Biological Mechanisms of Aflatoxin B₁-Induced Bile Metabolism Abnormalities in Ducklings

Simple Summary

Aflatoxin B₁ is highly toxic and widely prevalent, posing a serious threat to both human and livestock health. In production, it has been observed that aflatoxin B₁-contaminated feed can cause the liver of animals to turn green, likely due to abnormal bile metabolism. This study investigated the mechanisms of the effect of aflatoxin B₁ on bile metabolism in ducklings, intending to provide insights into the prevention and control of aflatoxin B₁ in agricultural practices.

Abstract

This study investigated the effects and biological mechanisms of aflatoxin B₁ (AFB₁) on the health and bile metabolism of ducklings. Forty-eight 1-day-old ducklings were randomly assigned to two groups, with six replicates per group. The control group was fed a basic diet, while the AFB₁ group received a diet containing 90 µg/kg of AFB₁. The experiment lasted for 2 weeks. The results showed that 90 µg/kg AFB₁ caused abnormal bile metabolism; damaged liver cell nuclei and mitochondria; and significantly decreased body weight, average daily weight gain, and levels of albumin, total protein, cholesterol, total superoxide dismutase, glutathione peroxidase, and glutathione. It also significantly increased feed conversion efficiency, along with alanine aminotransferase, aspartate aminotransferase, alkaline phosphatase, total bile acids, and malondialdehyde levels. In the liver, the expression levels of CYP7A1, SCD, and other genes were significantly upregulated, while BSEP, FASN, HMGCR, CAT, and other genes were significantly downregulated. In conclusion, AFB₁ causes abnormal bile metabolism and impairs the overall health and liver function of ducklings. Its mechanism of action may involve changes in gene expression related to bile acid metabolism, lipid metabolism, oxidative damage, and cancer pathways.

1. Introduction

Aflatoxins are a type of mycotoxin commonly found in agricultural production that pose a significant threat to both food safety and animal health [1,2]. When ingested by animals, AFB₁ can cause both acute and chronic poisoning, leading to serious health issues [2]. Sensitivity to AFB₁ varies across species, with ducklings being among the most susceptible [3,4]. During production, it was observed that ducks’ livers turned green when feed exceeded the AFB₁ safety threshold (10 µg/kg: Chinese Feed Hygiene Standards/GB 13078-2017), suggesting abnormalities in bile metabolism [5]. Such abnormalities may exacerbate liver damage and influence gene expression in various hepatic metabolic pathways [5,6]. At the same time, previous research in our laboratory has also found that AFB₁-contaminated feed can cause bile stasis in ducks at 28 days. A preliminary study has been conducted to explore the possible reasons for this, which may be related to changes in the expression levels of bile acid synthesis and excretion genes in the liver [7]. However, the timing of the initial occurrence of bile stasis in ducks and changes in the transcriptome response of the liver after bile stasis are still unclear.

The liver plays a crucial role in metabolism and detoxification in animals, and liver damage is often the most evident consequence of AFB₁ poisoning [3,8]. In the liver, AFB₁ undergoes two main processes: activation and detoxification [3,9]. The metabolic activation of AFB₁ involves the CYP450 enzyme system, which also produces large amounts of reactive oxygen species (ROS) [3,10]. The accumulation of ROS can damage mitochondria and trigger apoptosis in liver cells [10,11]. Furthermore, ROS build-up can lead to oxidative stress in the liver, increasing malondialdehyde (MDA) levels [10]. During AFB₁ metabolism, the metabolite AFB₁-exo-8,9-epoxide binds with glutathione (GSH) and is subsequently excreted from the body [3,9]. As a result, AFB₁ poisoning depletes GSH and reduces the activity of antioxidant enzymes such as catalase (CAT), superoxide dismutase (SOD), and glutathione peroxidase (GPX) while simultaneously increasing the levels of peroxides such as MDA [12].

Abnormal bile metabolism can further aggravate liver damage [5,6]. Bile acids, synthesized from cholesterol in the liver, are the main component of bile [13]. The gene CYP7A1 plays a key role in regulating bile acid synthesis, while HMGCS1 and HMGCR regulate cholesterol synthesis [13,14,15,16]. Altered expression of these genes can impact bile acid production [13,14,15,16]. Once synthesized, bile acids are secreted by the liver into the bile duct and stored in the gallbladder [13,17]. When released into the duodenum, bile aids fat digestion and absorption [17]. Bile secretion is regulated by the gene encoding the bile salt export pump (BSEP), facilitating the transport of bile acids from liver cells into the bile duct [17,18]. Abnormalities in these processes can lead to abnormal bile metabolism, further impairing liver function.

In order to determine the earliest time point when AFB₁ causes bile stasis in duck liver and study the changes in gene expression levels in various metabolic pathways of the liver after bile stasis occurs, this study utilized 48 1-day-old Cherry Valley ducks. After observing the effects of AFB₁ on the overall health and liver function of the ducklings, particularly noting abnormal bile metabolism in the second week, transcriptome sequencing was performed to detect changes in hepatic transcriptome responses. Quantitative polymerase chain reaction (qPCR) was also used to validate the transcriptomic findings. This study provides valuable insights into AFB₁ poisoning and its link to bile metabolism abnormalities.

2. Materials and Methods

2.1. Ducklings, Treatments, and Sample Acquisition

This study was approved by the Science Ethics Review Committee of Huazhong Agricultural University (approval number HZAUDU-2024-0008). One-day-old Cherry Valley meat ducklings were purchased from Wuhan Yongsheng Duck Industry Co., Ltd. (Wuhan, China). The experiment consisted of a control group and an AFB₁ treatment group, with six replicates in each group and four ducklings in each replicate. The AFB₁ used in the study was derived from laboratory-cultured fermented products. The basic dietary composition and nutritional levels are provided in

Table 1. Nutritional level of basic diet and feed formula ¹.

Ingredient	Percentage (%)	Nutrient Level	Content
Corn	65.50	ME (kcal/kg)	2800
Soybean meal	30.30	Crude protein (%)	19.00
Soybean oil	1.00	Calcium (%)	0.80
Limestone	1.20	Available phosphorus (%)	0.28
Salt	0.3	Met (%)	0.50
Choline chloride	0.1	Lys (%)	1.12
Lys	0.36	Met + Cys (%)	0.85
Met	0.24
Premix 1	1.00

¹ The premix provided the following per kg of diet: vitamin A, 10,000 IU; cholecalciferol, 2500 IU; vitamin E, 35 mg; thiamine, 2.50 mg; riboflavin, 10 mg; pyridoxine, 5.5 mg; iron, 80 mg; manganese, 90 mg; copper, 10 mg; zinc, 60 mg; selenium, 0.4 mg; iodine, 0.3 mg.

. The diet of the AFB₁ group was supplemented with 90 µg/kg of AFB₁. (The actual content of AFB₁ in the diet was determined using a commercial reagent kit (Romer Labs, Getzersdorf, Austria) [7], and the actual content of AFB₁ was 93 µg/kg.) The ducklings were housed in stainless steel cages with free access to feed and water. Before the formal experiment began, the floor, water dispenser, feeding trough, and duck cage of the duck house were thoroughly cleaned. After the duck house dried, it was sealed and fumigated with formalin and potassium permanganate for disinfection. The doors and windows were opened for three days for ventilation. When the ducklings were 1–3 days old, the heater of the duck house was turned on every day to ensure the indoor temperature remained between 30 and 34 °C. After 4 days of age, the indoor temperature was gradually decreased. The experiment lasted for 2 weeks, and the production performance of the ducklings was recorded weekly.

The ducklings were weighed at the start of the experiment and again at the end of the first and second weeks. At the conclusion of each week, one duckling from each replicate was randomly selected for blood collection from the wing vein. The serum was isolated and stored at −80 °C for subsequent indicator analyses. After using ether to make all the ducklings unconscious, the ducklings were euthanized by acute bloodletting. The ducklings were slaughtered and sampled. The heart and liver were weighed, and a photograph of the liver was taken. Two small pieces of liver tissue were fixed in 2.5% glutaraldehyde and 4% paraformaldehyde solutions, respectively, to prepare ultra-thin paraffin sections. The remaining liver tissue was stored at −80 °C for further indicator analyses.

2.2. Performance Testing

The initial weight of the ducklings was recorded prior to the start of the experiment. The ducklings were then weighed at the end of the first and second weeks to calculate the average daily weight gain. The daily feed intake was recorded, and the remaining feed in the feeders was weighed at the end of each week to calculate the average daily feed consumption. The feed conversion rate was calculated based on the total feed consumed and the weight gain achieved.

2.3. Determination of Serum Biochemical Indicators

The levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), alkaline phosphatase (ALP), total protein (TP), albumin (ALB), triglycerides, cholesterol, total bile acids (TBA), total bilirubin, and direct bilirubin in the serum were measured using a fully automated biochemical analyzer (Beckman, Brea, CA, USA).

2.4. Determination of Bile Acid and Antioxidant Enzyme Content in Liver

The contents of TBA, total SOD (T-SOD), MDA, GPX, and GSH in the liver were determined using a commercial kit (Nanjing Jiancheng Biotechnology Co., Ltd., Nanjing, China), following the manufacturer’s instructions for each assay.

2.5. Haematoxylin and Eosin (H&E) Staining Method

The liver tissue blocks were first immersed in a 4% paraformaldehyde solution for 48 h to ensure complete fixation. The tissue blocks were then removed and dehydrated using graded ethanol solutions. Once dehydrated, the tissue blocks were embedded in paraffin using an embedding machine to create wax blocks. A surgical knife was used to smooth the wax blocks, which were then sectioned into slices approximately 3 µm thick using a paraffin microtome. The sections were mounted onto glass slides, dried, and stained with H&E. Following ethanol dehydration, the slides were mounted with a coverslip and sealed with neutral gum for preservation. The sections were observed and photographed using a microscope (Olympus Co., Ltd., Tokyo, Japan).

2.6. Oil Red O Staining Method

The liver tissue blocks were fixed in a 4% paraformaldehyde solution. This was followed by sequential dehydration in 15% and 30% sucrose solutions. The tissue blocks were then embedded in an optimal cutting temperature compound and sectioned into slices approximately 8 µm thick using a cryostat. The sections were mounted onto glass slides, dried, and fixed with a fixative. The slides were immersed in Oil Red O staining solution for 8 min, followed by haematoxylin staining for 3 min. After staining, the sections were covered with a coverslip and sealed with glycerol gelatine. The slides were then observed and photographed under a microscope (Olympus Co., Ltd., Tokyo, Japan).

2.7. Observation and Analysis of Liver Ultrastructure

The liver tissue blocks were fixed in a 2.5% glutaraldehyde solution for 24 h. This was followed by three washes with phosphate-buffered saline. The tissue blocks were then fixed in osmium tetroxide solution for 2 h and washed thrice with phosphate-buffered saline. After dehydration with acetone, the tissue blocks were embedded in resin. Ultra-thin sections, approximately 60 nm thick, were prepared from the embedded tissue blocks. The sections were mounted onto copper grids and stained with uranyl acetate solution. The sections were then observed and photographed using a transmission electron microscope (Hitachi H-7650, Tokyo, Japan).

2.8. Liver Transcriptome Sequencing

RNA sequencing analysis was conducted on liver samples from both the control and AFB₁ groups, with six replicates in each group. Total RNA was extracted from the liver using Trizol (ABclonal Technology Co., Ltd., Wuhan, China), and mRNA was enriched using magnetic beads conjugated with Oligo (dT). Following reverse transcription to synthesize cDNA from the mRNA template, double-stranded cDNA was synthesized, purified, and repaired. PCR technology was then employed to enrich the cDNA and construct a cDNA library (Luo et al., 2019) [19]. After constructing the cDNA library, sequencing analysis was performed using an Illumina NextSeq 500 sequencer (Illumina, San Diego, CA, USA).

The sequencing results were aligned with the reference genome Anas platyrhynchos (https://www.ncbi.nlm.nih.gov/data-hub/genome/GCA_000355885.1/ accessed on 31 May 2024), using version GCF000355885.1 of the reference genome. Genes with a fold change in expression of ≥1.2 and p < 0.05 between the AFB₁ and control groups were defined as differentially expressed genes. Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) enrichment analyses were performed on these differentially expressed genes.

2.9. Real-Time qPCR

To validate the accuracy of the transcriptome sequencing results, eight genes were randomly selected for real-time qPCR analysis: cholesterol 7-alpha-monooxygenase (CYP7A1), cholesterol 25-hydroxylase (CH25H), cholesterol 24-hydroxylase (CH24H), solute carrier family 51 beta subunit (SLC51B), stearoyl-CoA desaturase (SCD), stearoyl-CoA desaturase 5 (SCD5), superoxide dismutase 1 (SOD1), and catalase (CAT). The primer sequences are listed in

Table 2. Primers for PCR.

Gene Name	Accession	Primer Sequence (5′-3′)	Product Size
CYP7A1	NM_001310351.1	F: CAAAGCAGGAGACCGAGAGA	216 bp
		R: CATTCAGGAACATGCGGAGG
CH24H	XM_027458607.2	F: TGAAAGGAGACGCTCTGGAG	160 bp
		R: TCGGCCTGAACTCTTTCCAT
CH25H	XM_005029425.5	F: CTACGCAATGGACAGACAGC	216 bp
		R: GTTGGATAGTTCTGCGGCTG
SLC51B	XM_005025513.5	F: ATTACTCTGTCCTCGCGCTT	295 bp
		R: ATGGCATCCTCTGAGCTCTC
SCD	XM_027460089.2	F: GGCCATATTCGGGTTGACAC	253 bp
		R: GTCTGCATCTGTCTCGGAGA
SCD5	XM_038177997.1	F: AAGTACATCAACCCCAGGCA	166 bp
		R: CCAACCCCAACCAGAACATG
SOD1	XM_027449207.2	F: TGGACCAAAGGATGCAGAGA	200 bp
		R: CATTCCCAGTTAGCGTGCTC
CAT	XM_027458335.2	F: AATGTGCGTGACTGACAACC	196 bp
		R: ACGTTCATCCTCCTTCAGCA
GAPDH	XM_038180584.1	F: TGAAAGTCGGAGTCAACGGA	249 bp
		R: CACTTGATGTTGCTGGGGTC

. The method for extracting total RNA from the liver was the same as described in the transcriptome sequencing section.

Reverse transcription synthesis of cDNA and qPCR experiments were performed according to the method reported by Wang et al. [20]. The GAPDH gene was used as the internal reference, and the relative expression levels of each gene were calculated using the 2^−ΔΔCt method. During the experiment, different processing steps were divided into different experimental areas for operation, and disposable gloves, suction heads, and centrifuge tubes were used to avoid cross-contamination of the samples.

2.10. Statistical Analysis

The experimental results were analyzed using IBM SPSS Statistics 25 software. After conducting a normal distribution test, all experimental results were analyzed using one-way ANOVA and the Tukey test for differences between groups, and the data are presented as mean ± standard deviation. A p-value of <0.05 was considered indicative of a statistically significant difference between the two groups.

3. Results

3.1. Changes in Growth Performance and Organ Weight

The effects of AFB₁ on the growth performance and organ weight of ducklings are presented in

Table 3. Effect of AFB₁ on growth performance and organ weight of ducklings ¹.

Item	Control	AFB1	p
Initial weight (g)	50.70 ± 2.15	50.92 ± 2.38	0.87
First week
Body weight (g)	178.13 ± 13.71 a	161.46 ± 8.27 b	0.03
Average daily weight gain (g)	18.20 ± 2.03 a	15.79 ± 1.01 b	0.03
Average daily feed intake (g)	29.57 ± 2.34	28.19 ± 1.56	0.26
Feed conversion rate	1.63 ± 0.06 b	1.79 ± 0.07 a	<0.01
Liver weight (g)	5.03 ± 0.46	5.32 ± 1.88	0.73
Heart weight (g)	1.15 ± 0.21	1.17 ± 0.33	0.92
Second week
Body weight (g)	412.92 ± 16.08 a	367.08 ± 23.31 b	<0.01
Average daily weight gain (g)	33.54 ± 0.73 a	28.90 ± 3.45 b	0.01
Average daily feed intake (g)	60.50 ± 3.64	57.50 ± 5.77	0.31
Feed conversion rate	1.80 ± 0.12 b	1.99 ± 0.08 a	0.01
Liver weight (g)	12.67 ± 1.41	11.47 ± 1.66	0.21
Heart weight (g)	3.12 ± 0.28	2.98 ± 0.32	0.46

¹ The values are expressed as the mean ± standard deviation (n = 6). ^a,b Means with different superscripts differ significantly (p < 0.05); the same applies below.

. There was no significant difference in initial body weight between the control and AFB₁ groups, with both averaging around 50 g (p > 0.05) (Table 3). During the first and second weeks, AFB₁ significantly reduced both the body weight and average daily weight gain of the ducklings, while significantly increasing feed conversion efficiency (p < 0.05) (Table 3). AFB₁ had no significant effect on average daily feed intake, liver weight, or heart weight (p > 0.05) (Table 3).

3.2. Changes in Serum Biochemical Indicators

The effect of AFB₁ on serum biochemical indicators in ducklings is shown in

Table 4. Effect of AFB₁ on serum biochemical indicators and bile acid metabolism indicators ¹.

Item	Control	AFB1	p
First week
ALT (U/L)	34.15 ± 1.98 b	51.05 ± 12.85 a	0.01
AST (U/L)	24.23 ± 8.88 b	45.85 ± 10.53 a	<0.01
ALP (U/L)	852.05 ± 227.78	1114.58 ± 785.40	0.45
TP (g/L)	25.03 ± 3.83 a	17.65 ± 4.27 b	0.01
ALB (g/L)	8.47 ± 1.34 a	5.92 ± 2.26 b	0.04
TG (mmol/L)	2.33 ± 1.02	1.36 ± 0.54	0.07
CHOL (mmol/L)	4.79 ± 1.13	4.66 ± 1.43	0.86
TBA (μmol/L)	36.50 ± 13.94	33.42 ± 18.86	0.75
TBiL (μmol/L)	11.10 ± 4.68	11.90 ± 6.36	0.81
DBiL (μmol/L)	0.35 ± 0.25	0.37 ± 0.24	0.85
Second week
ALT (U/L)	37.20 ± 6.53 b	55.58 ± 10.88 a	<0.01
AST (U/L)	27.48 ± 15.94 b	52.55 ± 11.15 a	0.01
ALP (U/L)	728.77 ± 108.79 b	1035.43 ± 134.09 a	<0.01
TP (g/L)	31.65 ± 10.34 a	19.52 ± 5.66 b	0.03
ALB (g/L)	8.85 ± 1.86 a	5.90 ± 2.19 b	0.03
TG (mmol/L)	1.23 ± 0.28 a	0.50 ± 0.19 b	<0.01
CHOL (mmol/L)	5.02 ± 1.15 a	3.70 ± 0.88 b	0.04
TBA (μmol/L)	13.15 ± 4.04 b	26.97 ± 5.82 a	<0.01
TBiL (μmol/L)	6.68 ± 2.05	12.00 ± 6.65	0.09
DBiL (μmol/L)	0.40 ± 0.12	0.63 ± 0.48	0.27

¹ Values are expressed as means ± SD (n = 6), and different superscripts in different columns of the same row indicate significant differences (p < 0.05).

. During both the first and second weeks, AFB₁ significantly increased the levels of ALT and AST in serum while significantly reducing the levels of TP and ALB (p < 0.05) (Table 4). Additionally, in the second week, AFB₁ significantly increased the serum ALP level while significantly decreasing the triglyceride and cholesterol levels (p < 0.05) (Table 4).

Regarding the serum bile acid content, AFB₁ had no significant effect on TBA or total bilirubin levels in ducklings during the first week (p > 0.05) (Table 4). However, in the second week, the serum TBA levels significantly increased in the AFB₁ group (p < 0.05), and although the total bilirubin level showed an upward trend, the difference was not statistically significant (p > 0.05) (Table 4). Changes in the direct bilirubin level were not significant during either the first or second week (p > 0.05) (Table 4).

3.3. Changes in Liver Bile Acid and Antioxidant Enzyme Content

The effects of AFB₁ on bile acid and antioxidant enzyme content in duckling liver are shown in

Table 5. Effect of AFB₁ on liver bile acid and liver antioxidant enzyme content ¹.

Item	Control	AFB1	p
First week
TBA (μmol/L)	14.25 ± 1.80	14.70 ± 3.93	0.80
T-SOD (U/mg protein)	182.53 ± 11.63 a	140.96 ± 21.73 b	<0.01
MDA (nmol/mg protein)	1.68 ± 0.21	1.96 ± 0.33	0.11
GSH-Px (U/mg protein)	89.25 ± 8.53 a	67.23 ± 8.86 b	<0.01
GSH (U/mg protein)	46.75 ± 5.78 a	38.48 ± 4.19 b	0.02
Second week
TBA (μmol/L)	15.84 ± 3.66 b	23.61 ± 3.59 a	<0.01
T-SOD (U/mg protein)	177.71 ± 24.95 a	137.97 ± 15.58 b	<0.01
MDA (nmol/mg protein)	1.59 ± 0.20 b	2.01 ± 0.16 a	<0.01
GSH-Px (U/mg protein)	87.13 ± 11.67 a	64.38 ± 6.78 b	<0.01
GSH (U/mg protein)	45.26 ± 5.78 a	36.53 ± 3.37 b	0.01

¹ Values are expressed as means ± SD (n = 6), and different superscripts in different columns of the same row indicate significant differences (p < 0.05).

. During the first week, there were no significant changes in liver TBA and MDA levels in the AFB₁ group (p > 0.05), whereas T-SOD, GPX, and GSH levels significantly decreased (p < 0.05) (Table 5). In the second week, AFB₁ significantly increased liver TBA and MDA levels while significantly reducing T-SOD, GPX, and GSH levels (p < 0.05) (Table 5).

3.4. Changes in Liver Health and Liver Tissue Structure

The effects of AFB₁ on liver health, tissue structure, and cellular ultrastructure in ducklings are shown in Figure 1. The color of the liver in the control group appeared bright red (Figure 1A). In contrast, the AFB₁ group exhibited signs of fatty liver during the first week, with the liver appearing yellow (Figure 1A). By the second week, the liver in the AFB₁ group continued to exhibit signs of fatty liver, as well as signs of abnormal bile metabolism, with the liver turning a yellow-green color (Figure 1A).

H&E staining revealed that the liver cells in the control group were closely arranged, with no signs of steatosis (Figure 1B). In the AFB₁ group, liver cells displayed vacuolar degeneration caused by fatty infiltration, with increased gaps between the cells (Figure 1B). Oil Red O staining showed a significant accumulation of lipid droplets that were stained orange-red in the AFB₁ group’s liver (Figure 1C). Ultrastructural analysis of the liver showed that in the control group, the nuclear membrane of liver cells was intact, the mitochondrial cristae were well preserved, and the mitochondrial matrix was densely packed and darker in color (Figure 1D). In contrast, liver cells in the AFB₁ group displayed nuclear membrane shrinkage, fragmented mitochondrial cristae, and an empty mitochondrial matrix, as observed under transmission electron microscopy (Figure 1D).

3.5. Statistical Results of Transcriptome Dataset

The quality of liver transcriptome sequencing is presented in

Table 6. Statistical summary of the liver RNA sequencing datasets.

Sample	Raw Reads	Q30(%) Value 1	Clean Reads	Total Mapped
Control-1	43,696,008	96.29	43,407,312	37,874,240 (87.25%)
Control-2	42,541,812	95.70	42,087,594	32,070,452 (76.20%)
Control-3	41,682,592	95.76	41,254,000	32,749,563 (79.39%)
Control-4	44,565,508	95.58	44,055,108	34,348,062 (77.97%)
Control-5	37,918,248	95.69	37,557,418	29,587,206 (78.78%)
Control-6	40,055,144	95.55	39,694,084	31,527,638 (79.43%)
AFB1-1	42,201,282	95.42	41,738,988	31,248,957 (74.87%)
AFB1-2	43,191,696	95.63	42,735,964	32,396,410 (75.81%)
AFB1-3	42,490,296	95.55	42,111,914	31,652,071 (75.16%)
AFB1-4	39,233,296	95.50	38,850,434	29,469,930 (75.85%)
AFB1-5	39,513,334	95.54	39,141,620	30,590,468 (78.15%)
AFB1-6	39,724,756	95.44	39,293,828	29,774,682 (75.77%)

¹ Q30 value refers to the sequencing quality score, indicating a 0.1% probability of error.

. In total, 12 samples were used for transcriptome sequencing analysis, and 12 cDNA libraries were constructed. The paired ends yielded between 37,918,248 and 44,565,508 raw reads from the libraries, with Q30 values ranging from 95.42% to 96.29%, all exceeding 80% (Table 6). After quality control, which involved removing low-quality reads, uncertain bases, and adapter sequences, 37,557,418 to 44,055,108 clean reads were obtained (Table 6). When aligned with the Anas platyrhynchos genome, the proportion of clean reads mapped to the reference genome ranged from 74.87% to 87.25% (Table 6).

3.6. Differential Analysis of Gene Expression Levels

The liver transcriptome sequencing results are shown in Figure 2 and Supplementary Document S1. In total, 6262 genes were differentially expressed in the liver of the AFB₁ group, with 3257 genes significantly upregulated and 3005 genes significantly downregulated (Figure 2A) (p < 0.05). The GO enrichment analysis revealed that genes with significant differences related to bile acid metabolism and AFB₁ toxicity were mainly involved in pathways such as oxidoreductase activity, organic acid metabolic processes, fatty acid metabolic processes, and organic acid catabolism (Figure 2B). The KEGG enrichment analysis indicated that genes linked to bile acid metabolism and AFB₁ toxicity were distributed in pathways such as primary bile acid biosynthesis, GSH metabolism, the PPAR signaling pathway, cellular senescence, cholesterol metabolism, and peroxisomes (Figure 2C).

Table 7. Changes in differential gene expression levels in various metabolic pathways of duckling liver.

Gene ID	Gene Symbol	Log2 (Fold Change)	Gene Description
Bile acid synthesis pathway
16440	HSD17B4	−1.16	hydroxysteroid 17-beta dehydrogenase 4
19755	CH25H	1.43	cholesterol 25-hydroxylase
3365	CYP7A1	2.18	cholesterol 7-alpha-monooxygenase
1859	HSD3B7	−0.92	hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7
20691	LOC101805427	−1.13	24-hydroxycholesterol 7-alpha-hydroxylase
12643	LOC101797844	0.60	acyl-coenzyme A amino acid N-acyltransferase 2
16937	AMACR	−1.21	alpha-methylacyl-CoA racemase
17396	ACOX2	−1.00	acyl-CoA oxidase 2
679	LOC101791081	−1.98	25-hydroxycholesterol 7-alpha-hydroxylase
17705	SCP2	−0.89	sterol carrier protein 2
11512	CH24H	0.95	cholesterol 24-hydroxylase
11839	LOC101802865	−1.47	sterol 26-hydroxylase, mitochondrial
Bile secretion signaling pathway
9766	BSEP	−1.05	ATP binding cassette subfamily B member 11
12806	ATP1B4	−1.45	ATPase Na+/K+ transporting family member beta 4
2095	ATP1B3	0.95	ATPase Na+/K+ transporting subunit beta 3
8315	NCEH1	1.27	neutral cholesterol ester hydrolase 1
16116	SLC51B	−0.53	solute carrier family 51 beta subunit
11264	ABCB5	1.73	ATP binding cassette subfamily B member 5
15489	ADCY2	−1.67	adenylate cyclase 2
17247	SLC51A	0.81	solute carrier family 51 alpha subunit
14631	ADCY3	2.20	adenylate cyclase 3
14939	KCNN2	−0.65	potassium calcium-activated channel subfamily N member 2
19874	ATP1B1	−1.13	ATPase Na+/K+ transporting subunit beta 1
6195	ABCG8	−3.41	ATP binding cassette subfamily G member 8
6196	ABCG5	−4.00	ATP binding cassette subfamily G member 5
11334	SCTR	3.24	secretin receptor, transcript variant X1
15107	NR1H4	−0.52	nuclear receptor subfamily 1 group H member 4
Lipid synthesis metabolic pathway
6139	ACSL4	1.02	acyl-CoA synthetase long-chain family member 4
12495	ACADL	−0.34	acyl-CoA dehydrogenase, long chain
14836	FADS2	−0.79	fatty acid desaturase 2
15821	SCD	2.34	stearoyl-CoA desaturase
7095	ACOX3	−1.12	acyl-CoA oxidase 3
5424	ACSL5	−1.46	acyl-CoA synthetase long-chain family member 5
6369	FABP3	2.87	fatty acid binding protein 3
7566	CD36	−1.63	CD36 molecule, transcript variant X6
1228	PPARA	−0.94	peroxisome proliferator activated receptor alpha
4591	SCD5	1.72	stearoyl-CoA desaturase 5
17466	HMGCS1	−0.81	3-hydroxy-3-methylglutaryl-CoA synthase 1
2844	HMGCR	−0.56	3-hydroxy-3-methylglutaryl-CoA reductase
2806	FASN	−1.81	fatty acid synthase
17756	ACAA1	−0.47	acetyl-CoA acyltransferase 1
Liver oxidative damage pathway
13087	MGST2	−0.74	microsomal glutathione S-transferase 2
7302	GSTK1	−1.01	glutathione S-transferase kappa 1
14244	GGT1	1.31	gamma-glutamyltransferase 1
1745	GPX3	1.26	glutathione peroxidase 3
386	GCLC	1.32	glutamate-cysteine ligase catalytic subunit
392	LOC101797138	3.32	glutathione S-transferase, transcript variant X2
394	LOC101798048	0.77	glutathione S-transferase, transcript variant X1
19681	GPX4	1.20	glutathione peroxidase 4
17700	GPX7	2.19	glutathione peroxidase 7
10599	GPX8	0.97	glutathione peroxidase 8
8664	SOD1	−0.36	superoxide dismutase 1
2543	CAT	−1.38	catalase
9868	PXMP4	−1.25	peroxisomal membrane protein 4
19397	PEX6	−0.42	peroxisomal biogenesis factor 6
8522	PEX7	−0.80	peroxisomal biogenesis factor 7
Cancer pathway
9473	MAP2K2	−0.48	mitogen-activated protein kinase kinase 2
5570	LRP5L	−1.27	LDL receptor related protein 5 like
13087	MGST2	−0.74	microsomal glutathione S-transferase 2
1418	WNT5B	1.41	Wnt family member 5B
13470	CCND1	1.29	cyclin D1
6331	PIK3CD	−2.21	phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit delta
9391	PRKCB	−0.44	protein kinase C beta
14575	CDKN1A	2.95	cyclin dependent kinase inhibitor 1A
8778	AKT3	0.79	AKT serine/threonine kinase 3
11885	FGFR2	1.00	fibroblast growth factor receptor 2
13263	IGF1	−1.53	insulin like growth factor 1
16734	IGF2	−0.55	insulin like growth factor 2
6458	FGF2	1.18	fibroblast growth factor 2
12322	PTK2	−0.77	protein tyrosine kinase 2

summarizes the differential genes and their expression changes related to bile acid synthesis, bile secretion signaling, lipid synthesis, liver oxidative damage, and cancer pathways. The expression levels of CYP7A1, CH24H, and CH25H in the bile acid synthesis pathway were significantly upregulated (p < 0.05), while the expression levels of BSEP, ABCG5, and ABCG8 in the bile acid efflux pathway were significantly downregulated (p < 0.05). In the lipid synthesis pathway, the expression levels of SCD and SCD5 were significantly upregulated (p < 0.05), while FASN, FADS2, HMGCS1, and HMGCR were significantly downregulated (p < 0.05). Additionally, in the oxidative damage pathway, CAT, SOD1, GSTK1, and MGST2 expression levels were significantly downregulated (p < 0.05).

Real-time qPCR showed that AFB₁ significantly upregulated the expression of CYP7A1, CH25H, CH24H, SCD, and SCD5 in the liver and significantly downregulated the expression of SLC51B, SOD1, and CAT (Figure 2D) (p < 0.05).

4. Discussion

4.1. The Effect of AFB₁ on the Production Traits of Ducklings

This study showed that AFB₁ led to a decrease in body weight and average daily weight gain in ducklings, and increased feed conversion efficiency. Sumantri et al. [21] reported that adding 100 µg/kg AFB₁ to the diet of laying ducks significantly reduced both body weight and average daily weight gain. Similarly, Wang et al. [22] found that acute toxicity experiments on ducklings with 0.3 mg/kg body weight of AFB₁ led to reduced body weight and feed intake. Additionally, Feng et al. [23] showed that feeding ducks AFB₁-contaminated corn significantly reduced their final weight, average daily feed intake, and daily weight gain. In addition, previous research in the laboratory has shown that AFB₁ also has adverse effects on body weight, daily weight gain, and feed intake of meat ducks at 2–4 weeks [7]. The results of this study align with previous reports, confirming that AFB₁ poisoning negatively impacts the growth of ducklings.

4.2. The Effect of AFB₁ on the Serum Biochemistry of Ducklings

Serum biochemical indicators reflect the body’s metabolic status [22,24,25]. This study revealed that AFB₁ significantly increased the levels of three transaminases in the serum of ducklings, suggesting liver damage in the AFB₁ group [22,24,25]. Simultaneously, the levels of TP and ALB significantly decreased, indicating impaired liver synthesis, a further manifestation of liver injury [22,25]. Additionally, the liver of the AFB₁ group turned yellow, and large numbers of lipid droplets were observed in the liver tissue, indicating fatty degeneration and abnormal lipid metabolism. Salem et al. [26] found similar effects in broiler chickens, and Altyar et al. [27] showed that the oral administration of AFB₁ significantly increased ALT, AST, and ALP levels in rats. In addition, laboratory researchers reported that AFB₁ increased ALT and AST levels in meat duck’s serum while decreasing ALB and TP levels [7,22]. These findings are consistent with previous reports, indicating that AFB₁ causes liver damage and disrupts body metabolism, which likely contributes to the decline in production performance observed in ducklings after AFB₁ poisoning.

4.3. The Effect of AFB₁ on Organelle Structure and Antioxidant Indicators in Ducklings

The nucleus and mitochondria are critical organelles in liver cells [28]. In this study, the nuclei and mitochondria of liver cells in the AFB₁ group were damaged. This may have been due to the blockade of mitochondrial protein synthesis during chronic poisoning, which impairs the repair of damaged cristae [29,30]. Mitochondrial damage can induce apoptosis, causing wrinkling of the nuclear membrane [31]. Additionally, a decrease in antioxidant enzyme levels and increased MDA content were observed, suggesting that AFB₁ induced oxidative stress in the liver. Altyar et al. [27] found that AFB₁ significantly increased nitric oxide and MDA levels in the heart and liver of rats while reducing SOD, GPX, GSH, and CAT levels. In addition, previous research in the laboratory has also produced similar findings, showing that AFB₁ damages the nuclei and mitochondria of liver cells and reduces antioxidant levels [7,22]. These results, in line with our study, indicate that AFB₁ induces oxidative stress and apoptosis in the liver. This may explain the inhibited growth in the AFB₁ group.

4.4. The Effect of AFB₁ on Bile Acid Metabolism in Duckling Liver

The liver is the primary site of bile acid synthesis [32]. Bile acids are transported back to the liver via the portal vein after performing their function in the intestine [32]. This study showed that TBA levels in the liver of the AFB₁ group significantly increased in the second week, with the liver turning yellow-green, indicating abnormal bile metabolism [5,6]. In previous studies, we also found that adding 90 µg/kg of AFB₁ to the feed can cause bile stasis in the liver of meat ducks in the fourth week [7]. The results of this study are similar to those of previous research. Excess bile in the liver may activate a protective mechanism that reduces bile production, preventing bile acids in the blood from being reused, thus leading to elevated bile acid levels in the serum. Interestingly, the liver did not turn green, nor did bile acid levels show significant changes during the first week. This suggests that the effect of AFB₁ on bile metabolism may be time-dependent.

4.5. Changes in Liver Transcriptome

To date, there have been no reports on the liver transcriptome response after abnormal bile metabolism in ducklings. Transcriptome quality control results in this study showed that all pre-processing steps met sequencing requirements [15,19]. Additionally, the qPCR results closely matched those obtained from transcriptome sequencing, further confirming the reliability of the transcriptome data [15,19]. Differential gene expression analysis classified these genes into four categories: bile acid metabolism, lipid metabolism, oxidative damage, and cancer.

4.6. Changes in Bile Acid Synthesis Genes

The liver synthesizes bile acids from cholesterol, with CYP7A1 acting as the key rate-limiting enzyme [13,32]. CH24H and CH25H are also critical genes involved in bile acid synthesis [13,33,34]. This study showed that AFB₁ significantly upregulated these genes, indicating that AFB₁ increases bile acid synthesis, which may explain the liver’s green color and abnormal bile metabolism. Additionally, BSEP, ABCG5, and ABCG8 expression levels in the AFB₁ group were downregulated. These genes regulate bile acid efflux from the liver, and their reduced expression may hinder this process, leading to increased bile acid content and exacerbating symptoms of bile metabolism abnormalities [17,18,35,36]. Previous reports suggest that AFB₁ affected the expression of CYP7A1 and BSEP genes in the liver of meat ducks in the fourth week and also affected bile acid metabolism in mice and rats [7,37,38]. This study extends those findings to ducklings, showing that increased bile acid synthesis and impaired efflux contribute to abnormal bile metabolism in ducklings.

4.7. Changes in Cholesterol Synthesis Genes

The liver is also a key organ for cholesterol synthesis, with HMGCS1 and HMGCR acting as rate-limiting enzymes [15,16]. This study showed that AFB₁ significantly downregulated these genes, indicating reduced cholesterol synthesis, which may explain the decrease in serum cholesterol levels. Zhou et al. [39] reported that AFB₁ increased cholesterol levels, including total cholesterol, in HepG2 liver cancer cells, and Ismail et al. [40] found increased cholesterol levels in rabbit serum. The discrepancy between this study and previous research may be due to dosing differences or ducklings’ heightened sensitivity to AFB₁ [3]. Further research is needed to clarify these findings.

4.8. Changes in Lipid Synthesis Genes

Fatty acid metabolism is another critical liver function [41]. Stearoyl-CoA desaturase (SCD) is a rate-limiting enzyme involved in synthesizing monounsaturated fatty acids, playing a key regulatory role in fatty acid metabolism [42]. This study showed that the expression of SCD and SCD5 was upregulated in the AFB₁ group. Increased SCD expression can lead to triglyceride accumulation, potentially causing fatty liver [42,43]. This may explain the fatty degeneration observed in the AFB₁ group. Additionally, the expression of FASN and FADS2 was downregulated, possibly due to a negative feedback mechanism triggered by lipid accumulation. Further research is needed to explore this regulation in detail.

4.9. Changes in Antioxidant-Related Genes

AFB₁ can induce the production of ROS, leading to oxidative damage in the liver [3,10,11]. CAT, SOD1, GSTK1, and MGST2 are genes related to antioxidant activity, and this study showed that AFB₁ downregulated their expression in the liver [22,44,45]. Wang et al. [22] similarly reported that AFB₁ significantly reduces the levels of GPX1, SOD1, and CAT in the duckling liver. These results suggest that AFB₁ impairs the expression of oxidative damage-related genes, contributing to the reduction in antioxidant capacity observed in the AFB₁ group.

4.10. Biological Mechanism of AFB₁-Induced Poisoning in Ducklings

AFB₁ causes changes in the expression levels of genes involved in cholesterol metabolism, lipid metabolism, and antioxidant pathways in the liver. These changes are the main cause of liver damage and subsequently lead to decreased production performance and health impairment in ducklings. Considering the effects of AFB₁ on the production performance and health of ducklings, as well as the functions of differentially expressed genes from the transcriptome data, a biological mechanism pathway of AFB₁-induced abnormal bile metabolism in ducklings was developed (Figure 3). AFB₁ damages liver tissue and organelles, impairing growth. The abnormal expression of related genes in the liver is a key factor contributing to abnormal bile metabolism.

5. Conclusions

AFB₁ not only affects the growth and liver health of ducklings, but it also leads to abnormal bile metabolism in the liver. The abnormal expression of genes related to bile acid metabolism, lipid metabolism, oxidative damage, and cancer may be key factors contributing to AFB₁-induced liver damage and bile metabolism abnormalities. Additionally, this study was the first to identify a time-dependent effect of AFB₁ on bile metabolism in ducklings. In summary, this study provides valuable insights for research on bile metabolism abnormalities and the prevention and control of AFB₁ in poultry farming.