Influence of 17α-Methyltestosterone on Morphological Deformities and Pigmentation Development in Juvenile Japanese Eels, Anguilla japonica
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Fish and Breeding Environmental Control
2.2. Sampling Procedure and Measurement of Biological Indicators
2.3. Measuring Plasma Hormone Levels
2.4. Histological Analysis
2.5. RNA Extraction and Quantitative Real-Time PCR Analysis
2.6. Statistical Analysis
3. Results
3.1. Biological Indices
3.2. Histological Analysis
3.3. Serum 11-KT, E2, GH, and Cortisol Concentrations
3.4. Skin Pigmentation Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Watanabe, S. Taxanomy of the Freshwater Eels, Genus Anguilla Shrank, 1798. In Eel Biology; Aida, K., Tsukamoto, K., Yamauchi, K., Eds.; Springer: Tokyo, Japan, 2003; pp. 3–18. [Google Scholar]
- Kagawa, H.; Tanaka, H.; Ohta, H.; Unuma, T.; Nomura, K. The first success of glass eel production in the world: Basic biology on fish reproduction advances new applied technology in aquaculture. Fish Physiol. Biochem. 2005, 31, 193–199. [Google Scholar] [CrossRef] [PubMed]
- Hyeon, J.Y.; Hur, S.P.; Kim, B.H.; Byun, J.H.; Kim, E.S.; Lim, B.S.; Lee, B.I.; Kim, S.K.; Takemura, A.; Kim, S.J. Involvement of estrogen and its receptors in morphological changes in the eyes of the Japanese eel, Anguilla japonica, in the process of artificially-induced maturation. Cells 2019, 8, 310. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.C.; Lou, S.W. Androgenic Modulation in the Primary Ovarian Growth of the Japanese eel, Anguilla japonica. Zool. Stud. 2019, 58, 2. [Google Scholar] [CrossRef]
- Di Biase, A.; Lokman, P.M.; Govonim, N.; Casalini, A.; Emmanuele, P.; Parmeggiani, A.; Mordenti, O. Co-treatment with androgens during artificial induction of maturation in female eel, Anguilla anguilla: Effects on egg production and early development. Aquaculture 2017, 479, 508–515. [Google Scholar] [CrossRef]
- Kottmann, J.S.; Jørgensen, M.G.P.; Bertolini, F.; Loh, A.; Tomkiewicz, J. Differential impacts of carp and salmon pituitary extracts on induced oogenesis, egg quality, molecular ontogeny and embryonic developmental competence in European eel. PLoS ONE 2020, 15, e0235617. [Google Scholar] [CrossRef]
- Kottmann, J.S.; Tomkiewicz, J.; Butts, I.A.E.; Lund, I.; Jacobsen, C.; Støttrup, J.G.; Holst, L. Effects of essential fatty acids and feeding regimes on egg and offspring quality of European eel: Comparing reproductive success of farm-raised and wild-caught broodstock. Aquaculture 2020, 529, 735581. [Google Scholar] [CrossRef]
- Shin, M.G.; Ryu, Y.W.; Choi, Y.H.; Kim, S.K. Morphological and allometric changes in Anguilla japonica Larvae. Biology 2022, 11, 407. [Google Scholar] [CrossRef]
- Byambaragchaa, M.; Park, S.H.; Kim, S.G.; Shin, M.G.; Kim, S.K.; Hur, S.P.; Park, M.H.; Kang, M.H.; Min, K.S. Stable Production of a Tethered Recombinant Eel Luteinizing Hormone Analog with High Potency in CHO DG44 Cells. Curr. Issues Mol. Biol. 2024, 46, 6085–6099. [Google Scholar] [CrossRef]
- Sudo, R.; Kawakami, Y.; Nomura, K.; Tanaka, H.; Kazeto, Y. Production of recombinant Japanese eel (Anguilla japonica) growth hormones and their effects on early-stage larvae. Gen. Comp. Endocrinol. 2022, 317, 113977. [Google Scholar] [CrossRef]
- Devlin, R.H.; Nagahama, Y. Sex determination and sex differentiation in fish: An overview of genetic, physiological, and environmental influences. Aquaculture 2002, 208, 191–364. [Google Scholar] [CrossRef]
- Godwin, J.; Luckenbach, J.A.; Borski, R.J. Ecology meets endocrinology: Environmental sex determination in fishes. Evol. Develop. 2003, 5, 40–49. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Xu, P.; Liu, X.; Guo, D.; Chen, X.; Bi, S.; Lai, H.; Wang, G.; Zhao, X.; Su, Y.; et al. Production of neo-male mandarin fish Sniperca chuatsi by masculinization with orally administered 17a-methyltestosterone. Aquaculture 2021, 530, 735904. [Google Scholar] [CrossRef]
- Lai, X.J.; Li, Z.Q.; Xie, Y.J.; Chen, S.X.; Wang, Y.L. Androstenedione and 17α-methyltestosterone induce early ovary development of Anguilla japonica. Theriogenology 2018, 120, 16–24. [Google Scholar] [CrossRef]
- Chai, Y.; Tosaka, R.; Abe, T.; Sago, K.; Sago, Y.; Hatanaka, E.; Ijiri, S.; Adachi, S. The relationship between the developmental stage of oocytes in various seasons and the quality of the egg obtained by artificial maturation in the ferminized Japanese eel. Aquac. Sci. 2010, 58, 269–278. [Google Scholar] [CrossRef]
- Sulaeman; Fotedar, R. Masculinization of silver perch (Bidyanus bidyanus Mitchell 1838) by dietary supplementation of 17a-methyltestosterone. Egypt. J. Aquat. Res. 2017, 43, 109–116. [Google Scholar] [CrossRef]
- Beardmore, J.A.; Mair, G.C.; Lewis, R.I. Monosex male production in finfish as exemplified by tilapia: Applications, problems, and prospects. Aquaculture 2001, 197, 283–301. [Google Scholar] [CrossRef]
- Backe, W.J.; Ort, C.; Brewer, A.J.; Field, J.A. Analysis of Androgenic Steroids in Environmental Waters by Large-volume Injection Liquid Chromatography Tandem Mass Spectrometry. Anal. Chem. 2011, 83, 2622–2630. [Google Scholar] [CrossRef]
- Sun, L.; Liu, Y.; Chu, X.; Lin, J.M. Trace Analysis of Fifteen Androgens in Environmental Waters by LC-ESI-MS-MS Combined with Solid-Phase Disk Extraction Cleanup. Chromatographia 2010, 9, 867–873. [Google Scholar] [CrossRef]
- Sudo, R.; Tosaka, R.; Ijiri, S.; Adachi, S.; Aoyama, J.; Tsukamoto, K. 11-ketotestosterone Synchronously Induces Oocyte Development and Silvering-Related Changes in the Japanese eel, Anguilla japonica. Zool. Sci. 2012, 29, 254–259. [Google Scholar] [CrossRef]
- Lai, X.; Peng, S.; Bai, Z.; Cao, L.; Huang, H.; Jiang, Y.; Wang, Y. Direct Feedback Regulation of E2, T, and hCG in the Brain-Pituitary-Gonad Axis of Japanese Eel (Anguilla japonica) during Artificial Maturation. Fishes 2024, 9, 265. [Google Scholar] [CrossRef]
- Liu, S.; Chen, Y.; Li, T.; Qiao, L.; Yang, Q.; Rong, W.; Liu, Q.; Wang, W.; Song, J.; Wang, X.; et al. Effects of 17 a-Methyltestosterone on the Transcriptome and Sex Hormones in the Brain of Gobiocypris rarus. Int. J. Mol. Sci. 2023, 24, 3571. [Google Scholar] [CrossRef]
- De Meyer, J.; Belpaire, C.; Boeckx, P.; Bervoets, L.; Covaci, A.; Malarvannan, G.; De Kegel, B.; Adriaens, D. Head shape disparity impacts pollutant accumulation in European eel. Environ. Pollut. 2018, 240, 378–386. [Google Scholar] [CrossRef]
- Galindo, D.; Sweet, E.; DeLeon, Z.; Wagner, M.; DeLeon, A.; Carter, C.; McMenamin, S.K.; Cooper, W.J. Thyroid hormone modulation during zebrafish development recapitulates evolved diversity in danionin jaw protrusion mechanics. Evol. Dev. 2019, 21, 231–246. [Google Scholar] [CrossRef] [PubMed]
- Durif, C.; Dufour, S.; Elie, P. The silvering process of Anguilla anguilla: A new classification from the yellow resident to the silver migrating stage. J. Fish Biol. 2005, 80, 77–89. [Google Scholar] [CrossRef]
- Hatakeyama, R.; Sudo, R.; Yatabe, T.; Yamano, K.; Nomura, K. Developmental features of Japanese eels, Anguilla japonica, from the late leptocephalus to the yellow eel stages: An early metamorphosis to the eel-like form and a prolonged transition to the juvenile. J. Fish Biol. 2021, 100, 454–473. [Google Scholar] [CrossRef] [PubMed]
- Okamura, A.; Yamada, Y.; Yokouchi, K.; Horie, N.; Mikawa, N.; Utoh, T.; Tanaka, S.; Tsukamoto, K. A silvering index for the Japanese eel Anguilla japonica. Environ. Biol. Fishes 2007, 80, 77–89. [Google Scholar] [CrossRef]
- Shen, S.C. A review of Congrid Eels of the Genus Ariosoma from Taiwan, with Description of a New Species. Zool. Stud. 1998, 37, 7–12. [Google Scholar]
- Hwang, J.A.; Park, J.S.; Kim, J.E.; Lee, J.H.; Kim, H.S. Estradiol B levels as a tool for sex determination in Farm Anguilla japonica. Biochem. Biophys. Res. Commun. 2022, 634, 108–113. [Google Scholar] [CrossRef]
- Hasheesh, W.S.; Marie, M.A.S.; Abbas, H.H.; Eshak, M.G.; Zahran, E.A. An Evaluation of the Effect of 17 a-Methyltestosterone Hormone on some Biochemical, Molecular and Histological Change in the Liver of Nile Tilapia; Oreochromis niloticus. Life Sci. J. 2011, 8, 343–358. [Google Scholar]
- Karsli, Z. Effects of synthetic androgen (17ɑ-methyltestosterone) and estrogen (17B-estradiol) on growth and skin coloration in emperor red cichlid, Aulonocara nyssae (Actinopterygii:Cichliformes: Cichlidae). Acta Ichthyol. Piscat. 2021, 51, 357–363. [Google Scholar] [CrossRef]
- Murry, C.M.; Easter, M.; Merchant, M.; Rheubert, J.L.; Wilson, K.A.; Cooper, A.; Mendonca, M.; Wibbels, T.; Martin, M.S.; Guyer, C. Methyltestosterone alters sex determination in the American alligator (Alligator missippiensis). Gen. Comp. Endocrinol. 2016, 236, 63–69. [Google Scholar] [CrossRef]
- Miura, C.; Shimizu, Y.; Uehara, M.; Ozaki, Y.; Young, G.; Miura, T. Gh is produced by the testis of Japanese eel and stimulates proliferation of spermatogonia. Reproduction 2011, 142, 869–877. [Google Scholar] [CrossRef]
- Palstra, A.P.; Bouwman, L.J.; Jehannet, P.; Kruijt, L.; Schipper, H.; Blokland, M.H.; Swinkels, W.; Heinsbroek, L.T.N.; Lokman, P.M. Steroid implants for the induction of vitellogenesis in feminized European silver eels (Anguilla anguilla L.). Front. Genet. 2022, 13, 969202. [Google Scholar] [CrossRef] [PubMed]
- Wang, J.; Zhou, J.; Yang, Q.; Wang, W.; Liu, Q.; Liu, W.; Liu, S. Effects of 17 a-methyltestosterone on the transcriptome, gonadal histology and sex steroid hormones in Pseudorasbora parva. Theiogenology 2020, 155, 88–97. [Google Scholar] [CrossRef] [PubMed]
- Shkil, F.; Siomava, N.; Voronezhskaya, E.; Diogo, R. Effects of hyperthyroidism in the development of the appendicular skeleton and muscles of zebrafsh, with notes on evolutionary developmental pathology (Evo-Devo-Path). Sci. Rep. 2019, 9, 5413. [Google Scholar] [CrossRef] [PubMed]
- Tran, N.K.; Kwan, T.N.; Purser, J.; Patil, J.G. Masculinization of Adult Gambusia holbrooki: A Case of Recapitulation of Protogyny in a Gonochorist? Biology 2022, 11, 694. [Google Scholar] [CrossRef]
- Olivereau, M.; Olivereau, J. Effect of 17α-Methyltestosterone on the Skin and Gonads of Freshwater Male Silver Eels. Gen. Comp. Endocrinol. 1985, 57, 64–71. [Google Scholar] [CrossRef]
- Jiang, Y.; Zhang, S.; Xu, J.; Feng, J.; Mahboob, S.; Al-Ghanim, K.A.; Sun, X.; Xu, P. Comparative Transcriptome Analysis Reveals the Genetic Basis of Skin Color Variation in Common Carp. PLoS ONE 2014, 9, e108200. [Google Scholar] [CrossRef]
- Bar, I.; Kaddar, E.; Velan, A.; David, L. Melanocortin receptor 1 and black pigmentation in the Japanese ornamental carp (Cyprinus carpio var. Koi). Front. Genet. 2013, 4, 6. [Google Scholar] [CrossRef]
- Hinton, D.E.; Segner, H.; Braunbeck, T. Toxic response of the liver. In Target Organ Toxicity in Marin and Freshwater Teleosts; Schlenk, D., Benson, W.H., Eds.; Taylor & Francis: London, UK, 2001; pp. 224–268. [Google Scholar] [CrossRef]
- Wolf, J.C.; Wolfe, M.J. A Brief Overview of Nonneoplastic Hepatic Toxicity in Fish. Toxicol. Pathol. 2005, 33, 75–85. [Google Scholar] [CrossRef]
- Rupia, E.J.; Shen, J.; Wu, J.; Chen, W.; Liu, L.; Dierckens, K.; Sorgeloos, P.; Lu, W. Effect of hormone injection frequency on the lipid content and fatty acid composition in gonad, muscle and liver of Anguilla japonica during artificial maturation. Aquacult Int. 2014, 22, 1105–1120. [Google Scholar] [CrossRef]
Genes | Forward (′5 → ′3) | Reverse (′5 → ′3) | Amplicon Size (bp) |
---|---|---|---|
Melanocortin 1 receptor (MCR1) | TGGAGCACAATCCTTTGATGTA | TCGTGCGGGATCATAACTTG | 148 |
Tyrosinase (Tyr) | CGGTGCTAATTGTGCTGAAAG | TCTTTGCCAGGTTCAAGTAAGA | 119 |
Dopachrome tautomerase (DCT) | TTTCCGGGAGAGAACCATTAAC | GAAGGTGGAGTTGGTGAAGTAG | 138 |
Agouti signaling protein 1 (Asip 1) | ACTGCCAAGTGTTTGCTTTG | ACTGCTGGAAGACGCATTTA | 131 |
Proopiomelanocortin (Pomc) | TCACCCTCCAGACCAAGAA | AGCCACCGTAGCGTTTG | 124 |
Premelanosome protein a (Pmel a) | TCTACCCAGACAGAAACTCCTC | CGTCTTCCACACGTACACATAG | 118 |
Premelanosome protein b (Pmel b) | GGGCATTGAGAATGTGGAGATA | CAGGCTTCCTTGACAGATGAT | 100 |
β-actin | AATCCACGAGACCACCTTCAACT | TGATCTCTTTCTGCATTCTGTCG | 134 |
6 Months | 15 Months | |||
---|---|---|---|---|
Control | MT Treated | Control | MT Treated | |
TL (mm) | 395.97 ± 27.72 | 285.97 ± 26.21 *** | 462.40 ± 36.2 | 404.7 ± 43.5 *** |
BW (g) | 85.24 ± 22.39 | 31.16 ± 7.57 *** | 131.00 ± 32.47 | 87.00 ± 30.57 *** |
SL (mm) | 12.22 ± 0.99 | 5.10 ± 0.74 *** | 14.86 ± 1.39 | 11.78 ± 2.24 ** |
PL (mm) | 45.80 ± 3.36 | 34.70 ± 1.64 *** | 58.17 ± 4.74 | 51.92 ± 7.17 * |
EL (mm) | 3.71 ± 0.54 | 4.12 ± 0.30 ns | 4.96 ± 0.99 | 4.18 ± 0.43 * |
Color Parameters | Control | MT-Treated |
---|---|---|
L* | 9.38 ± 1.02 | 8.07 ± 0.96 ** |
a* | 3.87 ± 1.11 | 3.65 ± 0.09 ns |
b* | 8.30 ± 0.81 | 9.55 ± 0.43 *** |
Control | MT Treated | |
---|---|---|
Sex ratio % (female/male) | 20:ND | 10:90 |
Estradiol-17β (pg/mL) | 76.4 ± 33.80 ns | 140.3 ± 177.4 ns |
11-kt (pg/mL) | ND | ND |
GH (pg/mL) | 12.9 ± 6.20 ns | 14.6 ± 4.1 ns |
Cortisol (ng/mL) | 7.7 ± 1.51 ns | 15.2 ± 3.77 ** |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hwang, J.-A.; Park, J.S.; Jeong, H.S.; Hwang, S.D. Influence of 17α-Methyltestosterone on Morphological Deformities and Pigmentation Development in Juvenile Japanese Eels, Anguilla japonica. Animals 2024, 14, 2684. https://doi.org/10.3390/ani14182684
Hwang J-A, Park JS, Jeong HS, Hwang SD. Influence of 17α-Methyltestosterone on Morphological Deformities and Pigmentation Development in Juvenile Japanese Eels, Anguilla japonica. Animals. 2024; 14(18):2684. https://doi.org/10.3390/ani14182684
Chicago/Turabian StyleHwang, Ju-Ae, Jun Seong Park, Hae Seung Jeong, and Seong Don Hwang. 2024. "Influence of 17α-Methyltestosterone on Morphological Deformities and Pigmentation Development in Juvenile Japanese Eels, Anguilla japonica" Animals 14, no. 18: 2684. https://doi.org/10.3390/ani14182684