicus in its larval stage.
Furthermore, the administration of L. lactis has been shown to improve the immune system directly [61]. In that sense, cytokines, the messenger proteins responsible for emitting the first warning signals of the immune system in response to harmful events, play a crucial role in the host organism’s defense [80,81]. Different strains of Lactobacillus and Bifidobacteria are known to release or increase the expression of il-8 or il-10 during normal mucosal conditions or inflammatory processes, helping to neutralize or prevent harmful stimuli [82]. In our study, A. tropicus larvae fed with L. lactis PH3-05 supplementation showed a higher expression of il-8, suggesting adaptation to the environment and a formulated diet and microbial colonization. In addition, it has been reported that certain strains of lactic acid bacteria can prevent an inflammatory response by activating the CD14 glycoprotein of epithelial cells [82].
Furthermore, the anti-inflammatory cytokine il-10 expression, vital for maintaining mucosal immune homeostasis in the intestinal tract [83], was significantly enhanced by L. lactis PH3-05 in A. tropicus larvae. Our results show a substantial increase in the expression of muc-2 (104 and 106 CFU/g) and il-10 (106 and 108 CFU/g) in A. tropicus larvae fed L. lactis, which is consistent with the findings from crucian carp (Carassius carassius) fed with L. lactis PH3-05 supplements. These carp showed a significant immune system response after exposure to Aeromonas hydrophila, marked by increased expression of anti-inflammatory interleukin (il-11) and the gene related to the reinforcement of the intestinal barrier (zo-1). The overexpression of INF-γ, IL-1β, and TNF-α further indicates that L. lactis administration effectively reduces intestinal inflammation caused by exposure to pathogen bacteria [84]. The high resistance to pathogenic bacteria is attributed to the probiotic ability of L. lactis PH3-05 to modulate the immune system by releasing certain antimicrobial compounds. Also, il-11 expression suggests that the organism can protect and restore the gastrointestinal mucosa [85]. In Nile tilapia (Oreochromis niloticus), the inclusion of L. lactis strengthens the immune system, leading to increased expression of immune-related genes, specifically tumor necrosis factor (TNF-α) and interferon-gamma (IFN-γ), after exposure to the pathogen Streptococcus agalactiae [54]. This promising result opens potential applications of L. lactis PH3-05 in enhancing immune responses. However, the interaction between the gut microbiota and the immune system also involves specific metabolites secreted by the microbiota, which are absorbed by enterocytes and transported to the bloodstream and systemic lymphoid tissues. These metabolites can regulate host immune responses, play roles in inflammatory signaling, and interact directly or indirectly with host immune cells [86].

4.5. Gut Microbiome

The gut microbiome’s microorganisms play essential roles in various metabolic, physiological, and immunological functions with the host organism [14].
Administering L. lactis PH3-05 (106 CFU/g) to A. tropicus larvae promotes an increase in the abundance of Lactobacillus in the intestinal microbiota. Previous studies [35] characterized the gut microbial composition of A. tropicus in both female and male juveniles and adults. The overall results showed that Fusobacteria is the most dominant phylum (42.26%), followed by Proteobacteria (31.40%), Firmicutes (12.96%), and Bacteroides (11.79%). Therefore, it can be considered a central gut microbial composition in A. tropicus at these stages. However, our results showed that the larval stage of A. tropicus is mainly composed of Proteobacteria and Bacteroides. The presence and function of Proteobacteria have been reported to increase the expression of genes related to RNA processing, degradation, the outer membrane, and lipopolysaccharide synthesis [87], which play roles in degrading Gram-negative (often pathogenic) microorganisms and enhancing the immune system. Bacteria belonging to the phyla Bacteroidetes and Proteobacteria could enhance metabolic and immune function and induce immune responses in the host, suggesting a possible relationship between these phyla and fish growth and immunity [88]. Additionally, the abundance of Proteobacteria may contribute to digestive functions in healthy fish [6].
This finding underscores the importance of our study in understanding the bacterial community structure. In this context, our research on A. tropicus larvae has revealed intriguing findings that open new avenues for further exploration. The Proteobacteria genus, particularly Massillia and Sphaerotilus, showed the highest abundance, while potentially harmful genera like Vibrio and Aeromonas decreased. This finding suggests potential future studies to further explore these genera’s role in the larvae’s microbiome. Similarly, Nile tilapia fed an experimental diet containing L. lactis PH3-05 (108 CFU/g) showed the highest abundance of the Proteobacteria phylum [54]. It has also been documented that bacteria from the Bacteroidetes and Proteobacteria groups may originate from the aquatic environment [88]. The Bacteroidetes phylum of bacteria readily assimilates dietary carbohydrates, as members of this genus possess metabolic pathways to utilize them [89]. The genus Sphingomonas has been reported as an environmental microorganism, not as part of the gastrointestinal tract [90]. We consider that the presence of Sphingomonas in A. tropicus larvae results from the experiment’s surrounding environment and that it is displaced by bacteria belonging to the genera Massillia and Sphaerotilus, which showed the highest abundance and could be considered part of the indigenous microbiota during colonization. However, we do not yet know whether the gut microbial composition of A. tropicus larvae can be classified as autochthonous or allochthonous. Nevertheless, we can consider that the administration of L. lactis PH3-05 (108 CFU/g) favored the abundance of proteobacteria in larvae fed with lower doses and the CD.
Our study provides new insights into the metabolic functions of gut microorganisms in A. tropicus. The identification of metabolic pathways related to carbohydrate (the lactic fermentation of hexoses and pentoses), waste (the Leloir pathway), and protein (proteolytic degradation and peptide transport) metabolism. Furthermore, the ability to synthesize lipids from fatty acids was discovered. Therefore, these findings contribute to a better understanding of the interaction between gut microorganisms and the physiology of tropical gar.
As can be seen, L. lactis PH3-05 can modify the microbiome and alter the abundance of bacteria from the phyla Bacterioides and Proteobacteria, particularly of the genera Massillia, Sphaerotilus, and Sphingomonas, enabling various pathways to manifest. These include (1) bacterial chemotaxis, allowing bacteria to move in response to nutrient gradients and other environmental stimuli [91]; (2) flagellar assembly, a transcriptional and post-transcriptional process that enables bacteria to move towards tissue colonization sites and perform multiple functions in host communication [92]; (3) fatty acid biosynthesis, revealing the diversity of the organization of the pfa genes, coding for a polyunsaturated fatty acid synthase complex [93]; (4) the biosynthesis of valine, leucine, and isoleucine, which are considered suitable targets for developing antibacterial agents [94]; and (5) the metabolism of dibasic acid C5-triphosphate, where a complex pathway has been described in different bacteria [95]. These findings reflected changes in the microbiome and enhanced A. tropicus PH3-05 larvae growth when fed with L. lactis (106−8 CFU/g).

5. Conclusions

Feeding A. tropicus larvae with live L. lactis PH3-05, isolated as part of the native microbiome, significantly improves production values, digestive morphology, digestive enzyme activity, and immune system gene expression. Additionally, this probiotic modulates and strengthens various metabolic pathways of the microbiome, showing highly significant results when using doses of 106−8 CFU/g in balanced feeds during weaning in the larval period. It is demonstrated that L. lactis PH3-05 can be considered a highly efficient probiotic that improves larval culture.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14182663/s1, Table S1: Antagonistic activity of Lactococcus lactis PH3-05 against pathogenic strains of fish.

Author Contributions

Conceptualization, C.S.A.-V., S.d.C.D.l.R.-G. and C.A.A.-G.; methodology, G.M.P.-J., C.A.S.-Q., O.M.-M. and R.J.-C.; software G.M.P.-J., E.G.-V., C.A.S.-Q. and M.M.-P.; validation, C.S.A.-V., S.d.C.D.l.R.-G., C.A.A.-G. and M.M.-P.; formal analysis, C.A.S.-Q., C.A.A.-G. and C.S.A.-V.; investigation, C.A.A.-G., C.S.A.-V. and S.d.C.D.l.R.-G.; resources, C.A.A.-G. and S.d.C.D.l.R.-G.; data curation, G.M.P.-J. and C.A.S.-Q.; writing—original draft preparation, G.M.P.-J., C.A.S.-Q. and C.A.A.-G.; writing—review and editing, M.M.-P., E.G.-V. and R.M.-G.; visualization, R.M.-G.; supervision, C.A.A.-G., C.S.A.-V. and S.d.C.D.l.R.-G.; project administration, C.A.A.-G. and S.d.C.D.l.R.-G.; funding acquisition, C.A.A.-G. and S.d.C.D.l.R.-G. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by CONAHCYT “Estudio de la fisiología digestiva en larvas y juveniles de pejelagarto (Atractosteus tropicus) con base en técnicas histológicas, bioquímicas y moleculares” CB-2016-01-282765. Relación sinérgica entre la antroponización y el proceso de invasion del bagre armado en el río Usumacinta CF-2023-G-956 and the author is grateful for the Grant provided by the National Council of Humanities, Sciences and Technology of Mexico (CONAHCYT) for postgraduate studies (CVU:833118).

Institutional Review Board Statement

The study was conducted following the Declaration of Helsinki, and the protocol was approved by Secretaría de Agricultura, Ganadería, Desarrollo Rural, Pesca y Alimentación (NOM-062-ZOO-1999, 2001) [39].

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available upon request from the corresponding authors.

Acknowledgments

The authors thank Ignacio Bautista-García and José Yael Trejo-Sánchez from LAFIRA-DACBiol and LABMIA (DACBiol).

Conflicts of Interest

The authors declare no conflicts of interest.

References

  1. FAO (Food and Agriculture Organization of the United Nations). The State of World Fisheries and Aquaculture 2020; FAO: Rome, Italy, 2020. [Google Scholar] [CrossRef]
  2. Reinoso, S.; Gutiérrez, M.S.; Domínguez-Borbor, C.; Argüello-Guevara, W.; Bohórquez-Cruz, M.; Sonnenholzner, S.; Nova-Baza, D.; Mardones, C.; Navarrete, P. Selection of Autochthonous Yeasts Isolated from the Intestinal Tracts of Cobia Fish (Rachycentron canadum) with Probiotic Potential. J. Fungi 2023, 9, 274. [Google Scholar] [CrossRef] [PubMed]
  3. Reda, R.M.; Selim, K.; El-Sayed, H.M.; El-Hady, M.A. In Vitro Selection and Identification of Potential Probiotics Isolated from the Gastrointestinal Tract of Nile Tilapia, Oreochromis niloticus. Probiotics Antimicrob. Proteins 2017, 10, 692–703. [Google Scholar] [CrossRef] [PubMed]
  4. Rohani, M.F.; Islam, S.M.; Hossain, M.K.; Ferdous, Z.; Siddik, A.; Nuruzzaman, M.; Padeniya, U.; Brown, C.L.; Shahjahan, M. Probiotics, prebiotics and synbiotics improved the functionality of aquafeed: Upgrading growth, reproduction, immunity and disease resistance in fish. Fish Shellfish Immunol. 2022, 120, 569–589. [Google Scholar] [CrossRef] [PubMed]
  5. Galdeano, C.M.; Cazorla, S.I.; Dumit, M.L.; Del Mar Vélez, M.; Perdigón, G. Beneficial Effects of Probiotic Consumption on the Immune System. Ann. Nutr. Metab. 2019, 74, 115–124. [Google Scholar] [CrossRef]
  6. Nayak, S. Probiotics and immunity: A fish perspective. Fish Shellfish Immunol. 2010, 29, 2–14. [Google Scholar] [CrossRef]
  7. Pérez-Sánchez, T.; Ruiz-Zarzuela, I.; De Blas, I.; Balcázar, J.L. Probiotics in aquaculture: A current assessment. Rev. Aquac. 2013, 6, 133–146. [Google Scholar] [CrossRef]
  8. Ringø, E.; Harikrishnan, R.; Soltani, M.; Ghosh, K. The effect of gut microbiota and probiotics on metabolism in fish and shrimp. Animals 2022, 12, 3016. [Google Scholar] [CrossRef]
  9. Valipour, A.; Nedaei, S.; Noori, A.; Khanipour, A.; Hoseinifar, S.H. Dietary Lactobacillus plantarum affected on some immune parameters, air-exposure stress response, intestinal microbiota, digestive enzyme activity and performance of narrow clawed crayfish (Astacus leptodactylus, Eschscholtz). Aquaculture 2019, 504, 121–130. [Google Scholar] [CrossRef]
  10. Yi, Y.; Zhen-Hua, Z.; Zhao, F.; Liu, H.; Yu, L.; Zha, J.; Wang, G. Probiotic potential of Bacillus velezensis JW: Antimicrobial activity against fish pathogenic bacteria and immune enhancement effects on Carassius auratus. Fish Shellfish Immunol. 2018, 78, 322–330. [Google Scholar] [CrossRef]
  11. Srirengaraj, V.; Razafindralambo, H.; Rabetafika, H.; Nguyen, H.T.; Sun, Y. Synbiotic Agents and Their Active Components for Sustainable Aquaculture: Concepts, Action Mechanisms, and Applications. Biology 2023, 12, 1498. [Google Scholar] [CrossRef]
  12. Bolotin, A.; Wincker, P.; Mauger, S.; Jaillon, O.; Malarme, K.; Weissenbach, J.; Ehrlich, S.D.; Sorokin, A. The Complete Genome Sequence of the Lactic Acid Bacterium Lactococcus lactis ssp. lactis IL1403. Genome Res. 2001, 11, 731–753. [Google Scholar] [CrossRef] [PubMed]
  13. Lee, S.H.; Beck, B.R.; Hwang, S.; Song, S.K. Feeding olive flounder (Paralichthys olivaceus) with Lactococcus lactis BFE920 expressing the fusion antigen of Vibrio OmpK and FlaB provides protection against multiple Vibrio pathogens: A universal vaccine effect. Fish Shellfish Immunol. 2021, 114, 253–262. [Google Scholar] [CrossRef]
  14. Ray, A.K.; Ghosh, K.S.; Ringø, E. Enzyme-producing bacteria isolated from fish gut: A review. Aquac. Nutr. 2012, 18, 465–492. [Google Scholar] [CrossRef]
  15. Zhu, C.; Liu, D.; Chen, W.; Ban, S.; Liu, T.; Huang, W.; Jiang, M. Effects of dietary host-associated Lactococcus lactis on growth performance, disease resistance, intestinal morphology and intestinal microbiota of mandarin fish (Siniperca chuatsi). Aquaculture 2021, 540, 736702. [Google Scholar] [CrossRef]
  16. Goupil-Feuillerat, N.; Cocaign-Bousquet, M.; Godon, J.; Ehrlich, S.D.; Renault, P. Dual role of alpha-acetolactate decarboxylase in Lactococcus lactis subsp. lactis. J. Bacteriol. 1997, 179, 6285–6293. [Google Scholar] [CrossRef]
  17. Kaktcham, P.M.; Piame, L.T.; Sileu, M.S.; Kouam, M.F.; Temgoua, J.; Ngoufack, F.Z.; de Lourdes Pérez-Chabela, M. Bacteriocinogenic Lactococcus lactis subsp. lactis 3MT isolated from freshwater Nile Tilapia: Isolation, safety traits, bacteriocin characterisation, and application for biopreservation in fish pâté. Arch. Microbiol. 2019, 201, 1249–1258. [Google Scholar] [CrossRef] [PubMed]
  18. Sperandio, B.; Polard, P.; Ehrlich, D.; Renault, P.; Guédon, É. Sulfur Amino Acid Metabolism and Its Control in Lactococcus lactis IL1403. J. Bacteriol. 2005, 187, 3762–3778. [Google Scholar] [CrossRef] [PubMed]
  19. Linh, T.H.; Nagai, S.; Nagasaka, N.; Okane, S.; Taoka, Y. Effect of Lactococcus lactis K-C2 on the growth performance, amino acid content and gut microflora of amberjack Seriola dumerili. Fish. Sci. 2018, 84, 1051–1062. [Google Scholar] [CrossRef]
  20. Dawood, M.A.; Koshio, S.; Ishikawa, M.; Yokoyama, S.; Basuini, E.; Hossain, M.S.; Nhu, T.H.; Dossou, S.; Moss, A.S. Effects of dietary supplementation of Lactobacillus rhamnosus or/and Lactococcus lactis on the growth, gut microbiota and immune responses of red sea bream, Pagrus major. Fish Shellfish Immunol. 2016, 49, 275–285. [Google Scholar] [CrossRef]
  21. Feng, J.; Chang, X.; Zhang, Y.; Yan, X.; Zhang, J.; Nie, G. Effects of Lactococcus lactis from Cyprinus carpio L. as probiotics on growth performance, innate immune response and disease resistance against Aeromonas hydrophila. Fish Shellfish Immunol. 2019, 93, 73–81. [Google Scholar] [CrossRef]
  22. Sun, Y.; Yang, H.; Ma, R.; Zhai, S. Does Dietary Administration of Lactococcus lactis Modulate the Gut Microbiota of Grouper, Epinephelus coioides. J. World Aquac. Soc. 2012, 43, 198–207. [Google Scholar] [CrossRef]
  23. Beck, B.R.; Kim, D.; Jeon, J.; Lee, S.M.; Kim, H.K.; Kim, O.; Lee, J.I.; Suh, B.S.; Ki, H.; Lee, K.H.; et al. The effects of combined dietary probiotics Lactococcus lactis BFE920 and Lactobacillus plantarum FGL0001 on innate immunity and disease resistance in olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2015, 42, 177–183. [Google Scholar] [CrossRef] [PubMed]
  24. Márquez-Couturier, G.; Álvarez-González, C.A.; Contreras-Sánchez, W.M.; Hernández-Vidal, U.; Hernández-Franyutti, A.; Mendoza-Alfaro, R.; Goytortúa-Bores, E. Avances en la Alimentación y Nutrición del Pejelagarto Atractosteus tropicus; Avances En Nutrición Acuícola VIII; Universidad Autónoma de Nuevo León: Monterrey, Mexico, 2006; pp. 446–523. [Google Scholar]
  25. Nájera-Arzola, I.C.; Álvarez-González, C.A.; Frías-Quintana, C.A.; Peña, E.; Martínez-García, R.; Camarillo-Coop, S.; Méndez-Marín, O.; Gisbert, E. Evaluation of Mannan oligosaccharides (MOS) in balanced diets for tropical gar juveniles (Atractosteus tropicus). Hidrobiológica 2018, 28, 239–246. [Google Scholar] [CrossRef]
  26. Nieves-Rodríguez, K.N.; Álvarez-González, C.A.; Peña-Marín, E.S.; Vega-Villasante, F.; Martínez-García, R.; Camarillo-Coop, S.; Tovar-Ramírez, D.; Guzmán-Villanueva, L.T.; Andrée, K.B.; Gisbert, E. Effect of β-Glucans in Diets on Growth, Survival, Digestive Enzyme Activity, and Immune System and Intestinal Barrier Gene Expression for Tropical Gar (Atractosteus tropicus) Juveniles. Fishes 2018, 3, 27. [Google Scholar] [CrossRef]
  27. Sepúlveda-Quiroz, C.A.; Peña-Marín, E.S.; Pérez-Morales, A.; Martínez-García, R.; Álvarez Villagómez, C.S.; Maytorena-Verdugo, C.I.; Camarillo-Coop, S.; Vissio, P.G.; Sirkin, D.I.P.; Tovar-Ramírez, D.; et al. Fructooligosaccharide supplementation in diets for tropical gar (Atractosteus tropicus) juvenile: Effects on morphophysiology and intestinal barrier function. Aquac. Res. 2020, 52, 37–50. [Google Scholar] [CrossRef]
  28. Pérez-Jiménez, G.M.; Peña-Marín, E.S.; Maytorena-Verdugo, C.I.; Sepúlveda-Quiroz, C.A.; Jiménez-Martínez, L.D.; De la Rosa-García, S.; Asencio-Alcudia, G.G.; Martínez, R.; Tovar-Ramírez, D.; Galavíz, M.A.; et al. Incorporation of Fructooligosaccharides in Diets Influence Growth Performance, Digestive Enzyme Activity, and Expression of Intestinal Barrier Function Genes in Tropical Gar (Atractosteus tropicus) Larvae. Fishes 2022, 7, 137. [Google Scholar] [CrossRef]
  29. De la Cruz-Marín, E.; Martínez-García, R.; López-Hernández, J.F.; Méndez-Marín, O.; De la Rosa-García, S.; Peña-Marín, E.S.; Tovar-Ramírez, D.; Sepúlveda-Quiroz, C.A.; Pérez-Jiménez, G.M.; Jiménez-Martínez, L.D.; et al. Inulin Supplementation in Diets for Tropical Gar (Atractosteus tropicus) Larvae: Effects on Growth, Survival, and Digestive and Antioxidant Enzyme Activities. Aquac. J. 2023, 3, 43–55. [Google Scholar] [CrossRef]
  30. Cigarroa-Ruiz, L.; Toledo-Solís, F.J.; Frías-Gómez, S.A.; Guerrero-Zárate, R.; Camarillo-Coop, S.; Álvarez-Villagómez, C.S.; Peña-Marín, E.S.; Galavíz, M.A.; Martínez-García, R.; Álvarez-González, C.A. Addition of β-glucans in diets for tropical gar (Atractosteus tropicus) larvae: Effects on growth, digestive enzymes and gene expression of intestinal epithelial integrity and immune system. Fish Physiol. Biochem. 2023, 49, 613–626. [Google Scholar] [CrossRef]
  31. Hernández-López, I.A.; Tovar-Ramírez, D.; De la Rosa-García, S.; Álvarez-Villagómez, C.S.; Asencio-Alcudia, G.G.; Martínez-Burguete, T.; Galavíz, M.A.; Guerrero-Zárate, R.; Martínez-García, R.; Peña-Marín, E.S.; et al. Dietary live yeast (Debaryomyces hansenii) provides no advantages in tropical gar, Atractosteus tropicus (Actinopterygii: Lepisosteiformes: Lepisosteidae), juvenile aquaculture. Acta Ichthyol. Piscat. 2021, 51, 311–320. [Google Scholar] [CrossRef]
  32. Palma-Cancino, D.J.; Martínez-García, R.; Álvarez-González, C.A.; Camarillo-Coop, S.; Peña-Ma, E.S. Evaluation of feeding strategies in tropical gar (Atractosteus tropicus Gill) larvae: Growth, survival and cannibalism. Ecosistemas Recur. Agropecu. 2019, 6, 273–281. Available online: https://www.cabdirect.org/cabdirect/abstract/20203438791 (accessed on 27 January 2024). [CrossRef]
  33. Jiménez-Martínez, L.D.; Tovar-Ramírez, D.; Álvarez-González, C.A.; Peña-Marín, E.S.; Camarillo-Coop, S.; Martínez-García, R.; Elena, P.; Martínez-Yáñez, R.; Concha-Frías, B. Assessment of dietary lipid sources in tropical gar, Atractosteus tropicus larvae: Growth parameters and intermediary lipogenic gene expression. Aquac. Res. 2020, 51, 2629–2640. [Google Scholar] [CrossRef]
  34. Sepúlveda-Quiroz, C.A.; Pérez-Jiménez, G.M.; Asencio-Alcudia, G.G.; Mendoza-Porras, O.; Jiménez-Martínez, L.D.; Galaviz-Espinoza, M.A.; Tovar-Ramírez, D.; Martínez, R.; Álvarez-Villagómez, C.S.; Álvarez-González, C.A. Tryptophan Reduces Intracohort Cannibalism Behavior in Tropical Gar (Atractosteus tropicus) Larvae. Fishes 2024, 9, 40. [Google Scholar] [CrossRef]
  35. Méndez-Pérez, R.; García-López, R.; Bautista-López, J.S.B.; Vázquez-Castellanos, J.F.; Álvarez-González, C.A.; Peña-Marín, E.S.; Baltierra-Trejo, E.; Adams-Schroeder, R.; Domínguez-Rodríguez, V.I.; Melgar-Valdés, C.E.; et al. High-throughput sequencing of the 16S rRNA gene to analyze the gut microbiome in juvenile and adult tropical gar (Atractosteus tropicus). Lat. Am. J. Aquat. Res. 2020, 48, 456–479. [Google Scholar] [CrossRef]
  36. Hoben, H.J.; Somasegaran, P. Comparison of the pour, spread, and drop plate methods for enumeration of Rhizobium spp. In inoculants made from presterilized peatt. Appl. Environ. Microbiol. 1982, 44, 1246–1247. [Google Scholar] [CrossRef] [PubMed]
  37. Álvarez-González, C.A.; Civera-Cerecedo, R.; Galindo, J.L.O.; Dumas, S.; Moreno Legorreta, M.; Álamo, T.G. Effect of dietary protein level on growth and body composition of juvenile spotted sand bass, Paralabrax maculatofasciatus, fed practical diets. Aquaculture 2001, 194, 151–159. [Google Scholar] [CrossRef]
  38. AOAC (Association of Official Analytical Chemists). Official Methods of Analysis, 17th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 2000. [Google Scholar]
  39. NOM-062-ZOO-1999. Norma Oficial Mexicana: Especificaciones Técnicas para la Producción, Cuidado y Uso de los Animales de Laboratorio. 2001. Available online: https://www.gob.mx/senasica/documentos/nom-062-zoo-1999 (accessed on 15 February 2024).
  40. Bradford, M.M. A Rapid and Sensitive Method for the Quantitation of Microgram Quantities of Protein Utilizing the Principle of Protein-Dye Binding. Anal. Biochem. 1976, 72, 248–254. [Google Scholar] [CrossRef]
  41. Anson, M.L. The estimation of pepsin, trypsin, papain, and cathepsin with hemoglobin. J. Gen. Physiol. 1938, 22, 79–89. [Google Scholar] [CrossRef]
  42. Walter, H. Proteinases: Methods with hemoglobin, casein and azocoll as substrates. In Methods of Enzymatic Analysis; Verlag Chemie: Weinheim, Germany, 1984; pp. 270–277. [Google Scholar]
  43. Erlanger, B.F.; Kokowsky, N.; Cohen, W.W. The preparation and properties of two new chromogenic substrates of trypsin. Arch. Biochem. Biophys. 1961, 95, 271–278. [Google Scholar] [CrossRef]
  44. Del Mar, E.G.; Largman, C.; Brodrick, J.; Geokas, M.C. A sensitive new substrate for chymotrypsin. Anal. Biochem. 1979, 99, 316–320. [Google Scholar] [CrossRef]
  45. Versaw, W.K.; Cuppett, S.L.; Winters, D.; Williams, L.E. An Improved Colorimetric Assay for Bacterial Lipase in Nonfat Dry Milk. J. Food Sci. 1989, 54, 1557–1558. [Google Scholar] [CrossRef]
  46. Maroux, S.; Louvard, D.; Barath, J. The aminopeptidase from hog intestinal brush border. Biochim. Biophys. Acta–Enzymol. 1973, 321, 282–295. [Google Scholar] [CrossRef]
  47. Jiménez-Martínez, L.; Morales, V.; Frías-Quintana, C.; Castillo, A.; Ascencio-Alcudia, G.; Alvarez-Villagomez, C.; Peña-Marín, E.; Concha-Frías, B.; Alvarez-González, C.A. Quality Evaluation of Reference Gene Expression on Different Tissues in Adults of Tropical Gar Atractosteus tropicus. Pak. J. Zool. 2021, 54, 363–372. [Google Scholar] [CrossRef]
  48. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
  49. Huse, S.M.; Dethlefsen, L.; Huber, J.A.; Welch, D.B.M.; Relman, D.A.; Sogin, M.L. Exploring Microbial Diversity and Taxonomy Using SSU rRNA Hypervariable Tag Sequencing. PLoS Genet. 2008, 4, e1000255. [Google Scholar] [CrossRef]
  50. Ibrahem, M.D. Evolution of probiotics in aquatic world: Potential effects, the current status in Egypt and recent prospectives. J. Adv. Res. 2015, 6, 765–791. [Google Scholar] [CrossRef]
  51. Xia, Y.; Lu, M.; Chen, G.; Cao, J.; Gao, F.; Wang, M.; Liu, Z.; Zhang, D.; Zhu, H.; Yi, M. Effects of dietary Lactobacillus rhamnosus JCM1136 and Lactococcus lactis subsp. lactis JCM5805 on the growth, intestinal microbiota, morphology, immune response and disease resistance of juvenile Nile tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2018, 76, 368–379. [Google Scholar] [CrossRef] [PubMed]
  52. Heo, W.; Kim, Y.; Kim, E.Y.; Bai, S.C.; Kong, I. Effects of dietary probiotic, Lactococcus lactis subsp. lactis I2, supplementation on the growth and immune response of olive flounder (Paralichthys olivaceus). Aquaculture 2013, 376–379, 20–24. [Google Scholar] [CrossRef]
  53. Kong, Y.; Gao, C.X.; Zhao, J.; Li, M.; Shan, X.; Wang, G. Effects of single or conjoint administration of lactic acid bacteria as potential probiotics on growth, immune response and disease resistance of snakehead fish (Channa argus). Fish Shellfish Immunol. 2020, 102, 412–421. [Google Scholar] [CrossRef]
  54. Sun, Y.; He, M.; Cao, Z.; Xie, Z.; Liu, C.; Wang, S.; Guo, W.; Zhang, X.; Zhou, Y. Effects of dietary administration of Lactococcus lactis HNL12 on growth, innate immune response, and disease resistance of humpback grouper (Cromileptes altivelis). Fish Shellfish Immunol. 2018, 82, 296–303. [Google Scholar] [CrossRef]
  55. Li, X.; Ringø, E.; Hoseinifar, S.H.; Lauzon, H.L.; Birkbeck, H.; Yang, D. The adherence and colonization of microorganisms in fish gastrointestinal tract. Rev. Aquac. 2018, 11, 603–618. [Google Scholar] [CrossRef]
  56. Ringø, E.; Hoseinifar, S.H.; Ghosh, K.; Van Doan, H.; Beck, B.R.; Song, S.K. Lactic Acid Bacteria in Finfish—An Update. Front. Microbiol. 2018, 9, 1818. [Google Scholar] [CrossRef] [PubMed]
  57. Fu, J.; Zheng, Y.; Gao, Y.; Wang, X. Dietary fiber intake and gut microbiota in human health. Microorganisms 2022, 10, 2507. [Google Scholar] [CrossRef]
  58. Sun, Y.; Yang, H.; Ma, R.; Song, K.; Li, J. Effect of Lactococcus lactis and Enterococcus faecium on growth performance, digestive enzymes and immune response of grouper Epinephelus coioides. Aquac. Nutr. 2011, 18, 281–289. [Google Scholar] [CrossRef]
  59. Yeganeh, S.; Adel, M.; Nosratimovafagh, A.; Dawood, M.A.O. The Effect of Lactococcus lactis subsp. lactis PTCC 1403 on the Growth Performance, Digestive Enzymes Activity, Antioxidative Status, Immune Response, and Disease Resistance of Rainbow Trout (Oncorhynchus mykiss). Probiotics Antimicrob. Proteins 2021, 13, 1723–1733. [Google Scholar] [CrossRef] [PubMed]
  60. LeBlanc, J.G.; Chain, F.; Martín, R.; Bermúdez-Humarán, L.G.; Courau, S.; Langella, P. Beneficial effects on host energy metabolism of short-chain fatty acids and vitamins produced by commensal and probiotic bacteria. Microb. Cell Fact. 2017, 16, 79. [Google Scholar] [CrossRef] [PubMed]
  61. Dawood, M.A.; Koshio, S. Recent advances in the role of probiotics and prebiotics in carp aquaculture: A review. Aquaculture 2016, 454, 243–251. [Google Scholar] [CrossRef]
  62. Misra, S.; Pandey, P.; Mishra, H.N. Novel approaches for co-encapsulation of probiotic bacteria with bioactive compounds, their health benefits and functional food product development: A review. Trends Food Sci. Technol. 2021, 109, 340–351. [Google Scholar] [CrossRef]
  63. Assan, D.; Kuebutornye, F.K.A.; Hlordzi, V.; Chen, H.; Mraz, J.; Mustapha, U.F.; Abarike, E.D. Effects of probiotics on digestive enzymes of fish (finfish and shellfish); status and prospects: A mini review. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2022, 257, 110653. [Google Scholar] [CrossRef]
  64. Taoka, Y.; Maeda, H.; Jo, J.; Sakata, T. Influence of commercial probiotics on the digestive enzyme activities of tilapia, Oreochromis niloticus. Aquac. Sci. 2007, 55, 183–189. [Google Scholar] [CrossRef]
  65. Mirghaed, A.T.; Yarahmadi, P.; Hosseinifar, S.H.; Tahmasebi, D.; Gheisvandi, N.; Ghaedi, A. The effects singular or combined administration of fermentable fiber and probiotic on mucosal immune parameters, digestive enzyme activity, gut microbiota and growth performance of Caspian white fish (Rutilus frisii kutum) fingerlings. Fish Shellfish Immunol. 2018, 77, 194–199. [Google Scholar] [CrossRef]
  66. Wang, J.; Feng, J.; Liu, S.; Cai, Z.; Song, D.; Yang, L.; Nie, G. The probiotic properties of different preparations using Lactococcus lactis Z-2 on intestinal tract, blood and hepatopancreas in Cyprinus carpio. Aquaculture 2021, 543, 736911. [Google Scholar] [CrossRef]
  67. Won, S.; Hamidoghli, A.; Choi, W.; Park, Y.; Jang, W.J.; Kong, I.; Bai, S.C. Effects of Bacillus subtilis WB60 and Lactococcus lactis on Growth, Immune Responses, Histology and Gene Expression in Nile Tilapia, Oreochromis niloticus. Microorganisms 2020, 8, 67. [Google Scholar] [CrossRef] [PubMed]
  68. Moroni, F.; Naya-Català, F.; Piazzon, M.C.; Rimoldi, S.; Calduch-Giner, J.; Giardini, A.; Martínez, I.; Brambilla, F.; Pérez-Sánchez, J.; Terova, G. The Effects of Nisin-Producing Lactococcus lactis Strain Used as Probiotic on Gilthead Sea Bream (Sparus aurata) Growth, Gut Microbiota, and Transcriptional Response. Front. Mar. Sci. 2021, 8, 659519. [Google Scholar] [CrossRef]
  69. Kong, Y.; Kong, N.; Liu, H.; Han, M.; Peng, S.; Fang, Q.; Chen, X.; Wang, G.; Li, M. Molecular mechanism of homologous lactic acid bacteria regulating liver cell injury of snakehead fish. Aquac. Rep. 2024, 34, 101905. [Google Scholar] [CrossRef]
  70. Tanekhy, M.; Khalil, R.; Hofi, H.; Hashish, E. The Biochemical, Pathological and Immunological Effectiveness of Commercial Probiotics in Nile Tilapia, Oreochromis niloticus. Pak. J. Zool. 2016, 48, 1269–1282. [Google Scholar]
  71. Dighiesh, H.S.; Alharbi, N.A.; Awlya, O.F.; Alhassani, W.E.; Hassoubah, S.A.; Albaqami, N.M.; Aljahdali, N.; El-Aziz, Y.M.A.; Eissa, E.H.; Munir, M.B.; et al. Dietary multi-strains Bacillus spp. enhanced growth performance, blood metabolites, digestive tissues histology, gene expression of Oreochromis niloticus, and resistance to Aspergillus flavus infection. Aquac. Int. 2024, 1–22. [Google Scholar] [CrossRef]
  72. Ismail, M.; Wahdan, A.; Mohamed, S.Y.; Metwally, E.; Mabrok, M. Effect of dietary supplementation with a synbiotic (Lacto Forte) on growth performance, haematological and histological profiles, the innate immune response and resistance to bacterial disease in Oreochromis niloticus. Aquac. Res. 2019, 50, 2545–2562. [Google Scholar] [CrossRef]
  73. Abomughaid, M.M. Isolation and Identification of Some Probiotic Bacteria and Their Potential Role in Improving Immune Response and Resistance of Nile Tilapia (Oreochromis niloticus) in Comparison with a Commercial Product. Int. J. Microbiol. 2020, 865456, 1–9. [Google Scholar] [CrossRef] [PubMed]
  74. Arsène, M.M.J.; Davares, A.K.L.; Andreevna, S.L.; Vladimirovich, E.A.; Carime, B.Z.; Marouf, R.; Khelifi, I. The use of probiotics in animal feeding for safe production and as potential alternatives to antibiotics. Vet. World 2021, 14, 319–328. [Google Scholar] [CrossRef]
  75. Merrifield, D.L.; Rodiles, A. The fish microbiome and its interactions with mucosal tissues. In Mucosal Health in Aquaculture; Elsevier eBooks; Academic Press: Cambridge, MA, USA, 2015; pp. 273–295. [Google Scholar] [CrossRef]
  76. Shephard, K.L. Mucus on the epidermis of fish and its influence on drug delivery. Adv. Drug Deliv. Rev. 1993, 11, 403–417. [Google Scholar] [CrossRef]
  77. Dash, S.; Das, S.; Samal, J.; Thatoi, H. Epidermal mucus, a major determinant in fish health: A review. Iran. J. Vet. Res. 2018, 19, 72–81. [Google Scholar] [PubMed] [PubMed Central]
  78. Lee, S.J.; Jeon, H.S.; Yoo, J.Y.; Kim, J.H. Some Important Metabolites Produced by Lactic Acid Bacteria Originated from Kimchi. Foods 2021, 10, 2148. [Google Scholar] [CrossRef] [PubMed]
  79. García-Hernández, V.; Quiros, M.; Nusrat, A. Intestinal epithelial claudins: Expression and regulation in homeostasis and inflammation. Ann. N. Y. Acad. Sci. 2017, 1397, 66–79. [Google Scholar] [CrossRef] [PubMed]
  80. Abbas, A.K.; Lichtman, A.H.; Pillai, S. Cellular and Molecular Immunology; Elsevier: São Paulo, Brazil, 2014. [Google Scholar]
  81. Beck, B.R.; Song, J.H.; Park, B.; Kim, D.; Kwak, J.-H.; Ki, H.; Ki Do, H.; Kim, A.; Kim, W.-J.; Song, S.K. Distinct immune tones are established by Lactococcus lactis BFE920 and Lactobacillus plantarum FGL0001 in the gut of olive flounder (Paralichthys olivaceus). Fish Shellfish Immunol. 2017, 55, 434–443. [Google Scholar] [CrossRef] [PubMed]
  82. Servin, A.L. Antagonistic activities of lactobacilli and bifidobacteria against microbial pathogens. FEMS Microbiol. Rev. 2004, 28, 405–440. [Google Scholar] [CrossRef]
  83. Gómez, G.D.; Balcázar, J.L. A review on the interactions between gut microbiota and innate immunity of fish. FEMS Immunol. Med. Microbiol. 2008, 52, 145–154. [Google Scholar] [CrossRef]
  84. Dong, Y.; Yang, Y.; Liu, J.; Awan, F.; Lu, C.; Liu, Y. Inhibition of Aeromonas hydrophila-induced intestinal inflammation and mucosal barrier function damage in crucian carp by oral administration of Lactococcus lactis. Fish Shellfish Immunol. 2018, 83, 359–367. [Google Scholar] [CrossRef]
  85. Wang, X.; Jiang, W.; Feng, L.; Wu, P.; Liu, Y.; Zeng, Y.; Jiang, J.; Kuang, S.; Tang, L.; Tang, W.; et al. Low or excess levels of dietary cholesterol impaired immunity and aggravated inflammation response in young grass carp (Ctenopharyngodon idella). Fish Shellfish Immunol. 2018, 78, 202–221. [Google Scholar] [CrossRef]
  86. Wang, G.; Huang, S.; Wang, Y.; Cai, S.; Yu, H.; Liu, H.; Zeng, X.; Zhang, G.; Qiao, S. Bridging intestinal immunity and gut microbiota by metabolites. Cell. Mol. Life Sci. 2019, 76, 3917–3937. [Google Scholar] [CrossRef]
  87. Fang, G.; Rocha, E.; Danchin, A. How Essential Are Nonessential Genes? Mol. Biol. Evol. 2005, 22, 2147–2156. [Google Scholar] [CrossRef]
  88. Sylvain, F.; Derome, N. Vertically and horizontally transmitted microbial symbionts shape the gut microbiota ontogenesis of a skin-mucus feeding discus fish progeny. Sci. Rep. 2017, 7, 5263. [Google Scholar] [CrossRef]
  89. Sonnenburg, E.D.; Zheng, H.; Joglekar, P.; Higginbottom, S.K.; Firbank, S.J.; Bolam, D.N.; Sonnenburg, J.L. Specificity of Polysaccharide Use in Intestinal Bacteroides Species Determines Diet-Induced Microbiota Alterations. Cell 2010, 141, 1241–1252. [Google Scholar] [CrossRef] [PubMed]
  90. Ringø, E.; Zhou, Z.; Vecino, J.; Wadsworth, S.; Romero, J.; Krogdahl, Å.; Olsen, R.; Dimitroglou, A.; Foey, A.; Davies, S.; et al. Effect of dietary components on the gut microbiota of aquatic animals. A never-ending story? Aquac. Nutr. 2015, 22, 219–282. [Google Scholar] [CrossRef]
  91. Sourjik, V.; Wingreen, N.S. Responding to chemical gradients: Bacterial chemotaxis. Curr. Opin. Cell Biol. 2012, 24, 262–268. [Google Scholar] [CrossRef] [PubMed]
  92. Aldridge, P.; Hughes, K.T. Regulation of flagellar assembly. Curr. Opin. Microbiol. 2002, 5, 160–165. [Google Scholar] [CrossRef]
  93. Yoshida, K.; Hashimoto, M.; Hori, R.; Adachi, T.; Okuyama, H.; Orikasa, Y.; Nagamine, T.; Shimizu, S.; Ueno, A.; Morita, N. Bacterial Long-Chain Polyunsaturated Fatty Acids: Their Biosynthetic Genes, Functions, and Practical Use. Mar. Drugs 2016, 14, 94. [Google Scholar] [CrossRef]
  94. Amorim-Franco, T.M.; Blanchard, J.S. Bacterial Branched-Chain Amino Acid Biosynthesis: Structures, Mechanisms, and Drugability. Biochemistry 2017, 56, 5849–5865. [Google Scholar] [CrossRef]
  95. National Center for Biotechnology Information. PubChem Pathway Summary for Pathway SMP0012440, C5-Branched Dibasic Acid Metabolism, Source: PathBank. Available online: https://pubchem.ncbi.nlm.nih.gov/pathway/PathBank:SMP0012440 (accessed on 20 July 2024).
Animals 14 02663 g001
Figure 1. Representative images of the liver and digestive system of A. tropicus larvae treated with CD and 106 CFU/g of L. lactis PH3-05: (a) CD, (b) 106 CFU/g of L. lactis PH3-05. The liver images show melanomacrophagic centers (yellow arrow) and hepatocytes (circle). Images of the intestine display the height of enterocytes (yellow line) of A. tropicus larvae: (c) CD, (d) 106 CFU/g of L. lactis PH3-05.
Figure 1. Representative images of the liver and digestive system of A. tropicus larvae treated with CD and 106 CFU/g of L. lactis PH3-05: (a) CD, (b) 106 CFU/g of L. lactis PH3-05. The liver images show melanomacrophagic centers (yellow arrow) and hepatocytes (circle). Images of the intestine display the height of enterocytes (yellow line) of A. tropicus larvae: (c) CD, (d) 106 CFU/g of L. lactis PH3-05.
Animals 14 02663 g001
Animals 14 02663 g002
Figure 2. Relative expression levels of intestinal barrier function and immune system genes in A. tropicus larvae fed with L. lactis PH3-05 supplementation (104, 106, and 108 CFU/g) and the control diet. Values are mean ± SD. Data are presented as fold-change relative to control diet samples (set to 1). Significant differences between treatments are indicated by letters (p < 0.05). (a) Mucus layer protein (muc-2); (b) Tight junction protein (zo-2); (c) Pro-inflammatory cytokine (il-8); (d) Anti-inflammatory cytokine (il-10).
Figure 2. Relative expression levels of intestinal barrier function and immune system genes in A. tropicus larvae fed with L. lactis PH3-05 supplementation (104, 106, and 108 CFU/g) and the control diet. Values are mean ± SD. Data are presented as fold-change relative to control diet samples (set to 1). Significant differences between treatments are indicated by letters (p < 0.05). (a) Mucus layer protein (muc-2); (b) Tight junction protein (zo-2); (c) Pro-inflammatory cytokine (il-8); (d) Anti-inflammatory cytokine (il-10).
Animals 14 02663 g002
Animals 14 02663 g003
Figure 3. Alpha diversity of gut microbiota in A. tropicus larvae treated with L. lactis PH3-05 supplementations (104, 106, and 108 CFU/g) and control diet: (a) Chao 1, (b) ACE, and (c) Shannon–Weaver indexes were calculated from the ASVs.
Figure 3. Alpha diversity of gut microbiota in A. tropicus larvae treated with L. lactis PH3-05 supplementations (104, 106, and 108 CFU/g) and control diet: (a) Chao 1, (b) ACE, and (c) Shannon–Weaver indexes were calculated from the ASVs.
Animals 14 02663 g003
Animals 14 02663 g004
Figure 4. A relative abundance of bacterial phyla is present in the intestinal microbiota of A. tropicus larvae fed with L. lactis PH3-05 (104, 106, and 108 CFU/g) and a control diet.
Figure 4. A relative abundance of bacterial phyla is present in the intestinal microbiota of A. tropicus larvae fed with L. lactis PH3-05 (104, 106, and 108 CFU/g) and a control diet.
Animals 14 02663 g004
Animals 14 02663 g005
Figure 5. Relative abundance of the bacterial genus is present in the intestinal microbiota of A. tropicus larvae fed with L. lactis (104, 106, and 108 CFU/g) and a control diet.
Figure 5. Relative abundance of the bacterial genus is present in the intestinal microbiota of A. tropicus larvae fed with L. lactis (104, 106, and 108 CFU/g) and a control diet.
Animals 14 02663 g005
Animals 14 02663 g006
Figure 6. Principal coordinate analysis (PCoA) based on beta diversity analyses with Bray–Curtis (a), Jaccard (b), Weighted Unifrac (c), and Unweighted Unifrac (d) indexes of gut bacterial profiles of A. tropicus larvae treated fed L. lactis PH3-05 (104, 106, and 108 CFU/g) and a control diet.
Figure 6. Principal coordinate analysis (PCoA) based on beta diversity analyses with Bray–Curtis (a), Jaccard (b), Weighted Unifrac (c), and Unweighted Unifrac (d) indexes of gut bacterial profiles of A. tropicus larvae treated fed L. lactis PH3-05 (104, 106, and 108 CFU/g) and a control diet.
Animals 14 02663 g006
Animals 14 02663 g007
Figure 7. Heat map of microbial functions in the digestive tract of A. tropicus larvae fed with L. lactis PH3-05 (104, 106, and 108 CFU/g) and a control diet. Predictions are based on level 3 functional annotations using the KEGG database.
Figure 7. Heat map of microbial functions in the digestive tract of A. tropicus larvae fed with L. lactis PH3-05 (104, 106, and 108 CFU/g) and a control diet. Predictions are based on level 3 functional annotations using the KEGG database.
Animals 14 02663 g007
Table 1. Composition of experimental diets with different concentrations of Lactococcus lactis and the control diet.
Table 1. Composition of experimental diets with different concentrations of Lactococcus lactis and the control diet.
Ingredients
(g kg diet−1)		 Lactococcus lactis PH3-05
CFU/g
Control Diet104106108
Fish meal a350350350350
Pork meal a270.9270.9270.9270.9
Poultry meal a150150150150
Starch b100100100100
Fish oil a36.536.536.536.5
Lactococcus lactis00.0010.010.1
Wheat meal c37.636.637.5937.6
Grenetin d20202020
Vit-min premix e15151515
Soy lecithin f15151515
Vitamin C g5555
Chemical composition (g 100 g diet−1 Dry Matter)
Crude protein50.150.249.849.9
Crude lipid14.214.113.914.2
Fiber10.110.29.910.0
Ashes14.013.914.114.2
Humidity8.18.08.48.2
NFE11.611.612.311.7
a Marine and agricultural proteins S.A. de C.V., Guadalajara, Jalisco; b Pronat Ultra, Merida, Yucatan, Mexico; c GALMEX SA de CV, Villahermosa, Tabasco, México; d D’gari, food and diet products relámpago, S.A. de C.V. e Vitamin premix composition g/mg or International Units per kg of diet: Vitamin A, 10,000,000 IU; Vitamin D3, 2,000,000 IU; Vitamin E, 100,000 IU; Vitamin K3, 4.0 g; Thiamine B1, 8.0 g; Riboflavin B2, 8.7 g; Pyridoxine B6, 7.3 g; Vitamin B12, 20.0 mg; Niacin, 50.0 g; Pantothenic acid, 22.2 g; Inositol, 0.15 mg; Nicotinic Acid, 0.16 mg; Folic Acid, 4.0 g; Biotin, 500 mg; Vitamin C, 10.0 g; Choline 0.3 mg, Excipient q.s. 2 g; Manganese, 10 g; Magnesium, 4.5 g; Zinc, 1.6 g; Iron, 0.2 g; Copper, 0.2 g; Iodine, 0.5 g; Selenium, 40 mg; Cobalt 60 mg. Excipient q.s. 1.5 g; f Pronat Ultra, Yucatán, México; g ROVIMIX® STAY-C® 35–DSM, Guadalajara, México. NFE = Nitrogen-free extract: 100 − (% protein − % ether extract − % ash − %fiber).
Table 2. Primers used for qPCR analysis.
Table 2. Primers used for qPCR analysis.
Target GeneGene FunctionPrimer Sequence (5′-3′)Amplification Efficiency (%)Amplicon Size (bp)Reference
muc-2mucus layer protein (mucin 2)FW: GGCCTCCTCAAGAGCACGGTG RV: TCTGCACGCTGGAGCACTCAATG90.94100[26]
zo-2tight junction proteinFW: TACCCATGGAAAATGTGCCTCA
RV: CGGGGTCTCTTCACGGTAA		95.2988[28]
il-8pro-inflammatory cytokineFW: ATATTCACTGGTGGGCGGAG
RV: GTGCGGCCTGAGATTGTTT		94.18369[28]
il-10anti-inflammatory cytokineFW: TTATAAAGCCATGGGGGAGCTG
RV: CTGCACAGTCTGCCTCTAGT		94.4791This study
β-actincytoskeletal actinFW: GAGCTATGAGCTGCCTGAGTGG
RV: GTGGTCTCATGAATGCCACAGG		97.10119[47]
Table 3. Indexes of the growth performance and survival rate of A. tropicus larvae fed diets supplemented with different concentrations of L. lactis PH3-05 (104, 106, and 108 CFU/g) compared with the control diet.
Table 3. Indexes of the growth performance and survival rate of A. tropicus larvae fed diets supplemented with different concentrations of L. lactis PH3-05 (104, 106, and 108 CFU/g) compared with the control diet.
Lactococcus lactis PH3-05 (CFU/g)
Control Diet104106108
Initial weight (g)0.002 ± 0.0070.002 ± 0.0070.002 ± 0.0070.002 ± 0.007
Final weight (g)0.031 ± 0.002 b0.034 ± 0.0004 b0.040 ± 0.00 a0.041 ± 0.00 a
Initial length (cm)1.8 ± 0.181.8 ± 0.181.8 ± 0.181.8 ± 0.18
Final length (cm)2.09 ± 0.05 b2.13 ± 0.12 a2.18 ± 0.09 a2.38 ± 0.09 a
SGR (% d−1)1.53 ± 0.07 b1.64 ± 0.07 b2.75 ± 0.15 a2.83 ± 0.003 a
WG (%)25.75 ± 1.35 b27.74 ± 1.46 b50.33 ± 3.50 a52.14 ± 0.06 a
S (%)31.11 ± 1.92 b33.75 ± 1.82 b46.36 ± 4.34 a32.56 ± 6.72 b
SGR: specific growth rate; WG: weight gain; S: survival rate. Values are means ± SD. Significant differences are shown with different letters (p < 0.05).
Table 4. Digestive enzymatic activities of A. tropicus larvae fed diets supplemented with different concentrations of L. lactis PH3-05 (104, 106, and 108 CFU/g) compared with the control diet.
Table 4. Digestive enzymatic activities of A. tropicus larvae fed diets supplemented with different concentrations of L. lactis PH3-05 (104, 106, and 108 CFU/g) compared with the control diet.
Activities
(U mg protein−1)		 Lactococcus lactis PH3-05 (CFU/g)
Control Diet104106108
Acid protease 490.79 ± 36.69 b490.27 ± 76.22 b716.99 ± 5.57 a235.30 ± 66.15 c
Alkaline protease41.14 ± 4.68 b44.45 ± 0.02 b55.45 ± 1.82 a37.46 ± 11.82 b
Trypsin0.12 ± 0.02 b0.22 ± 0.10 ab0.28 ± 0.05 ab0.35 ± 0.07 a
Chymotrypsin79.57 ± 2.70 ab87.45 ± 2.86 a89.06 ± 0.78 a65.86 ± 10.60 b
Lipase17.52 ± 0.21 b27.17 ± 1.21 b37.75 ± 0.3 a15.79 ± 8.64 b
Leucine aminopeptidase60. 21 ± 11.18 b83.66 ± 1.96 a81. 21 ± 3.58 ab71.72 ± 11.01 ab
Values are means ± SD. Significant differences are shown with different letters (p < 0.05).
Table 5. Histological analysis of A. tropicus larvae fed with diets supplemented with different concentrations of L. lactis PH3- and 108 CFU/g compared with the control diet.
Table 5. Histological analysis of A. tropicus larvae fed with diets supplemented with different concentrations of L. lactis PH3- and 108 CFU/g compared with the control diet.
Morphological
Analysis		 Lactococcus lactis PH3-05 (CFU/g)
Control Diet104106108
Area MMC (%/Area)1.01 ± 0.43 b1.45 ± 0.14 ab1.91 ± 0.48 a1.94 ± 0.31 a
Hepatocyte area (µm2)5.48 ± 0.84 b5.72 ± 0.81 ab5.37 ± 0.66 b7.36 ± 0.25 a
Enterocyte height (µm)10.40 ± 0.40 d12.61 ± 0.22 c17.88 ± 0.40 a14.23 ± 0.33 b
MMC: melanomacrophagic centers. Values are means ± SD. Significant differences are shown with different letters (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Pérez-Jiménez, G.M.; Alvarez-Villagomez, C.S.; Martínez-Porchas, M.; Garibay-Valdez, E.; Sepúlveda-Quiroz, C.A.; Méndez-Marín, O.; Martínez-García, R.; Jesús-Contreras, R.; Alvarez-González, C.A.; De la Rosa-García, S.d.C. The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae. Animals 2024, 14, 2663. https://doi.org/10.3390/ani14182663

AMA Style

Pérez-Jiménez GM, Alvarez-Villagomez CS, Martínez-Porchas M, Garibay-Valdez E, Sepúlveda-Quiroz CA, Méndez-Marín O, Martínez-García R, Jesús-Contreras R, Alvarez-González CA, De la Rosa-García SdC. The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae. Animals. 2024; 14(18):2663. https://doi.org/10.3390/ani14182663

Chicago/Turabian Style

Pérez-Jiménez, Graciela María, Carina Shianya Alvarez-Villagomez, Marcel Martínez-Porchas, Estefanía Garibay-Valdez, César Antonio Sepúlveda-Quiroz, Otilio Méndez-Marín, Rafael Martínez-García, Ronald Jesús-Contreras, Carlos Alfonso Alvarez-González, and Susana del Carmen De la Rosa-García. 2024. "The Indigenous Probiotic Lactococcus lactis PH3-05 Enhances the Growth, Digestive Physiology, and Gut Microbiota of the Tropical Gar (Atractosteus tropicus) Larvae" Animals 14, no. 18: 2663. https://doi.org/10.3390/ani14182663

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop