The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers
by
Yu-Yun Gao
1,2,†,
Xiao-Ping Liu
2,†,
Ying-Huan Zhou
2,
Jia-Yi He
2,
Bin Di
2,
Xian-Yue Zheng
2,
Ping-Ting Guo
2,
Jing Zhang
2,
Chang-Kang Wang
2 and
Ling Jin
1,* 1
China National Engineering Research Center of JUNCAO Technology, Fujian Agriculture and Forestry University, Fuzhou 350002, China
2
College of Animal Science, Fujian Agriculture and Forestry University, Fuzhou 350002, China
*
Author to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2024, 14(20), 2926; https://doi.org/10.3390/ani14202926
Submission received: 28 August 2024
/
Revised: 7 October 2024
/
Accepted: 9 October 2024
/
Published: 11 October 2024
(This article belongs to the Section Animal Nutrition)
Abstract
:Simple Summary
Juncao-substrate Ganoderma lucidum Residue (HWE-JGLR) is a dark brown powder. It is obtained by cultivating G. lucidum using mycorrhizae as culture material and extracting it from the remaining culture substrate after G. lucidum harvesting. The application of HWE-JGLR in animal feeds not only reduces the waste of resources but also promotes the reuse of agricultural resources and sustainable development. In our study, HWE-JGLR not only optimised the growth performance of broilers but also enhanced their immune responses. Specifically, dietary supplementation with HWE-JGLR was associated with increased production and gene expression of the immunomodulatory cytokine interleukin-4 (IL-4) and IL-10. Meanwhile, levels and gene expression of the pro-inflammatory cytokine IL-1β were significantly reduced. In addition, HWE-JGLR enhanced the intestinal barrier aspect in poultry. The addition of HWE-JGLR upregulated the gene expression of the broiler jejunal mucosal tight junction proteins Claudin-1 and ZO-1.
Abstract
The purpose of this experiment was to investigate the effects of Hot Water Extract of Juncao-substrate Ganoderma lucidum Residue (HWE-JGLR) on the immune function and intestinal health of yellow-feather broilers. In an animal feeding experiment, 288 male yellow-feather broilers (1 day old) were randomly allocated to four treatment groups with six replicates of 12 birds each. The control (CON) group was fed a basal diet. HJ-1, HJ-2, and HJ-3 were fed a basal diet supplemented with 0.25%, 0.50%, and 1.00% HWE-JGLR, respectively. The feeding trial lasted for 63 d. The results showed increased ADFI (p = 0.033) and ADG (p = 0.045) of broilers in HJ-3, compared with the CON group. Moreover, higher contents of serum IL-4 and IL-10 and gene expression of IL-4 and IL-10 in jejunum mucosa and lower contents of serum IL-1β and gene expression of IL-1β in jejunum mucosa in HJ-3 were observed (p < 0.05). Additionally, the jejunal mucosal gene expression of Claudin-1 and ZO-1 in HJ-2 and HJ-3 was higher than that in the CON group (p < 0.05). As for the microbial community, compared with the CON group, the ACE index, Shannon index, and Shannoneven index of cecal microorganisms in HJ-2 and HJ-3 were elevated (p < 0.05). PCoA analysis showed that the cecal microbial structure of broilers in HJ-2 and HJ-3 was different from the CON group (p < 0.05). In contrast with the CON group, the broilers in HJ-2 and HJ-3 possessed more abundant Desulfobacterota at the phylum level and unclassified Lachnospiraceae, norank Clostridia vadinBB60 group and Blautia spp. at the genus level, while Turicibacter spp. and Romboutsia spp. were less (p < 0.05). In conclusion, dietary supplementation with HWE-JGLR can improve growth performance, enhance body immunity and intestinal development, and maintain the cecum microflora balance of yellow-feather broilers.
1. Introduction
Ganoderma lucidum (G. lucidum), a traditional Chinese medicine with a long history, derives its medicinal value from a wealth of bioactive components, primarily including polysaccharides, triterpenoids, sterols, lipids, and a variety of amino acids [1,2]. It is noteworthy that after the fruiting bodies of Ganoderma are harvested, the mycelium remaining in the cultivation substrate still harbors valuable resources [3]. In particular, the secondary metabolites produced by this mycelium, namely Ganoderma lucidum polysaccharides (GLP) [4]. GLP consists of the polymerization of a number of monosaccharides, such as glucose, mannose, arabinose, xylose, fucose, glucuronic acid, and galacturonic acid [5]. Hot Water Extract of Juncao-substrate Ganoderma lucidum Residue (HWE-JGLR) is extracted through a special process. The researchers chose Juncao as the culture substrate to cultivate G. lucidum until the G. lucidum fruiting entity matures and is harvested. During this process, while G. lucidum draws nutrients from the Juncao, its mycelium penetrates deep into the substrate and interacts with the raw material of the Juncao, potentially producing and accumulating unique bioactive. HWE-JGLR is a dark brown powdery substance that was finally obtained by Liu et al. [6] after using the hot water extraction method to process the leftover substrate and maximize the retention of the active ingredients therein. Previous studies showed that HWE-JGLR may play a positive role in enhancing the production performance and strengthening the immune function of dairy cows through its rich bioactive ingredients [6,7]. Our previous results showed that supplementation of HWE-JGLR in the diet could regulate lipid metabolism, enhance antioxidant capacity and improve intestinal health in 21-day-old yellow-feather broilers [8].
GLP, as an active ingredient in HWE-JGLR, has shown remarkable efficacy in regulating the immune system and improving gut microbiota [9,10]. GLP can effectively regulate immune cells and release a variety of cytokines to regulate the body’s immune response [11,12]. For example, GLP can elevate the IgG level in mouse serum and enhance the proliferation of splenocytes while elevating the levels of key immunomodulatory factors such as interleukin(IL)-4, IL-6, and interferon-γ (IFN-γ) in mice, enhancing the body’s ability of humoral and cellular immunity [13]. In addition, a study by Song et al. [14] found that GLP promoted the expression of the pro-inflammatory factor tumour necrosis factor-α (TNF-α) and IL-1β in macrophages, further enhancing the immune response. Moreover, GLP can also improve the body’s intestinal environment and regulate the intestinal microflora. GLP not only promotes beneficial bacteria such as Lactobacillus, Propionibacterium, and Bifidobacterium but also inhibits the growth of harmful bacteria such as Corynebacterium, Streptomyces, and Proteus, thereby contributing to the maintenance of intestinal microecological balance [4,15]. Chen et al. [15] further revealed that GLP can adjust the structure of the rat’s gut microbiota, GLP can reduce the relative abundance of Bacteroidetes and Proteus and increase the relative abundance of beneficial bacteria such as thick-walled bacilli, Lactobacillus and Ruminococcus in rats. Khan et al. [16] also revealed that GLP can modulate SFCA levels, which are crucial for maintaining the integrity of the gut barrier and nutrient absorption.
The gut health of poultry is a key factor in enhancing their production performance [17]. However, due to the overuse of antibiotics in recent years, poultry gut health has been negatively impacted [18]. As consumer health concerns continue to grow and awareness of antibiotic resistance issues increases, the need to find products that can replace antibiotics to maintain broiler health has become particularly urgent [19]. Polysaccharides obtained from G. lucidum have a wide range of pharmacological effects, such as antioxidant, immunomodulatory, anti-inflammatory, and antimicrobial properties [20]. However, the high cost of G. lucidum itself has limited its popularity in practical production applications. In contrast, HWE-JGLR extracted from the remaining medium was inexpensive and enriched in GLP. Therefore, we hypothesized that the addition of HWE-JGLR to the feed of yellow-feathered broilers may produce a similar effect as the addition of GLP. This experiment was conducted to investigate the feasibility of applying HWE-JGLR in practical production by determining the effects of HWE-JGLR on growth performance, immune function and intestinal health of yellow-feather broilers. The development of HWE-JGLR feed resources is of great significance for promoting the recycling of agricultural resources and alleviating ecological pressure.
2. Materials and Methods
2.1. Experimental Design, Animals, and Diets
A total of 288 1-day-old male yellow-feather broilers (average weight 34.10 ± 0.08 g, purchased from Fujian Wenshi Poultry Co., Ltd., Fuzhou, China) were randomly divided into four treatments with six replicates each (12 birds per replicate). The feedstuff used in this experiment was provided by Jinhualong Feed Factory (Fuzhou, China). HWE-JGLR includes GLP (15.79%), crude protein (23.58%), and crude fat (0.20%), among other components. GLP content was determined to be 15.79% following the procedure described by Nataraj et al. [21]. As our previous studies have said, the main active ingredient of HWE-JGLR is GLP, and other components are mainly carriers, including stone powder, silica, and lignin, which do not affect the growth performance of animals [8]. It is provided by the National Engineering Research Center of JUNCAO Technology (Fuzhou, China). The CON group was fed a corn-soybean basal diet, and the HJ-1, HJ-2, and HJ-3 were fed a basal diet supplemented with 0.25%, 0.50%, and 1.00% of HWE-JGLR for 63 days, respectively. The experiment was divided into three stages of ration formulation: 1 to 21 d, 22 to 42 d, and 43 to 63 d. The diets were formulated according to the Chinese Feeding Standard of Chicken (NY/T33-2004) [22]. The composition and nutrition level of the basal diet is shown in Table 1, Table 2 and Table 3. Six nutrients of corn, soybean meal and expanded soybeans in the formula were supplemented in Supplementary Table S1.
In the process of raising, broilers were housed in individual cages with 1562.5 cm² per bird. The feed ingredients less than 0.1% in the diet formula were first stirred evenly with the premix, and other feed ingredients greater than 0.1% were poured into the blender and stirred evenly, and then all the feeds were mixed in the blender. Each 50 kg feed needs to be mixed for a 30 min mixer from Changsha Ruijia Xuefeng Machinery Equipment Co., Ltd. (Changsha, Hunan, China). To prevent mildew in the feed, we will configure the feed one week before the start of a phase. The cage is equipped with LED lamps and implements 23 h of light per day and 1 h of dark cycle, and the light intensity is maintained at 50 lx. The temperature setting started at the initial 35 °C, decreased by 2–3 °C per week until it dropped to 22 °C, and maintained this temperature condition until the end of the experiment. At the same time, ensure that the henhouse has a good ventilation system. On day 5 of broiler growth, the chickens were immunized with infectious avian influenza, followed by Newcastle disease vaccination on the 10th and 20th days, respectively. All birds had ad libitum access to feed and water. All the experimental procedures applied in this study were reviewed and approved by the Committee of Animal Experiments of Fujian Agriculture and Forestry University (Fuzhou, Fujian, China, approval ID PZCASFAFU22009). The ethical approval date is 15 July 2021.
2.2. Growth Performance Measurement
A group of 288 1-day-old broilers was randomly selected, and the broilers were weighed and grouped afterward. Then, the average weight was calculated as the initial body weight (0.01 g precision electronic scale). After that, each replicate was weighed on day 63 and recorded as final body weight (0.1 g precision electronic scale). Average daily gain (ADG) was calculated as (total weight on day 63 − initial weight)/63. Feed intake was calculated by recording feed weight and residual feed weight for 63 d (0.01 g precision electronic scale), and the value of (total feed weight − total residual feed weight)/63 was used as the average daily feed intake (ADFI), and the feed gain ratio (F/G) was calculated based on ADG and ADFI.
2.3. Sampling Procedure
On day 63 of the experiment, two healthy yellow-feather broilers close to the average weight were randomly selected from each replicate, and the body weight before slaughter was recorded. After 12 h of fasting, blood samples were obtained from the broilers by puncturing their wing vein. The blood samples collected were centrifuged at 4 °C at 1000× g for 15 min. The supernatant was then collected, and the serum was transferred to −80 °C for further analysis. Approximately 3 cm of tissue from the duodenum, jejunum, and ileum was collected. The contents of the intestine were washed out using a normal saline solution, and then the duodenum, jejunum, and ileum tissue was preserved by fixing it in a 4% formaldehyde solution. Then, three sections of approximately 3 cm of mid-jejunal tissue were taken, and the mucosa was scraped off and frozen at −80 °C to detect digestive enzyme activity and gene expression of tight junction protein. Cecal digesta were collected and stored at −80 °C for 16S rRNA gene sequencing. The spleen, thymus, and bursa of Fabricius were taken and accurately weighed and recorded to calculate the immune organ indexes.
2.4. Determination of Digestive Enzyme Activities
The jejunum mucosa and digesta samples were thawed and homogenized in 0.9% NaCl solution, which was nine times larger in volume than the determining samples. Then, the homogenates were centrifuged at 1000× g for 10 min at 4 °C to obtain the supernatants. Total protein content in the intestinal mucosa was assessed by using a BCA protein quantitative kit purchased from New Cell § Molecular Biotech Co. Ltd. (Suzhou, China). The activities of lipase (Catalog number: A054-1-1), α-amylase (Catalog number: C016-1-1), chymotrypsin (Catalog number: A080-3-1) and trypsin (Catalog number: A080-2-2) were measured by commercial assay kits (Nanjing Jiancheng Bio-Engineering Institute, Nanjing, China) according to the instructions of the manufacturer [23]. The absorbance was detected by spectrophotometry (iMark, Bio-Rad, Hercules, CA, USA).
2.5. Intestinal Morphology
The fixed duodenum, jejunum, and ileum tissue were subjected to hematoxylin and eosin (H&E) staining. The tissue section was examined using a light microscope (Hitachi, Tokyo, Japan). Image-Pro Plus 6.0 software (Media Cybernetics Inc., Bethesda, MD, USA) was used to measure the villus height (VH), crypt depth (CD), and villus height/crypt depth (V/C).
2.6. Gene Expression Analysis by qPCR
Total RNA was extracted from the jejunal mucosa by using the TransZol UP Plus Total RNA Extraction Kit (Catalog number: ER501-01-V2) from Beijing TransGen Biotech Co., Ltd. (Beijing, China) and a Thermo Scientific NanoDrop 2000 Spectrophotometer (Thermo Fisher Scientific, Wilmington, NC, USA) was used to determine the concentration and quality of RNA. Total RNA was reverse-transcribed by using the Synthesis SuperMix for qPCR from Beijing TransGen Biotech Co., Ltd. (Beijing, China). The cDNA was used for quantitative real-time PCR on Applied Biosystems. The relative mRNA expression levels of each target gene were analyzed according to the method described by Livak and Schmittgen (2001) and shown as 2−ΔΔCT. The primer sequences are shown in Table 4.
2.7. Bacterial DNA Extraction and 16S rRNA Gene Sequencing
Cecal contents were collected sterilely and preserved in liquid nitrogen before storage at −80 °C. Total fecal DNA was extracted using the Stool DNA Kit (D4015-01, Omega Bio-tek, Norcross, GA, USA), and the purity and concentration of extracted DNA were assessed by measuring the OD 260/280 and OD 260/230 ratios. DNA was stored at −80 °C for subsequent analysis. For the analysis of microbial diversity and composition of the cecum, we selected the highly variable V3-V4 region of the bacterial 16S rRNA gene as the target region, which was amplified by PCR using specific primers 338F (5′-ACTCCTACGGGAGGCAGCAG-3′) and 806R (5′-GGACTACHVGGGTWTCTAAT-3′) by an ABI GeneAmp 9700 PCR thermocycler (Waltham, MA, USA). Subsequently, the amplification products were purified and sent to the Illumina MiSeq PE300 platform (Illumina, Inc, San Diego, CA, USA) for high-throughput sequencing, a process that was performed by Majorbio Bio-Pharm Technology Co., Ltd. (Shanghai, China) according to established methods to obtain high-quality sequence data. The Venn diagram illustrates unique and shared Amplicon Sequence Variants (ASVs) across groups. Alpha diversity was assessed using accumulated cyclone energy (ACE), Shannon, and Shannoneven diversity indices with the Mothur software (V1.45.3) [24]. Principal coordinate analysis (PCoA) based on Bray–Curtis distances to evaluate sample and group similarities, while intergroup differences were determined by the Analysis of Similarities (ANOSIM) test.
2.8. Data Analysis and Statistics
Statistical analyses were conducted using SPSS, version 22.0 (SPSS, Inc., Chicago, IL, USA). The Shapiro–Wilk test was used to check the normality of all data, and Levene’s test was used to check the homogeneity of variance. Data were evaluated using one-way analysis of variance (ANOVA) with Tukey’s multiple range test, and a p-value < 0.05 was considered statistically significant.
3. Results
3.1. Growth Performance
The effects of HWE-JGLR on growth performance are presented in Table 5. Compared with the CON group, the ADFI (p = 0.033) and ADG (p = 0.045) of broilers supplemented with 0.50% and 1.00% HWE-JGLR increased, and there was a highly significant effect of FBW (p < 0.001) in broilers with 0.25%, 0.50% and 1.00% HWE-JGLR. But there was no difference in IBW, Mortality and F/G (p > 0.05).
3.2. Immune Indicators
Dietary supplementation with HWE-JGLR had no effect on the immune organ index of 63-day-old broilers, as shown in Table 6 (p > 0.05).
Compared with the CON group, the serum contents of IL-4 and IL-10 in HJ-3 increased, and the serum IL-1β content of HJ-3 decreased (p < 0.05). There were no differences in serum IFN-γ, IL-6, IgA, IgG, and IgM of broilers among groups (Figure 1A,B).
3.3. Gene Expression of Cytokines in the Jejunum Mucosa
As shown in Figure 2A, compared with the CON group, the gene expression of IL-1β in the jejunal mucosa of broilers in HJ-1, HJ-2, and HJ-3 decreased. The gene expression of the IL-10 in the jejunal mucosa of broilers in HJ-1, HJ-2, and HJ-3 strengthened, and the gene expression of IL-4 in the jejunal mucosa in HJ-2 and HJ-3 increased (p < 0.05). There were no differences in small intestine mucosal IFN-γ and IL-6 gene expression among the groups (p > 0.05).
3.4. Gene Expression of Tight Junction Protein in the Jejunum Mucosa
As shown in Figure 2B, compared with the CON group, the gene expression of Claudin-1 in the jejunal mucosa of broilers enhanced in HJ-3, and the gene expression level of ZO-1 in the jejunal mucosa increased in HJ-2 and HJ-3 (p < 0.05). The gene expression of Occludin in the jejunum mucosa was not different among groups (p > 0.05).
3.5. Digestive Enzyme Activity
As shown in Table 7, there were no differences in jejunal digestive enzyme activities among groups (p > 0.05).
3.6. Jejunum Histomorphology
As shown in Table 8, no changes in jejunal VH, CD, and V/C of broilers were observed among groups (p > 0.05).
3.7. Cecal Microbiota
After denoise and quality control, 499,848 16S rRNA gene sequences were obtained from 24 cecal bacterial DNA samples of broilers, and a total of 5851 ASVs were obtained based on the DADA2 modeling algorithm. Rarefaction curve analysis showed that the sequencing data were sufficient to reflect the microbial diversity (Figure 3A). On day 63, there were 882 shared ASVs among groups, whereas 48, 79, 82, and 94 ASVs were identified as only present in the CON group, HJ-1, HJ-2, and HJ-3, respectively (Figure 3B). As shown in Table 9, the ACE index, Shannon index and Shannoneven index of cecum microflora were increased in HJ-2 and HJ-3 compared with the CON group (p < 0.05). As revealed in Figure 3C, PCoA based on the Bray–Curtis distance showed that the distance of samples between groups is far (p = 0.001), indicating that the microbial structure between groups was distinguishing. As presented in Table 10 and Figure 3D, at the phylum level, the cecal microbiota community of broilers was dominated by Firmicutes, Bacteroidota, Desulfobacterota, Actinobacteriota, and Proteobacteria, and their proportions accounted for more than 99%. The relative abundance of Desulfobacterota in HJ-3 was increased compared with the CON group (p < 0.05). At the genus level, the cecal microbiota community was dominated by Romboutsia spp., unclassified Lachnospiraceae, Turicibacter spp., norank Clostridia vadinBB60 group, norank Clostridia UCG-014, Faecalibacterium spp., Blautia spp., Ruminococcus torques group, and Lactobacillus spp. The relative abundances of Romboutsia spp. in HJ-2 and HJ-3 decreased compared with the CON group (p < 0.05). The relative abundances of unclassified Lachnospiraceae and Blautia spp. in HJ-2 and HJ-3 enhanced (p < 0.05). The relative abundance of Turicibacter spp. in HJ-2 decreased (p < 0.05). The relative abundance of norank Clostridia vadinBB60 group among HJ-1, HJ-2, and HJ-3 elevated (p < 0.05). The relative abundances of Ruminococcus torques group in HJ-2 upregulated (p < 0.05) (Table 10 and Figure 3E).
4. Discussion
In recent years, several studies have shown that GLP has a beneficial effect on gut health and growth performance [25,26]. Liu et al. [27] further demonstrated that sporoderm-broken spores of G. lucidum could increase the ADG of poultry and could effectively reduce the F/G of broilers. Moreover, in the field of aquaculture, Mohan et al. [28] further proved that GLP has a positive effect on the production performance of shrimp, which increased ADG, AFDI, and survival rate of shrimp, and disease resistance was also upregulated. Following the results of previous studies, our experiment likewise found a positive effect of the HWE-JGLR on broiler growth performance, further corroborating the above findings. Our experiments showed that the addition of 0.50% and 1.00% of HWE-JGLR to the diet increased ADFI and ADG. To further analyze the mechanism of HWE-JGLR on the growth performance of broilers, we focused on the two dimensions of immune function and intestinal health of broilers.
Cytokines are small molecule proteins with various biological activities secreted by immune cells, which are important mediators in the immune response [29]. Normally, there is a dynamic balance of pro-inflammatory and anti-inflammatory factors in the body, ensuring proper regulation of the immune response [30]. For example, IL-1β acts as a pro-inflammatory factor and is involved in regulating the proliferation, differentiation, and apoptosis of cells involved [31]. As a key immunomodulatory molecule, IL-4 plays a central regulatory role in humoral and adaptive immunity by promoting the proliferation of activated B cells and T cells. On the other hand, IL-10 plays a key role in anti-inflammatory effects, effectively balancing the immune response by down-regulating the expression levels of pro-inflammatory cytokines such as TNF-α and IL-1β [32]. Our results showed that dietary additions of 0.25%, 0.50%, and 1.00% HWE-JGLR significantly altered immune indices in broilers. Specifically, it reduced IL-1β gene expression and enhanced IL-10 gene expression in the jejunal mucosa of broilers. The addition of 0.5% and 1% HWE-JGLR increased the levels of IL-4 content in the serum and the levels of IL-4 gene expression jejunal mucosa of broilers. This is consistent with the results of previous studies that added GLP that 400 mg/kg GLP reduced serum levels of IL-1β and IL-6 in diabetic rats [15], and 800 mg/kg GLP reduced serum IL-6 and TNF-α levels and increased serum IL-2, IL-4, and IL-10 levels in rats with gastric cancer [33]. On this basis, we speculate that the immunomodulatory mechanism of HWE-JGLR may involve direct activation of immune cells and act through specific receptor pathways. It has been revealed that GLP can activate the NF-κB and p38 MAPK signalling pathways by binding to TLR4 on the surface of macrophages, triggering a series of immune responses, including the release of cytokines such as TNF-α [34]. In addition, the interaction of GLP with pattern recognition receptors (PRRs) promotes the synthesis and release of immune-related molecules such as cytokines, chemokines, and nitric oxide (NO), further activating and directing immune cell functions [11]. Consequently, we infer that HWE-JGLR may interact with receptors on the membrane of immune cells, activating signaling pathways such as NF-κB and p38 MAPK, which in turn regulate the expression of cytokines. This mechanism effectively adjusts the immune balance in broilers, leading to improved growth performance.
The integrity of the intestinal barrier and the stability of the intestinal flora are key factors affecting the intestinal health of broilers. Healthy intestinal status can directly enhance broiler performance by improving nutrient absorption efficiency, maintaining intestinal microbial balance, and enhancing immune response [35]. As a natural bioactive substance, GLP has been widely studied and proven to have a positive effect on regulating intestinal microbial communities, maintaining intestinal homeostasis, and promoting intestinal health [16,36,37]. Sang et al. [36] found that 300 mg/kg GLP elevated gene expression of Occludin, Claudin-1, and ZO-1 in mice on a high-fat diet. We generally consider that upregulation of Claudin-1 and ZO-1 gene expression effectively maintains cell polarity, intercellular adhesion fixation, and ion transport in cellular bypass in epithelial and endothelial cells [38]. Consequently, we infer that the HWE-JGLR potentially fosters a positive influence on the intestinal barrier function and the stability of the gut microbiota in broilers. As we expected, in terms of intestinal barrier function, the addition of 0.5% and 1% HWE-JGLR increased gene expression of ZO-1 in broiler jejunal mucosa, and 1.00% of HWE-JGLR elevated jejunal mucosa Claudin-1 gene expression. In maintaining the homeostasis of gut microbiota, Ren et al. [39] found that GLP increased the diversity of gut microbial communities in high-diet mice and increased the abundance of beneficial bacteria such as Mycobacterium spp. Chen et al. [15] found that 400 mg/kg GLP reduced the abundance of harmful bacteria such as Aerococcus, Rumenococcus, Corynebacterium, and Aspergillus in type 2 diabetic rats. Additionally, Guo et al. [40] demonstrated that GLP ameliorated microbiota dysbiosis and increased the abundance of beneficial Bifidobacterium and Lactobacillus strains as well as the production of SCFAs by inhibiting TLR4/MyD88/NF-κB signaling, which attenuated endotoxaemia. Therefore, we infer that HWE-JGLR may play a role in enhancing the abundance and diversity of microbial communities in the broiler cecum, increasing the abundance of beneficial intestinal bacteria and inhibiting the colonisation of harmful bacteria. As we expected, our results showed that dietary supplemented with 0.50% and 1.00% HWE-JGLR increased the microbial α-diversity and affected the microbial composition of broilers. Blautia spp. is an anaerobic bacterium that produces bacteriocins to prevent pathogen colonization, efficiently promotes metabolism and regulates host health by upregulating T cell and SCFA production [41]. Our results showed that dietary supplemented with 0.50% and 1.00% HWE-JGLR increased the relative abundance of Blautia spp. in the cecum of broilers. In addition, we found that the relative abundance of Turicibacter spp. in the cecum of broilers was decreased by the supplement of HWE-JGLR. Liang et al. [42] showed that Turicibacter spp. was positively correlated with pro-inflammatory cytokines. Thus, the decrease in the relative abundance of Turicibacter spp. may be due to a decrease in the expression of the pro-inflammatory factor IL-1β due to the addition of HWE-JGLR. In conclusion, HWE-JGLR can indirectly regulate the pro-inflammatory state in the gut to maintain the homeostasis of the intestinal flora by increasing the abundance of beneficial bacteria and decreasing the abundance of potentially harmful bacteria.
5. Conclusions
In conclusion, dietary supplementation of HWE-JGLR can enhance the production of immuno-modulatory cytokines IL-4 and IL-10 and upregulate their gene expression. At the same time, HWE-JGLR could significantly reduce the level and gene expression of pro-inflammatory cytokine IL-1β. In addition, the addition of HWE-JGLR upregulated the gene expression of tight junction proteins Claudin-1 and ZO-1 in the jejunum mucosa of broilers and strengthened the intestinal barrier of broilers. It can effectively regulate the intestinal flora and increase the number of beneficial bacteria. Therefore, it is recommended to supplement 1.00% HWE-JGLR in broiler diets. All results indicate that HWE-JGLR may be a good feed additive that can replace GLP extracted from G. lucidum fruiting bodies and is a new functional additive in the production of yellow-feather broilers.
Supplementary Materials
The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14202926/s1, Table S1: Effect of HWE-JGLR on growth performance of 21-day-oldyellow-feather broilers.
Author Contributions
Data curation Y.-Y.G., X.-P.L. and Y.-H.Z.; Investigation, X.-P.L., J.-Y.H., B.D., X.-Y.Z., P.-T.G., J.Z. and C.-K.W.; Methodology, Y.-Y.G.; Resources, L.J.; Supervision, Y.-Y.G. and L.J.; Visualization, X.-P.L. and J.-Y.H.; Writing—original draft, X.-P.L. and J.-Y.H.; Writing—review & editing, Y.-Y.G., X.-P.L., Y.-H.Z. and J.-Y.H. All authors have read and agreed to the published version of the manuscript.
Funding
This study was supported by the National Key Research and Development Program of China (2023YFD1600500), the Agricultural Guiding (Key) Project of Fujian Provincial Science and Technology Department (2023N0008), Science and Technology Development Projects Funded by Chinese Central and Local Governments (2022L3085), Science and Technology Innovation Special Fund Project of Fujian Agriculture and Forestry University (KFB23099A), Project of Natural Science Foundation of Fujian Province (2022J01587), and Fujian Specialist Funds of Chicken Industrial System in China (K83139297, 2019–2022).
Institutional Review Board Statement
All experimental procedures and animals were approved by the Fujian Agriculture and Forestry University Animal Care and Use Committee.
Informed Consent Statement
Informed consent was obtained from all subjects involved in the study.
Data Availability Statement
Most of the data generated or analyzed in this study are presented in this published article or its Supplementary Information. Additional data not included here are accessible upon reasonable request to the corresponding author.
Conflicts of Interest
All authors declare no conflict of interest.
References
- Qin, X.; Fang, Z.; Zhang, J.; Zhao, W.; Zheng, N.; Wang, X. Regulatory effect of Ganoderma lucidum and its active components on gut flora in diseases. Front. Microbiol. 2024, 15, 1362479. [Google Scholar] [CrossRef]
- Cör Andrejč, D.; Knez, Ž.; Knez Marevci, M. Antioxidant, antibacterial, antitumor, antifungal, antiviral, anti-inflammatory, and nevro-protective activity of Ganoderma lucidum: An overview. Front. Pharmacol. 2022, 13, 934982. [Google Scholar] [CrossRef] [PubMed]
- Qiu, W.L.; Lo, H.C.; Lu, M.K.; Lin, T.Y. Significance of culture period on the physiochemistry and anti-cancer potentials of polysaccharides from mycelia of Ganoderma lucidum. Int. J. Biol. Macromol. 2023, 242, 125181. [Google Scholar] [CrossRef]
- Jin, M.L.; Zhu, Y.M.; Shao, D.Y.; Zhao, K.; Xu, C.L.; Li, Q.; Yang, H.; Huang, Q.S.; Shi, J.L. Effects of polysaccharide from mycelia of Ganoderma lucidum on intestinal barrier functions of rats. Int. J. Biol. Macromol. 2017, 94, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Jin, M.L.; Zhang, H.; Wang, J.J.; Shao, D.Y.; Yang, H.; Huang, Q.S.; Shi, J.L.; Xu, C.L.; Zhao, K. Response of intestinal metabolome to polysaccharides from mycelia of Ganoderma lucidum. Int. J. Biol. Macromol. 2019, 122, 723–731. [Google Scholar] [CrossRef]
- Liu, Y.L.; Zhao, C.; Lin, D.M.; Lin, H.; Lin, Z.X. Effect of water extract from spent mushroom substrate after Ganoderma balabacense cultivation by using JUNCAO technique on production performance and hematology parameters of dairy cows. J. Anim. Sci. 2015, 86, 855–862. [Google Scholar] [CrossRef]
- Liu, Y.L.; Zhao, C.; Lin, D.M.; Lan, H.J.; Lin, Z.X. Effects of Ganoderma lucidum Spent Mushroom Substrate Extract on Milk and Serum Immunoglobulin Levels and Serum Antioxidant Capacity of Dairy Cows. Trop. J. Pharm. Res. 2015, 14, 1049–1055. [Google Scholar] [CrossRef]
- Gao, Y.Y.; Zhou, Y.H.; Liu, X.P.; Di, B.; He, J.Y.; Wang, Y.T.; Guo, P.T.; Zhang, J.; Wang, C.K.; Jin, L. Ganoderma lucidum polysaccharide promotes broiler health by regulating lipid metabolism, antioxidants, and intestinal microflora. Int. J. Biol. Macromol. 2024, 280, 135918. [Google Scholar] [CrossRef]
- Lu, J.H.; He, R.J.; Sun, P.L.; Zhang, F.M.; Linhardt, R.J.; Zhang, A.Q. Molecular mechanisms of bioactive polysaccharides from Ganoderma lucidum (Lingzhi), a review. Int. J. Biol. Macromol. 2020, 150, 765–774. [Google Scholar] [CrossRef]
- Ma, Y.Z.; Han, J.B.; Wang, K.F.; Han, H.; Hu, Y.B.; Li, H.; Wu, S.X.; Zhang, L.J. Research progress of Ganoderma lucidum polysaccharide in prevention and treatment of Atherosclerosis. Heliyon 2024, 10, e33307. [Google Scholar] [CrossRef]
- Ren, L.; Zhang, J.; Zhang, T. Immunomodulatory activities of polysaccharides from Ganoderma on immune effector cells. Food Chem. 2021, 340, 127933. [Google Scholar] [CrossRef]
- Wang, X.; Lin, Z. Immunomodulating Effect of Ganoderma (Lingzhi) and Possible Mechanism. Adv. Exp. Med. Biol. 2019, 1182, 1–37. [Google Scholar] [CrossRef] [PubMed]
- Liu, Z.; Xing, J.; Zheng, S.; Bo, R.; Luo, L.; Huang, Y.; Niu, Y.; Li, Z.; Wang, D.; Hu, Y.; et al. Ganoderma lucidum polysaccharides encapsulated in liposome as an adjuvant to promote Th1-bias immune response. Carbohydr. Polym. 2016, 142, 141–148. [Google Scholar] [CrossRef]
- Song, M.; Li, Z.H.; Gu, H.S.; Tang, R.Y.; Zhang, R.; Zhu, Y.L.; Liu, J.L.; Zhang, J.J.; Wang, L.Y. Ganoderma lucidum Spore Polysaccharide Inhibits the Growth of Hepatocellular Carcinoma Cells by Altering Macrophage Polarity and Induction of Apoptosis. J. Immunol. Res. 2021, 2021, 6696606. [Google Scholar] [CrossRef]
- Chen, M.; Xiao, D.; Liu, W.; Song, Y.; Zou, B.; Li, L.; Li, P.; Cai, Y.; Liu, D.; Liao, Q.; et al. Intake of Ganoderma lucidum polysaccharides reverses the disturbed gut microbiota and metabolism in type 2 diabetic rats. Int. J. Biol. Macromol. 2020, 155, 890–902. [Google Scholar] [CrossRef]
- Khan, I.; Huang, G.X.; Li, X.A.; Leong, W.; Xia, W.R.; Hsiao, W.L.W. Mushroom polysaccharides from Ganoderma lucidum and Poria cocos reveal prebiotic functions. J. Funct. Foods 2018, 41, 191–201. [Google Scholar] [CrossRef]
- Yadav, S.; Jha, R. Strategies to modulate the intestinal microbiota and their effects on nutrient utilization, performance, and health of poultry. J. Anim. Sci. Biotechnol 2019, 10, 2. [Google Scholar] [CrossRef]
- Zhu, Q.D.; Sun, P.; Zhang, B.K.; Kong, L.L.; Xiao, C.P.; Song, Z.G. Progress on Gut Health Maintenance and Antibiotic Alternatives in Broiler Chicken Production. Front. Nutr. 2021, 8, 692839. [Google Scholar] [CrossRef]
- Roberts, T.; Wilson, J.; Guthrie, A.; Cookson, K.; Vancraeynest, D.; Schaeffer, J.; Moody, R.; Clark, S. New issues and science in broiler chicken intestinal health: Emerging technology and alternative interventions. J. Appl. Poult. Res. 2015, 24, 257–266. [Google Scholar] [CrossRef]
- Seweryn, E.; Ziała, A.; Gamian, A. Health-Promoting of Polysaccharides Extracted from Ganoderma lucidum. Nutrients 2021, 13, 2725. [Google Scholar] [CrossRef]
- Nataraj, A.; Govindan, S.; Rajendran, A.; Ramani, P.; Subbaiah, K.A.; Munekata, P.E.S.; Pateiro, M.; Lorenzo, J.M. Effects of Carboxymethyl Modification on the Acidic Polysaccharides from Calocybe indica: Physicochemical Properties, Antioxidant, Antitumor and Anticoagulant Activities. Antioxidants 2023, 12, 105. [Google Scholar] [CrossRef]
- NY/T33-2004; Nutritional Requirements of Broiler. Ministry of Agriculture of the People’s Republic of China: Beijing, China, 2004.
- Liu, X.; Lyu, W.; Liu, L.; Lv, K.; Zheng, F.; Wang, Y.; Chen, J.; Dai, B.; Yang, H.; Xiao, Y. Comparison of Digestive Enzyme Activities and Expression of Small Intestinal Transporter Genes in Jinhua and Landrace Pigs. Front. Physiol. 2021, 12, 669238. [Google Scholar] [CrossRef]
- Schloss, P.D.; Westcott, S.L.; Ryabin, T.; Hall, J.R.; Hartmann, M.; Hollister, E.B.; Lesniewski, R.A.; Oakley, B.B.; Parks, D.H.; Robinson, C.J.; et al. Introducing mothur: Open-Source, Platform-Independent, Community-Supported Software for Describing and Comparing Microbial Communities. Appl. Environ. Microbiol. 2009, 75, 7537–7541. [Google Scholar] [CrossRef]
- Chen, H.W.; Yu, Y.H. Effect of Ganoderma lucidum extract on growth performance, fecal microbiota, and bursal transcriptome of broilers. Anim. Feed. Sci. Technol. 2020, 267, 114551. [Google Scholar] [CrossRef]
- Jia, D.S.; Tang, Y.J.; Qin, F.x.; Liu, B.; Hu, T.J.; Chen, W. Ganoderma lucidum polysaccharide alleviates Cd toxicity in common carp (Cyprinus carpio): Neuropeptide, growth performance and lipid accumulation. Comp. Biochem. Phys. C 2023, 271, 109663. [Google Scholar] [CrossRef]
- Liu, T.; Zhou, J.C.; Li, W.X.; Rong, X.P.; Gao, Y.; Zhao, L.H.; Fan, Y.; Zhang, J.Y.; Ji, C.; Ma, Q.G. Effects of sporoderm-broken spores of Ganoderma lucidum on growth performance, antioxidant function and immune response of broilers. Anim. Nutr. 2020, 6, 39–46. [Google Scholar] [CrossRef] [PubMed]
- Mohan, K.; Muralisankar, T.; Uthayakumar, V.; Chandirasekar, R.; Karthick Rajan, D. Dietary Ganoderma lucidum polysaccharides to enhance the growth, immune response and disease resistance of freshwater prawn Macrobrachium rosenbergii. Aquac. Rep. 2019, 14, 100203. [Google Scholar] [CrossRef]
- Martonik, D.; Parfieniuk-Kowerda, A.; Rogalska, M.; Flisiak, R. The Role of Th17 Response in COVID-19. Cells 2021, 10, 1550. [Google Scholar] [CrossRef]
- Yang, C.; Wang, M.; Tang, X.; Yang, H.; Li, F.; Wang, Y.; Li, J.; Yin, Y. Effect of Dietary Amylose/Amylopectin Ratio on Intestinal Health and Cecal Microbes’ Profiles of Weaned Pigs Undergoing Feed Transition or Challenged with Escherichia coli Lipopolysaccharide. Front. Microbiol. 2021, 12, 693839. [Google Scholar] [CrossRef]
- Schroder, K.; Hertzog, P.J.; Ravasi, T.; Hume, D.A. Interferon-gamma: An overview of signals, mechanisms and functions. J. Leukoc. Biol. 2004, 75, 163–189. [Google Scholar] [CrossRef]
- Chen, L.; Sun, M.; Wu, W.; Yang, W.; Huang, X.; Xiao, Y.; Ma, C.; Xu, L.; Yao, S.; Liu, Z.; et al. Microbiota Metabolite Butyrate Differentially Regulates Th1 and Th17 Cells’ Differentiation and Function in Induction of Colitis. Inflamm. Bowel Dis. 2019, 25, 1450–1461. [Google Scholar] [CrossRef]
- Pan, K.; Jiang, Q.; Liu, G.; Miao, X.; Zhong, D. Optimization extraction of Ganoderma lucidum polysaccharides and its immunity and antioxidant activities. Int. J. Biol. Macromol. 2013, 55, 301–306. [Google Scholar] [CrossRef] [PubMed]
- Huang, X.J.; Nie, S.P. The structure of mushroom polysaccharides and their beneficial role in health. Food. Funct. 2015, 6, 3205–3217. [Google Scholar] [CrossRef]
- Ducatelle, R.; Goossens, E.; Eeckhaut, V.; Van Immerseel, F. Poultry gut health and beyond. Anim. Nutr. 2023, 13, 240–248. [Google Scholar] [CrossRef] [PubMed]
- Sang, T.; Guo, C.; Guo, D.; Wu, J.; Wang, Y.; Wang, Y.; Chen, J.; Chen, C.; Wu, K.; Na, K.; et al. Suppression of obesity and inflammation by polysaccharide from sporoderm-broken spore of Ganoderma lucidum via gut microbiota regulation. Carbohydr. Polym. 2021, 256, 117594. [Google Scholar] [CrossRef]
- Ding, Q.A.; Nie, S.P.; Hu, J.L.; Zong, X.Y.; Li, Q.Q.; Xie, M.Y. In vitro and in vivo gastrointestinal digestion and fermentation of the polysaccharide from Ganoderma atrum. Food. Hydrocoll. 2017, 63, 646–655. [Google Scholar] [CrossRef]
- Bhat, A.A.; Najeeb, S.; Lubna, T.; Sabah, N.; Sheema, H.; Muzafar, A.M.; Santosh, K.Y.; Roopesh, K.; Shanmugakonar, M.; Hamda, A.; et al. Claudin-1, A Double-Edged Sword in Cancer. Int. J. Mol. Sci. 2020, 21, 569. [Google Scholar] [CrossRef]
- Ren, F.; Meng, C.; Chen, W.J.; Chen, H.M.; Chen, W.X. Ganoderma amboinense polysaccharide prevents obesity by regulating gut microbiota in high-fat-diet mice. Food Biosci. 2021, 42, 101107. [Google Scholar] [CrossRef]
- Guo, C.; Guo, D.; Fang, L.; Sang, T.; Wu, J.; Guo, C.; Wang, Y.; Wang, Y.; Chen, C.; Chen, J.; et al. Ganoderma lucidum polysaccharide modulates gut microbiota and immune cell function to inhibit inflammation and tumorigenesis in colon. Carbohydr. Polym. 2021, 267, 118–231. [Google Scholar] [CrossRef]
- Liu, X.; Mao, B.; Gu, J.; Wu, J.; Cui, S.; Wang, G.; Zhao, J.; Zhang, H.; Chen, W. Blautia-a new functional genus with potential probiotic properties? Gut Microbes 2021, 13, 1875796. [Google Scholar] [CrossRef]
- Liang, Y.N.; Yu, J.G.; Zhang, D.B.; Zhang, Z.; Ren, L.L.; Li, L.H.; Wang, Z.; Tang, Z.S. Indigo Naturalis Ameliorates Dextran Sulfate Sodium-Induced Colitis in Mice by Modulating the Intestinal Microbiota Community. Molecules 2019, 24, 4086. [Google Scholar] [CrossRef]
Figure 1.
Effects of HWE-JGLR on serum cytokines (A) and immunoglobulins (B) contents of broilers. Values are presented as a mean ± SD. Letters in the case of each cytokine describe significant differences between groups at p < 0.05.
Figure 1.
Effects of HWE-JGLR on serum cytokines (A) and immunoglobulins (B) contents of broilers. Values are presented as a mean ± SD. Letters in the case of each cytokine describe significant differences between groups at p < 0.05.
Figure 2.
Effects of HWE-JGLR on gene expression of jejunal mucosal cytokine (A) and jejunal tight-junction protein (B) in broilers. Values are presented as a mean ± SD. Letters in the case of each cytokine or jejunal tight-junction protein describe significant differences between groups at p < 0.05.
Figure 2.
Effects of HWE-JGLR on gene expression of jejunal mucosal cytokine (A) and jejunal tight-junction protein (B) in broilers. Values are presented as a mean ± SD. Letters in the case of each cytokine or jejunal tight-junction protein describe significant differences between groups at p < 0.05.
Figure 3.
Rarefaction curves of sequencing read (A) and Venn diagram (B) of ASVs in broilers. PCoA analysis based on the Bray-Curtis distance (C). Relative abundance at phylum level (D) and genus level (E) in cecum microbiota. In (B–D) A represents HJ-1, B represents HJ-2, and C represents HJ-3.
Figure 3.
Rarefaction curves of sequencing read (A) and Venn diagram (B) of ASVs in broilers. PCoA analysis based on the Bray-Curtis distance (C). Relative abundance at phylum level (D) and genus level (E) in cecum microbiota. In (B–D) A represents HJ-1, B represents HJ-2, and C represents HJ-3.
Table 1.
Basal diet composition and nutrient levels from 1 to 21 d (air-dry basis).
| Items | Groups | |||
|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | |
| Ingredients, % | ||||
| Corn | 58.03 | 57.70 | 57.38 | 56.71 |
| Soybean meal, 46% CP | 32.64 | 32.57 | 32.48 | 32.35 |
| Expanded soybean | 4.00 | 4.00 | 4.00 | 4.00 |
| Soybean oil | 1.16 | 1.30 | 1.45 | 1.75 |
| Limestone powder | 1.12 | 1.12 | 1.12 | 1.12 |
| Dicalcium phosphate | 1.57 | 1.57 | 1.57 | 1.58 |
| DL-Methionine, 98% | 0.18 | 0.18 | 0.19 | 0.19 |
| HWE-JGLR | 0.00 | 0.25 | 0.50 | 1.00 |
| Premix 1 | 1.00 | 1.00 | 1.00 | 1.00 |
| NaCl | 0.30 | 0.30 | 0.30 | 0.30 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Nutrient levels 2 | ||||
| Metabolizable energy, MJ/kg | 12.12 | 12.12 | 12.12 | 12.12 |
| Crude protein, % | 21.00 | 21.00 | 21.00 | 21.00 |
| Calcium, % | 1.00 | 1.00 | 1.00 | 1.00 |
| Non-phytate phosphorus, % | 0.45 | 0.45 | 0.45 | 0.45 |
| Lysine, % | 1.10 | 1.10 | 1.10 | 1.09 |
| Methionine + Cystine, % | 0.85 | 0.85 | 0.85 | 0.85 |
1 Nutrient levels of premix in Phase 1 (per kg diet): vitamin A, 5000 IU; vitamin D3, 1000 IU; vitamin E, 10 IU; vitamin K3, 0.5 mg; vitamin B1, 1.3 mg; vitamin B2, 3.6 mg; vitamin B6, 2.5 mg; vitamin B12, 0.01 mg; nicotinic acid, 35 mg; pantothenic acid, 10 mg; biotin, 0.15 mg; folic acid, 0.55 mg; choline chloride, 1000 mg; Cu (sulfate), 8 mg; Fe (sulfate), 80 mg; Mn (sulfate), 80 mg; Zn (sulfate), 60 mg; I (iodide), 0.35 mg; Se (selenite), 0.15 mg. 2 Nutrient levels were calculated values.
Table 2.
Basal diet composition and nutrient levels from 22 to 42 d (air-dry basis).
| Items | Groups | |||
|---|---|---|---|---|
| Con | HJ-1 | HJ-2 | HJ-3 | |
| Ingredients, % | ||||
| Corn | 62.89 | 62.56 | 62.23 | 61.57 |
| Soybean meal, 46% CP | 26.45 | 26.38 | 26.31 | 26.17 |
| Expanded soybean | 5.00 | 5.00 | 5.00 | 5.00 |
| Soybean oil | 1.83 | 1.97 | 2.12 | 2.42 |
| Limestone powder | 1.04 | 1.04 | 1.04 | 1.04 |
| Dicalcium phosphate | 1.38 | 1.38 | 1.38 | 1.39 |
| DL-Methionine, 98% | 0.11 | 0.11 | 0.11 | 0.11 |
| HWE-JGLR | 0.00 | 0.25 | 0.50 | 1.00 |
| Premix 1 | 1.00 | 1.00 | 1.00 | 1.00 |
| NaCl | 0.30 | 0.30 | 0.30 | 0.30 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Nutrient levels 2 | ||||
| Metabolizable energy, MJ/kg | 12.54 | 12.54 | 12.54 | 12.54 |
| Crude protein, % | 19.00 | 19.00 | 19.00 | 19.00 |
| Calcium, % | 0.90 | 0.90 | 0.90 | 0.90 |
| Non-phytate phosphorus, % | 0.40 | 0.40 | 0.40 | 0.40 |
| Lysine, % | 0.97 | 0.97 | 0.97 | 0.96 |
| Methionine + Cystine, % | 0.73 | 0.73 | 0.72 | 0.72 |
1 Nutrient levels of premix in Phase 2 (per kg diet): vitamin A, 5000 IU; vitamin D3, 1000 IU; vitamin E, 10 IU; vitamin K3, 0.5 mg; vitamin B1, 1.3 mg; vitamin B2, 3.6 mg; vitamin B6, 2.5 mg; vitamin B12, 0.01 mg; nicotinic acid, 30 mg; pantothenic acid, 10 mg; biotin, 0.15 mg; folic acid, 0.55 mg; choline chloride, 750 mg; Cu (sulfate), 8 mg; Fe (sulfate), 80 mg; Mn (sulfate), 80 mg; Zn (sulfate), 60 mg; I (iodide), 0.35 mg; Se (selenite), 0.15 mg. 2 Nutrient levels were calculated values.
Table 3.
Basal diet composition and nutrient levels from 43 to 63 d (air-dry basis).
| Items | Groups | |||
|---|---|---|---|---|
| Con | HJ-1 | HJ-2 | HJ-3 | |
| Ingredients, % | ||||
| Corn | 71.22 | 70.97 | 70.60 | 69.92 |
| Soybean meal, 46% CP | 18.57 | 18.47 | 18.42 | 17.45 |
| Expanded soybean | 4.00 | 4.00 | 4.00 | 5.00 |
| Soybean oil | 2.48 | 2.58 | 2.74 | 2.86 |
| Limestone powder | 1.00 | 1.00 | 1.00 | 1.00 |
| Dicalcium phosphate | 1.20 | 1.20 | 1.21 | 1.23 |
| DL-Methionine, 98% | 0.11 | 0.11 | 0.11 | 0.11 |
| HWE-JGLR | 0.00 | 0.25 | 0.50 | 1.00 |
| Premix 1 | 0.30 | 0.30 | 0.30 | 0.30 |
| NaCl | 0.12 | 0.12 | 0.12 | 0.13 |
| Total | 100.00 | 100.00 | 100.00 | 100.00 |
| Nutrient levels 2 | ||||
| Metabolizable energy, MJ/kg | 12.96 | 12.96 | 12.96 | 12.96 |
| Crude protein, % | 16.00 | 16.00 | 16.00 | 16.00 |
| Calcium, % | 0.80 | 0.80 | 0.81 | 0.81 |
| Non-phytate phosphorus, % | 0.35 | 0.34 | 0.35 | 0.35 |
| Lysine, % | 0.85 | 0.85 | 0.85 | 0.85 |
| Methionine + Cystine, % | 0.65 | 0.65 | 0.65 | 0.65 |
1 Nutrient levels of premix in Phase 3 (per kg diet): vitamin A, 5000 IU; vitamin D3, 1000 IU; vitamin E, 10 IU; vitamin K3, 0.5 mg; vitamin B1, 1.3 mg; vitamin B2, 3.0 mg; vitamin B6, 2.5 mg; vitamin B12, 0.01 mg; nicotinic acid, 25 mg; pantothenic acid, 10 mg; biotin, 0.15 mg; folic acid, 0.55 mg; choline chloride, 500 mg; Cu (sulfate), 8 mg; Fe (sulfate), 80 mg; Mn (sulfate), 80 mg; Zn (sulfate), 60 mg; I (iodide), 0.35 mg; Se (selenite), 0.15 mg. 2 Nutrient levels were calculated values.
Table 4.
Primer sequences and amplification parameters of reference and target genes.
| Gene | Primer Sequence 5′→3′ | GenBank No. | Product Length/bp |
|---|---|---|---|
| β-Actin | F: GAGAAATTGTGCGTGACATCA R: CCTGAACCTCTCATTGCCA | NM_205518 | 152 |
| IFN-γ | F: CTTCCTGATGGCGTGAAGA R: GAGGATCCACCAGCTTCTGT | NM_205149.2 | 127 |
| IL-1β | F: GGAGCAGGGACTTTGCTGAC R: AAGGACTGTGAGCGGGTGTA | NM_204524.2 | 130 |
| IL-10 | F: GCTGTCACCGCTTCTTCAC R: TCACTTCCTCCTCCTCATCAG | NM_001004414.2 | 164 |
| IL-6 | F: CCTCCTCGCCAATCTGAAGT R: GCACTGAAACTCCTGGTCTTT | NM_204628.1 | 138 |
| IL-4 | F: TCTTCCTCAACATGCGTCAG R: TGGTGGAAGAAGGTACGTAGG | NM_001007079.1 | 127 |
| Claudin-1 | F: ATGGTATGGCAACAGAGTG R: CAGGAGCAGCAGAGGAAT | NM_001013611 | 144 |
| Occludin | F: GATGTCCAGCGGTTACTACTAC R: GAAGAAGCAGATGAGGCAGAG | XM_025144248 | 172 |
| ZO-1 | F: TGCTTCCAGTGCCAACAGA R: CTTGCCAACCGTAGACCATAC | XM_015278981 | 183 |
Table 5.
Effects of HWE-JGLR on growth performance of broilers 1.
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| IBW, g | 34.32 ± 0.17 | 34.31 ± 0.15 | 34.25 ± 0.06 | 34.34 ± 0.12 | 0.072 |
| FBW, g | 2297.50 ± 1.87 a | 2303.50 ± 1.87 b | 2309.50 ± 1.87 c | 2315.50 ± 1.87 d | <0.001 |
| ADFI, g | 80.29 ± 2.61 b | 82.13 ± 2.11 ab | 81.51 ± 0.86 b | 84.71 ± 3.61 a | 0.033 |
| ADG, g | 34.37 ± 1.73 b | 35.79 ± 0.56 ab | 36.02 ± 0.96 a | 36.32 ± 1.16 a | 0.045 |
| F/G | 2.34 ± 0.06 | 2.31 ± 0.03 | 2.28 ± 0.03 | 2.33 ± 0.08 | 0.256 |
| Mortality, % | 5.56 | 1.39 | 2.78 | 2.99 | 0.549 |
1 Values are means of six replicates per treatment with 12 birds each (n = 6). IBW = Initial body weight; FBW = Final body weight; ADFI = average daily feed intake; ADG = average daily gain; F/G = ratio of feed to gain. a–d Means in the same row without the same superscript significantly differ at p < 0.05. The data are presented as mean ± SD.
Table 6.
Effects of HWE-JGLR on immune organ indexes of broilers (g/kg) 1.
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| Spleen index | 1.19 ± 0.33 | 1.10 ± 0.23 | 1.04 ± 0.25 | 1.07 ± 0.20 | 0.223 |
| Thymus index | 2.42 ± 1.49 | 1.56 ± 1.01 | 2.57 ± 1.10 | 2.33 ± 1.34 | 0.074 |
| Bursa of Fabricius index | 1.70 ± 0.40 | 1.54 ± 0.58 | 1.55 ± 0.63 | 1.56 ± 0.62 | 0.549 |
1 Values are means of six replicates per treatment with 12 birds each (n = 6). The data are presented as mean ± SD.
Table 7.
Effects of HWE-JGLR on jejunal digestive enzyme activities of broilers 1.
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| Lipase, U/gprot | 197.83 ± 34.77 | 190.93 ± 56.83 | 200.84 ± 25.77 | 206.10 ± 88.24 | 0.983 |
| Trypsin, U/mgprot | 14,923 ± 2567 | 15,091 ± 1914 | 17,215 ± 2477 | 14,945 ± 2987 | 0.365 |
| Chymotrypsin, U/mgprot | 29.37 ± 10.08 | 30.10 ± 5.48 | 32.87 ± 9.92 | 28.77 ± 6.79 | 0.840 |
| α-amylase, U/gprot | 0.25 ± 0.14 | 0.16 ± 0.05 | 0.23 ± 0.15 | 0.17 ± 0.12 | 0.611 |
1 Values are means of six replicates per treatment with 12 birds each (n = 6) The data are presented as mean ± SD.
Table 8.
Effects of HWE-JGLR on intestinal morphology of 63-day-old broilers 1.
| Items | Groups | p-Value | ||||
|---|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | |||
| Duodenum | VH (μm) | 990.50 ± 50.24 | 1049 ± 190.62 | 1022 ± 197.42 | 1125 ± 148.78 | 0.512 |
| CD (μm) | 82.30 ± 18.54 | 81.66 ± 9.20 | 77.18 ± 4.23 | 83.02 ± 6.83 | 0.798 | |
| V/C | 12.77 ± 2.68 | 13.46 ± 4.19 | 13.46 ± 2.42 | 13.79 ± 1.73 | 0.940 | |
| Jejunum | VH (μm) | 1026 ± 41.24 | 997.30 ± 89.18 | 1054 ± 54.52 | 1141 ± 137.59 | 0.058 |
| CD (μm) | 93.52 ± 7.22 | 95.21 ± 9.30 | 89.75 ± 13.55 | 94.71 ± 9.53 | 0.787 | |
| V/C | 11.16 ± 1.21 | 10.57 ± 1.09 | 12.12 ± 2.25 | 12.18 ± 1.26 | 0.229 | |
| Ileum | VH (μm) | 865.30 ± 111.47 | 966.30 ± 87.30 | 833 ± 167.37 | 875.10 ± 129.29 | 0.331 |
| CD (μm) | 86.01 ± 9.34 | 79.60 ± 10.59 | 77.95 ± 8.19 | 73.09 ± 11.09 | 0.188 | |
| V/C | 10.18 ± 0.96 | 12.50 ± 2.43 | 11.04 ± 2.82 | 12.63 ± 2.93 | 0.264 | |
1 Values are means of six replicates per treatment with 12 birds each (n = 6). The data are presented as mean ± SD.
Table 9.
Effects of water extract of HWE-JGLR on alpha diversity of cecum microorganism 1.
| Items | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| ACE | 188.80 ± 70.09 b | 235.80 ± 36.38 ab | 268.50 ± 27.34 a | 284.40 ± 19.81 a | 0.014 |
| Shannon | 2.73 ± 1.09 b | 3.71 ± 0.75 ab | 4.44 ± 0.31 a | 4.57 ± 0.07 a | 0.004 |
| Shannoneven | 0.52 ± 0.17 b | 0.68 ± 0.12 ab | 0.80 ± 0.04 a | 0.81 ± 0.01 a | 0.002 |
1 Values are means of six replicates per treatment with 12 birds each (n = 6). a,b Means in the same row without the same superscript significantly differ at p < 0.05. The data are presented as mean ± SD.
Table 10.
The relative richness of cecal dominant phyla and genera in 63-day-old broilers 1.
| Items (%) | Groups | p-Value | |||
|---|---|---|---|---|---|
| CON | HJ-1 | HJ-2 | HJ-3 | ||
| Phylum level | |||||
| Firmicutes | 99.05 ± 1.35 | 98.39 ± 1.03 | 97.64 ± 1.00 | 98.13 ± 0.89 | 0.117 |
| Bacteroidota | 0.69 ± 0.99 | 0.99 ± 0.93 | 0.63 ± 0.44 | 0.58 ± 0.72 | 0.759 |
| Desulfobacterota | 0.05 ± 0.09 c | 0.20 ± 0.33 b | 1.10 ± 0.76 a | 0.71 ± 0.43 a | 0.002 |
| Actinobacteriota | 0.06 ± 0.10 | 0.25 ± 0.24 | 0.29 ± 0.18 | 0.45 ± 0.43 | 0.149 |
| Proteobateria | 0.13 ± 0.22 | 0.11 ± 0.12 | 0.26 ± 0.47 | 0.06 ± 0.08 | 0.816 |
| Genus level | |||||
| Romboutsia | 49.96 ± 19.41 a | 31.65 ± 22.58 ab | 9.51 ± 5.96 b | 9.56 ± 5.22 b | 0.006 |
| unclassified Lachnospiraceae | 4.04 ± 4.73 b | 4.69 ± 2.85 b | 15.96 ± 5.10 a | 15.54 ± 6.06 a | 0.001 |
| Turicibacter | 17.82 ± 17.55 a | 6.85 ± 6.29 ab | 1.46 ± 1.40 b | 2.80 ± 2.35 ab | 0.030 |
| norank Clostridia vadinBB60 group | 2.70 ± 2.54 b | 6.14 ± 4.81 a | 9.94 ± 2.18 a | 8.52 ± 4.91 a | 0.026 |
| norank Clostridia UCG-014 | 3.49 ± 2.85 | 8.94 ± 2.69 | 6.11 ± 2.04 | 6.40 ± 1.77 | 0.293 |
| Faecalibacterium | 3.99 ± 3.50 | 6.15 ± 2.70 | 7.54 ± 4.95 | 6.22 ± 3.42 | 0.449 |
| Blautia | 1.18 ± 0.92 b | 3.74 ± 3.45 ab | 8.26 ± 4.73 a | 8.25 ± 3.89 a | 0.002 |
| Ruminococcus torques group | 0.79 ± 0.76 b | 1.89 ± 1.51 b | 3.06 ± 1.49 ab | 5.65 ± 3.23 a | 0.002 |
| Lactobacillus | 0.54 ± 0.76 | 2.92 ± 3.77 | 4.78 ± 9.63 | 1.37 ± 1.06 | 0.460 |
1 Values are means of six replicates per treatment with 12 birds each (n = 6). a–c Means in the same row without the same superscript significantly differ at p < 0.05. The data are presented as mean ± SD.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Gao, Y.-Y.; Liu, X.-P.; Zhou, Y.-H.; He, J.-Y.; Di, B.; Zheng, X.-Y.; Guo, P.-T.; Zhang, J.; Wang, C.-K.; Jin, L. The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers. Animals 2024, 14, 2926. https://doi.org/10.3390/ani14202926
AMA Style
Gao Y-Y, Liu X-P, Zhou Y-H, He J-Y, Di B, Zheng X-Y, Guo P-T, Zhang J, Wang C-K, Jin L. The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers. Animals. 2024; 14(20):2926. https://doi.org/10.3390/ani14202926
Chicago/Turabian StyleGao, Yu-Yun, Xiao-Ping Liu, Ying-Huan Zhou, Jia-Yi He, Bin Di, Xian-Yue Zheng, Ping-Ting Guo, Jing Zhang, Chang-Kang Wang, and Ling Jin. 2024. "The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers" Animals 14, no. 20: 2926. https://doi.org/10.3390/ani14202926
APA StyleGao, Y.-Y., Liu, X.-P., Zhou, Y.-H., He, J.-Y., Di, B., Zheng, X.-Y., Guo, P.-T., Zhang, J., Wang, C.-K., & Jin, L. (2024). The Addition of Hot Water Extract of Juncao-Substrate Ganoderma lucidum Residue to Diets Enhances Growth Performance, Immune Function, and Intestinal Health in Broilers. Animals, 14(20), 2926. https://doi.org/10.3390/ani14202926
Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.
