Next Article in Journal
Effect of High-Tannin and -Polyphenol Plant Material Supplement on Rumen Fermentation, Nitrogen Partitioning and Nutrient Utilization in Beef Cattle
Previous Article in Journal
Communication as a Tool for Exhibiting Prosocial Behavior in Dogs
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Pattern of Gene Expression (Igf Family, Muscle Growth Regulatory Factors, and Osteogenesis-Related Genes) Involved in the Growth of Skeletal Muscle in Pikeperch (Sander lucioperca) During Ontogenesis

by
Fatemeh Lavajoo Bolgouri
1,2,
Bahram Falahatkar
1,*,
Miquel Perelló-Amorós
2,
Fatemeh Moshayedi
2,
Iraj Efatpanah
1 and
Joaquim Gutiérrez
2,*
1
Fisheries Department, Faculty of Natural Resources, University of Guilan, Sowmeh Sara, 1144, Guilan, Iran
2
Department of Cell Biology, Physiology and Immunology, Faculty of Biology, University of Barcelona, 08028 Barcelona, Spain
*
Authors to whom correspondence should be addressed.
Animals 2024, 14(21), 3089; https://doi.org/10.3390/ani14213089
Submission received: 22 August 2024 / Revised: 28 September 2024 / Accepted: 21 October 2024 / Published: 26 October 2024
(This article belongs to the Section Animal Genetics and Genomics)

Simple Summary

This study focused on the mRNA expression of various growth-related and osteogenesis genes in pikeperch (Sander lucioperca) during its developmental stages from hatching to 40 days post-hatching (DPH). The average total length of the larvae increased from 3.6 mm at hatching to 27.1 mm by 40 DPH. Results showed distinct phases of gene expression across the egg, larval, and juvenile stages, indicating a transition toward juvenile development. According to the PLS-DA model, the most relevant VIPs are myf5 and mymk as best markers of earlier stages and igf1ra, ostc, pax7, and ghr as markers of later stages of ontogeny. Overall, these findings highlight the dynamic changes in gene expression that regulate metabolism, growth, and development in pikeperch, providing insights important for pikeperch farming.

Abstract

The pikeperch (Sander lucioperca) is an economically important freshwater fish and a valuable food with high market acceptance. It is undergoing important changes in growth and regulatory metabolism during the ontogeny. Hence, the current study aims to investigate the mRNA expression of the growth hormone (gh)/insulin-like growth factor (igf) axis (ghr, igfI, igfbp, igfr), muscle regulatory factors (pax7, myf5, myod, myogenin, mrf, mymk, mstn), and osteogenesis-related genes (colla1a, fib1a, on, op, ostn) from hatching through day 40th post-hatching (DPH). The average total length (TL) of larvae measured at hatching was 3.6 ± 0.4 mm (67 degree days), and at the end of the experiment (40 DPH, 777 degree days), it was 27.1 ± 1.1 mm. The results showed three phases of gene expression in day 0 (egg), larval, and juvenile stages of pikeperch, which can be a progression or transition from the initial state toward the juvenile state. The expression pattern of myf5, mymk, and fib1a genes showed the highest value at day 0. The growth hormone receptor gene (ghr) and igfbp5 were raised to 1 DPH, whereas increased expression of igfI, igfII, igf1bp4, igf1rb, myod2, and mrf4 was detected at 14 DPH. The myod1, pax7, op, ostc, on, igf1ra, and col1a1a genes were highly expressed at 21 DPH and juvenile stages. According to the PLS-DA model, the most relevant VIPs are myf5 and mymk as best markers of earlier stages and igf1ra, ostc, pax7, and ghr as markers of later stages of ontogeny. Results from this study suggest that basal metabolism, growth of body cells and muscles, and bone proliferation and development can be regulated by the dynamic changes in gene expression patterns in this species. The identified genes will help to understand the basic biological process of pikeperch larvae and development, which is very important in pikeperch farming

Graphical Abstract

1. Introduction

The pikeperch (Sander lucioperca) is a member of the Percidae family. A large, diverse, and economically important group of primarily freshwater fishes, it includes 11 genera and about 275 known species [1]. The rapid growth trait of the pikeperch relative to other Percidae and its potential for diversification make it an attractive species for intensive rearing.
The growth rate of fish during the early life stage can vary depending on the stages. The pikeperch developmental stages consist of embryonic organ formation, hatching, and the transition from endogenous to exogenous feeding in parallel to acquiring of many new physiological functions [2,3,4]. According to the FAO [5], the constant decline in the annual capture of pikeperch is estimated from 48,800 tones (1950s) to 21,200 tones (nowadays). Thus, pikeperch aquaculture in artificial conditions has developed due to the increasing demand for this species for human consumption [6]. Improving the quality and quantity of the myotomal muscle is an essential objective in the aquaculture industry. However, different problems affect the increased production and trade in aquaculture, and in pikeperch, it is hampered by difficulties, especially during early ontogenesis, which includes the organo-, myo-, skeleto-, and neurogenesis, as well as the phase of growth and the development of the immune system [7]. So, basic knowledge of the physiological processes during rearing is important for improving aquaculture production. Hence, studying the expression of the growth, muscle, and bone gene pattern is necessary during the ontogeny stages.
The implication of the endocrine system in regulating teleost’s growth during early development is obvious, and information is available [8,9]. Like other vertebrates, the primary regulator of the somatic growth and development of fish is carried out by the growth hormone/insulin-like growth factor axis [10,11]. Both growth hormone/insulin-like growth factors are crucial during early fish development and differentiation [10,12]. The formation of skeletal muscular tissue is initiated in fish embryos during early development compared with birds and mammals [8,13,14], and this dynamic and plastic tissue contributes to the fish swimming force at early life stages. This is because fish embryos develop in an aqueous environment, requiring functional musculature at an earlier stage to facilitate movement and survival. During embryogenesis, skeletal muscle is formed by cells derived from somites that differentiate into a myotome [8]. The differentiation of somites into different types of the muscle depends on specific and extreme functions of myogenic regulatory factors (mrfs) [15]. Moreover, mrfs control the determination and differentiation of skeletal muscle cells during embryogenesis and postnatal myogenesis [8,16]. In addition to muscles, bones play an essential role in fish locomotion. The osteogenesis process is regulated by skeletal-derived factors that control specific stages of osteoblast development and bone building [17]. Moreover, synchronicity between bone and muscle is required for proper musculoskeletal growth [18].
There is little information concerning regulating growth, muscle, and bone molecular factors during pikeperch ontogeny. However, Franz et al. [14] studied the regulation of myogenic genes during the embryo–larval transition in pikeperch for the first time. Therefore, our main objective was to evaluate the gene expression pattern of the growth hormone/insulin-like growth factor axis, muscle growth regulatory factors, and osteogenesis-related genes involved in the growth of the skeletal muscle in pikeperch under culture conditions. Our data can be useful for exploring basic knowledge about pikeperch growth during early ontogenesis for sustainable aquaculture.

2. Materials and Methods

2.1. Larval and Juvenile Rearing

The larvae used in the present study were obtained by spontaneous spawning of pikeperch broodstock held at controlled conditions under optimal temperature 13.9 ± 0.4 °C with high fertilization, survival, and hatching rates. This study was conducted in the Dr. Yousefpour Marine Fishes Restocking and Genetic Conservation Center (YFHC, Siahkal, Guilan, Iran). Pikeperch wild broodstock was captured from the lake behind the Aras dam in northwest Iran and transported to the YFHC. The age and body weight of caught fish were 4–5 years and 1.1 ± 0.1 kg, respectively. Before the spawning, breeders were transferred to twelve circular concrete tanks (185 cm diameter × 40 cm depth) without feeding for 5–7 days. For hormonal induction, fourteen females and sixteen males were held in each rectangular concrete tank (13 × 3.08 × 1.1 m) with an artificial spawning nest (50 × 50 cm) [19] for each pair. Spawning in female fish was induced by injection of 200 IU kg−1 human chorionic gonadotropin (hCG, manufactured by LG life sciences, South Korea), whereas male fish received no injections. At 80–85 h after injection, females spawned on artificial nests. The spawned adhesive eggs attached to the nests were transferred to a circular concrete tank with 180 cm diameter, 50 cm height, and 1272 L of water volume. The water flow was maintained at 0.3–0.5 L min−1. The larval density in each circular concrete tank was 70 ind L−1. The water physicochemical properties during the experimental period, including temperature, dissolved oxygen, and pH, were 18.7 ± 0.3 °C, 7.2 ± 0.6 mg L−1, and 7.8 ± 0.2, respectively. The water ammonia nitrogen was measured under 0.03 mg L−1. After hatching, artificial nests were removed from the circular concrete tank to supply enough space for the growth and motion of larvae. Larvae showed swim-up behavior after 2–3 days post-hatch (DPH). The air blower supplied enough oxygen needed by larvae in the circular concrete tank. Rotifers, cyclopoid copepods, copepod nauplii, or some small cladocerans were mainly used as the first prey for the 5th DPH larvae [20,21]. The larvae fed were composed of Artemia nauplii and then with Daphnia magna at the beginning of the inflection stage (10th DPH), of which the highest average density was kept at 30 ind mL−1 three times per day (at 8.00, 13.00, and 18.00) (Figure 1). The small zooplanktons were obtained from a stock produced in an earthen pond (using cow manure as an organic fertilizer for microalgae growth on which the zooplankton feed) [22]. The Artemia nauplii was hatched based on the standard procedure [23]. After 16–24 h, about 70% of the cysts at 29 °C were hatched and fed to the larvae. From 15 DPH to the juvenile period, larvae were reared in three earthen ponds under identical conditions including water exchange (5–20% every day), feeding (natural zooplankton such as rotifers, cladocerans, and copepods) [24], water temperature (21.5 ± 2.5 °C), water ammonia nitrogen (controlled under 0.03 mg L−1), and natural photoperiod. The pond size was 4 ha, and the larval density was 400 × 103 larva ha−1 in the earthen pond. During the experiment, random samples of the eggs before hatch and larvae during 1, 3, 5, 8, 10, 14, and 21 DPH and in the juvenile stage were taken at the same time of the day from 9:00 to 11:00 AM (150 to 200 fish in each stage). Larvae were killed with an overdose of clove powder extract. After total length measurement, the whole fish was immediately frozen in liquid nitrogen. Then, all samples were stored at −80 °C until further analyses.

2.2. Ethics Approval

The experimental basic principles of the ARRIVE guidelines approved all the experimental procedures involved in this study. The reporting performed in the manuscript follows the recommendations given in the ARRIVE guidelines for Reporting Animal Research. No distress or suffering was produced by the procedures used to perform this study.

2.3. Gene Selection and Primer Design

Altogether, 23 genes were selected for analysis (Table 1). The focus was placed on growth genes: growth hormone receptor (ghr), insulin-like growth factor 1 (igfI), insulin-like growth factor II (igfII), insulin-like growth factor binding protein 4 (igfbp4), insulin-like growth factor binding protein 5A (igfbp5A), insulin-like growth factor 1a receptor (igf1ra), and insulin-like growth factor 1b receptor (igf1rb); muscle genes: paired Box 7 (pax7), myogenic factor 5 (myf5), myogenic differentiation 1 (myod1), myogenic differentiation 2 (myod2), myogenin (myog), myogenic regulatory factors (mrf4), myomaker (mymk), and myostatin (mstnb); bone genes: collagen type I alpha 1 (col1a1a), fibronectin 1a (fib1a), osteocalcin (ostc), osteopontin (op), and osteonectin (ostn); and reference genes: beta-actin (β-actin), elongation factor1a (ef1a), and ribosomal protein S18. The newly designed specific primers for this study were obtained with the NCBI Primer-Blast Tool using as templates the cDNA sequences of the studied genes obtained from the pikeperch genome deposited in the Ensembl (SLUC_FBN_1) and corroborated with reciprocal BLAST against the NCBI nucleotide database. The primer sequence quality was assessed with NetPrimer online software (http://www.premierbiosoft.com/netprimer/netprlaunch/netprlaunch.html accessed on 8 May 2022).

2.4. RNA Extraction, cDNA Synthesis, and qPCR Analysis

All the analyses were performed at the Department of Cell Biology, Physiology, and Immunology at the University de Barcelona. Due to the different amounts of sample available, the number of samples for each stage was given as follows: 0 day (egg): 10 samples; day 1: 5 samples; day 3: 10 samples; day 5: 10 samples; day 8: 10 samples; day 14: 10 samples; day 21: 6 samples; Juveniles: 10 samples. For RNA extraction, 1 mL of TRI Reagent Solution® (Applied Biosystems, Alcobendas, Spain) was added to the samples (100 mg of whole pooled larvae for each stage or 100 mg of freeze-powdered whole-body homogenate of the juvenile individuals). The samples were homogenized (5–10 pools for each stage) with the Precellys Evolution® (Bertin Instruments, Montigny-le-Brettoneux, France) [14], coupled with a Cryolys system® (Bertin Instruments, Montigny-le-Brettoneux, France), adjusting the protocol depending on the hardness and elasticity of the tissue. The RNA extraction was performed using TRI Reagent Solution® following the manufacturer’s instructions. Each sample final total RNA concentration was obtained using Nanodrop 2000 TM (Thermo Scientific, Alcobendas, Spain). RNA integrity was confirmed in 1% agarose gel (m/v) stained with SYBR-Safe DNA Gel Stain® (Life Technologies, Alcobendas, Spain). Following the manufacturer’s recommendations, reverse transcription was carried out with a First Strand cDNA Synthesis Transcriptor Kit® (Roche, Sant Cugat del Valles, Spain). The expression of each gene was calculated using the Pfaffl method [25], which accounts for the efficiency of each primer pair relative to the geometric mean of the reference genes βactin, Ef1a, and rps18. According to the requirements of the MIQE guidelines [26], the mRNA transcript levels of the genes were analyzed by qPCR using the CFX384 TM RealTime System (Bio-Rad, El Prat de Llobregat, Spain). The expression level of each analyzed gene was calculated relative to the reference genes βactin, Ef1a, and rps18 using the Pfaffl method [25]. The analysis was performed in a final volume of 5 µL, containing 2.5 µL of iTaq SYBR Green Supermix® (Bio-Rad, El Prat de Llobregat, Spain), 0.125 µL of forward (250 nM) and reverse (250 nM) primers, 1 µL of cDNA from each sample, and 1.25 µL of DEPC water. The reaction was performed in triplicate in 384-well plates (Bio-Rad, El Prat de Llobregat, Spain) under the conditions described by Salmerón et al. [27]. The qPCR consisted of the following: (1) an activation phase of 3 min at 95 °C; (2) 40 cycles of 10 s at 95 °C and 30 s at 55–68 °C (dependent on the melting temperature of the primers (Table 1)); and (3) a melting curve from 55 °C to 95 °C that increased by 0.5 °C every 30 s. Before this analysis, the adequate cDNA dilution for each gene was determined by a dilution factor with a pool of samples. With this efficiency curves, the specificity of the amplification, the absence of primers dimers, and the efficiency of the primers were also tested.

2.5. Statistical Analyses

Data were analyzed using IBM SPSS Statistics v.25 (Armonk, NY, USA) and were presented as means ± standard error of the mean (SEM). The normal distribution was analyzed using the Shapiro–Wilk test, and the homogeneity of the variances (homoscedasticity) was assessed with Levene’s test. If normal distribution and/or homoscedasticity was not found, data were logarithmically transformed. Significant differences were tested by one-way analysis of variance (ANOVA) and the post-hoc Tukey HSD. The nonparametric Kruskal–Wallis test and the post-hoc Games–Howell were used if necessary. Statistical differences were considered significant when p < 0.05.
According to published papers [28,29], the peak intensity tables of all genes were uploaded to the websites of MetaboAnalyst 6.0 (https://www.metaboanalyst.ca/MetaboAnalyst/ModuleView.xhtml accessed on 3 April 2024) for data processing and analyses. In the multivariate analysis module of MetaboAnalyst, the normalized data were then subject to partial least squares discriminant analysis (PLS-DA) for pattern discovery.
For the relative expression graphs and the PLS-DA, the gene expression value of each individual biological sample for a given gene was the average of the triplicates (technical replicates of the qPCR).

3. Results

From hatching (67 degree days) to the final period of development (40 DPH, 777 degree days), the total length of the pikeperch continuously grew and increased from 3.6 ± 0.4 mm to 27.0 ± 1.1 mm, respectively (Figure 1).

3.1. Growth Hormone Receptor and Igfs Genes Expression

ghr gene expression showed a significant increase at 1 DPH and then decreased, presenting the lowest values at 21 DPH and in the juveniles (Figure 2a). Regarding igfI, the expression in the egg stage was very low, increasing first after hatching, and then it showed a significant increase at 10 and 14 DPH, returning to the lower levels at the juvenile stage (Figure 2b). On the other hand, igfII interestingly presented a relatively high expression in the egg stage, which slightly decreased from 3 DPH to 8 DPH as well as days 10 and 14, similar to igfI (Figure 2c). The expression of igf1bp4 was low in the egg but peaked at 1 and 14 DPH; afterward, its expression diminished in the juveniles (Figure 2d). For igf1bp5, a fluctuating profile of expression was observed with peaks on days 1, 5, and 14 DPH, followed by a decrease at 21 DPH and in the juveniles (Figure 2e). Concerning the igf1 receptors, igf1ra gene expression showed a low basal expression at the egg stage, progressively increasing with significant values at 21 DPH and in the juveniles (Figure 2f). The expression of the igf1rb (Figure 2g) remained high from 1 to 14 DPH, but very low expression was detected in the egg, 21 DPH, and in the juvenile.

3.2. Muscle Responses during Ontogenesis

Regarding pax7, the initial expression was very low, which increased at 3 DPH, keeping stable levels until 21 DPH and at the juvenile stage, where it presented the highest expression levels (Figure 3a). The myogenic genes myf5 presented an inverse expression pattern compared with pax7, with the highest expression in the egg stage, which constantly decreased until the juvenile stage (Figure 3b). The two paralogues myod1 and myod2 presented differential expression profiles (Figure 3c,d). The myod1 gene presented an intervallic increasing profile, while myod2 showed maximum levels at 14 DPH, which decreased at the juvenile stage (Figure 3c,d). Our findings revealed that myogenin expression slightly decreased during ontogenesis from the egg stage to 10 DPH. Then, it presented a fast expression peak at 21 DPH, significantly decreasing afterward, reaching a low expression in the juveniles (Figure 3e).
Regarding mrf4, it presented an important up-regulation at 1 DPH, which kept medium expression values until 14 DPH, where the highest values were observed, along with a drastic decrease in the juveniles (Figure 3f). Mymk presented an inverse expression pattern compared with pax7, with high expression at the egg stage and 1 DPH. Then, the expression decreases at 3 DPH, followed by a stable level until 21 DPH. Afterward, the expression decreased to a very low level at the juvenile stage (Figure 3g). The expression of mstnb significantly peaked at 1 DPH, then the expression declined at 3 DPH and 8 DPH, rising again at 14 and 21 DPH (Figure 3h), and decreasing also in the juveniles.

3.3. Bone Responses during Ontogenesis

Regarding the osteogenesis-related genes, col1a1a had a highly similar expression pattern to pax7 in muscle. col1a1a presented a low basal expression in the egg stage, which slightly increased from 1 DPH to 14 DPH; after that, an important up-regulation showed at 21 DPH and in the juveniles (Figure 4a). On the other hand, fib1a had a high expression in eggs, which progressively decreased, keeping lower expression from 3 DPH onward but with sporadic expression peaks at 5 and 14 DPH (Figure 4b). Concerning the osteogenic factor, the on highest level was found at the juvenile stage, although high levels were also observed at the egg and 1 DPH, significantly decreasing at 3 and 8 DPH and until 21 DPH (Figure 4c). Differently, the op expression was not significantly changed during the ontogenesis (Figure 4d). Finally, the expression of ostc was significantly low during the first 14 DPH and then increased at 21 DPH and in the juvenile (Figure 4e).

3.4. PLS-DA for Pattern and Biomarker Identification

In order to evaluate how many different larval stages can be properly identified based on the genomic data obtained from the gene expression analysis, a supervised multivariate classification analysis was performed. The selected method was a three-dimensional partial least squares (PLS) regression (a.k.a. projection on latent structures) discriminant analysis. The PLS-DA overview is shown in Figure 5A, highlighting that the results of the analysis were able to explain 43.8% of the total variability between samples. The specific percentages were Component 1 (22.1%), Component 2 (14.9%), and Component 3 (6.8%). The performance and accuracy of the analysis are shown in Figure 5B, which shows that R2 and Q2 (which are parameters that measure the internal and external predictability, respectively) are close to 0.8, indicating a relatively strong robustness of the analysis. The scatter 3D score plot of the PLS-DA is represented in Figure 6. In the plot, 1 and 2 allow a clear separation of four major clusters, from left to right: 0 day (egg); 1, 3, 5, 8, 10, and 14 days; 21 days; and juveniles. Among the second cluster, the 10 and 14 days’ samples are those that can be more clearly separated from the rest of the not separated time points, indicating that this stage can represent an inflection point in the ontogenic process of this species. The samples egg, 21 days, and juveniles are clearly different from others. So, according to obtained results, the pikeperch ontogeny can be distinguished into 5 stages: egg, days 1 to 8 (preflexion), days 10 to 14 (postflexion), day 21, and juveniles. In addition to identifying the larval stages, the results of the PLS-DA provide insights into which genes were most important to achieve this classification by assigning a Variable Importance in the Projection (VIP) score to each gene. This score summarizes the contribution of each variable to the model. Figure 7 shows the main VIP scores corresponding to each component, and the colored boxes on the right of each graph indicate the relative expression of the corresponding gene in each group. Only VIPs ≥ 1 are considered as relevant for accurate prediction and robustness. In all three components, the most relevant VIPs are myf5 and mymk as best markers of earlier stages and igf1ra, ostc, pax7, and ghr as markers of later stages of ontogeny. The other VIPs were lower than one and did not pass the cutoff.

4. Discussion

The study of the expression of those genes related to fish somatic growth can provide new insights into fisheries management, aquaculture, and the development regulation during ontogenesis. The current study evaluated muscle and skeletal genes involved in the early steps of pikeperch ontogenesis to improve the basic knowledge of the musculoskeletal system during rearing and the associated challenges.
The water temperature was found to vary from 12.5 °C at hatching to 27.5 °C during the pikeperch study period. These changes within the different developmental stages of pikeperch during ontogeny provide a more targeted approach for assessing the effects of temperature changes on this species in both wild and laboratory conditions. So, the dynamics of gene expression in this study can be influenced by the changes in water temperature.
Growth hormone is one of the most important indicators for development and growth in vertebrates [18,30,31]. gh and igfs play an effective role in the growth of body cells and basal metabolism in fish [7,18,32]. Concerning ghr, it significantly increased at 1 DPH and tended to decrease at 21 DPH and in the juveniles. ghr, a single transmembrane receptor, is a vital factor regulating the gh/igf axis in fish [33]. In pikeperch, igfI was strongly upregulated after hatching, and from 10 to 14 DPH, the expression of igfI increased again; then, it returns to the lowest levels in the juveniles. This decrease in igfI in juveniles can stop muscle proliferation and development. Teng et al. [34] reported that igfI correlates more with fish growth. The initial feeding rate rapidly increased in pikeperch from 9 to 14 DPH and reached the highest level at 14 DPH [35]. According to our result, the expression levels of the igfII gene in egg and larvae stages were significantly different. Although a significant increase was observed at 14 DPH, the higher gene expression in the egg suggests that the igfII gene played an essential regulatory role in embryo and larvae development. Schäfer et al. [7] indicated that the transcript level of igfII and ghr in pikeperch increased from early after hatching to 4 and 7 DPH, and the highest levels at the juvenile stage may reflect the strong phase of growth in fingerlings. A previous report documented increased igfII transcript levels in maraena white fish (Coregonus maraena) at the onset of oral feeding and during development into the fingerlings [36]. In turbot (Scophthalmus maximus), the mRNA levels of igfI and igfII sharply increased from the stage of unfertilized egg to postlarvae, followed by a decrease with larval development [37]. These data indicate that both igfI and igfII are present in embryos (fertilized eggs), larvae, and the juvenile of pikeperch. However, in some specific points, such as before hatching, igfII seems to have a more notorious role than igfI, which markedly increased after hatching, and the expression profiles of both igfs were very similar. What they specifically do during the early life of fish is not sure, but it refers to a particular distribution of functions between both igfs in the entire life of the pikeperch. This is in agreement with the studies in gilthead sea bream (Sparus aurata), where igfII was more important than igfI in regulating myocyte proliferation [38,39].
During the ontogeny, igf1bp4 showed a profile parallel to both igfs peptides, while igf1bp5 fluctuated during development. These genes can control igf availability and activity in an autocrine and/or paracrine manner [40]. Igfbp4 and igfbp5 genes play an anabolic role in different species [31,41,42] and have also been proposed as a myogenic molecule promotor [9].
We showed that the gene expression of igfrs was different during ontogeny. Thus, igf1ra was highly expressed at 21 DPH and in the juveniles, while igf1rb was expressed from 1 DPH to 14 DPH. It suggests the different functions of both igf1r in pikeperch development, with igf1ra being more responsible for the earlier steps in the ontogeny in this species. Such differential roles of function of both igf1rs have been observed in other fish species, such as rainbow trout Oncorhynchus mykiss [43] and Chilean flounder Paralichthys adspersus [44]. In the current study, pax7 expression, as a key marker of secondary myogenesis, started to increase importantly from 21 DPH to the juvenile stage, which has been shown in other fish species such as Japanese pufferfish (Takifugu rubripes) [45]. Of note, pax7 is involved in developing the thymus, CNS, Shwann cells, cranial bone and cartilage, melanotrope cells, spermatogonia cells, and muscle [46]. The role of pax7 in the late stages (21 DPH larvae to juvenile fish) is possible to correlate the gene expression levels with ontogenetic processes such as muscle differentiation, stratified and mosaic hyperplasia, or satellite cell proliferation [47,48,49].
The information on mrfs during larval development in pikeperch is scarce, and the results obtained can be helpful to understanding muscle growth regulation during ontogenesis and aquaculture development. Based on the current results, a set of mrfs were expressed during larval development. The two myod genes were differently expressed during development. The expression of myod1 and myod2 demonstrated that they exhibited overlapping but distinct patterns of expression in embryos and in juveniles. According to Franz et al. [14], the expression of myod1 coincides with somitogenesis and the phases of muscle growth before and after hatching. The different expression patterns of myod1 and myod2 genes have been reported in sea bream, rainbow trout, and flounder (Paralichthys olivaceus) fast and slow muscles during embryos and adults [50].
The present study demonstrates that the expression of myf5 and mymk was maximum before hatching and gradually decreased during the first stages of development, almost disappearing in the juveniles. It has been reported that mymk is involved in initial myoblast fusion during early development [51]. Both myf5 and mymk are necessary for the initiation of myogenesis in vertebrates. In Labeo rohita, the expression of myf5 was higher in the embryonic stages [52]. Concerning myogenin, this gene maintained relatively high expression levels in all the stages, with a peak at 21 DPH. Myogenin expression usually happens after myf5 expression and remains active to maintain differentiation and growth of skeletal muscle fibers in the terminal differentiation stage [13]. Our results clearly showed that mymk and myf5 were expressed at a high level in the early embryonic stages, whereas mrf4 and myogenin were expressed after mymk and myf5 expression with the peak at 14 or 21 DPH, which coincides with the differentiation and growth of skeletal muscle fibers of pikeperch.
Regarding the level of mstnb expression in pikeperch, results showed an initial rise at 1 DPH, when somitogenesis and muscle cell proliferation and differentiation are completed [53,54,55]. Thereafter, mstnb mRNA concentration declined to gradually reach a new peak at 14 and 21 DPH. According to Vianello et al. [55], mstn has a key regulatory role during the early muscle development in fish and mammals. Rodgers et al. [56] suggested that in developing tilapia (Oreochromis mossambicus), mstn was expressed early after hatching, as we observed in our results. In agreement with our study, the reports on zebrafish (Danio rerio) by Vianello et al. [55] and on pikeperch by Franz et al. [14] revealed high mstn expression in the juveniles.
The present study analyzed the expression profile of several gene markers for skeletogenesis during larval development in pikeperch. The high expression level of the col1a1a gene was found in 21 DPH and the juvenile stage. Durán et al. [57] and Gistelinck et al. [58] reported the expression of col1a1a within the formation of actinotrichia in the first fin skeleton during the development. However, in the present study, the lowest expression of the col1a1a genes was observed in pikeperch at early developmental stages. It can suggest the role of maternal collagen type I transcripts in the earliest stages of development [58]. Regarding the fib1a gene, the highest expression levels were observed in eggs. fib1a is produced by osteoblasts and accumulates in the ECM, which appeared necessary in the first stages of bone formation [59]. Its expression is higher during the early stages of osteoblast differentiation and declines during cell maturation [60]. According to Stein et al. [60] and Owen et al. [61], fib1a expression was highest on day 5. It progressively decreased after that, confirming a potential role in the first stages of osteogenesis and cell adhesion.
Concerning on and ostc, transcript levels were increased at 21 DPH and in the juveniles, confirming their essential role in establishing ECM production [62,63,64]. In agreement with these data, several studies demonstrated that the expression of on and ostc usually increases during maturation-specific skeletal cell types [62,64,65].
The pattern of gene expression during fish ontogeny often comprises more genes, making it challenging to interpret. PLS-DA helps reduce this dimensionality while retaining the important variation related to the developmental stages, facilitating the identification of key genes involved in ontogeny, which enables researchers to identify unique gene expression patterns associated with each stage of development.
This method provides visual output (e.g., score plots) that allows researchers to visualize the relationships and differences between various groups (e.g., showing the discrimination between the clustered samples corresponding to the different ontogenic stages) in a clear and interpretable way.
In summary, PLS-DA is a valuable analytical tool in the study of gene expression during the ontogeny of fish larvae, enabling researchers to derive important insights into developmental biology and related applications. The obtained results suggest that during the larval development stage of pikeperch, there is a complex and interesting pattern of gene expression that plays a crucial role in coordinating the proper development of the musculoskeletal system.

5. Conclusions

Overall, in this study, we investigated the mRNA expression of key genes involved in growth hormone regulation, muscle development, and osteogenesis in pikeperch from hatching through the juvenile stage. This research highlights distinct phases of gene expression during different developmental stages, with specific genes showing peak expression at various time points. The findings suggest a complex regulatory network influencing metabolism, cellular growth, and tissue development in pikeperch, establishing a basis for increasing knowledge and insight into how larvae and juvenile of an economically valuable species grow and develop. This knowledge holds great potential for informing and improving pikeperch aquaculture practices.

Author Contributions

F.L.B.: larval rearing, sampling, biometry, laboratory work, data analysis, and writing—original draft. B.F.: funding acquisition, supervision, conceptualized the study, and draft—editing. M.P.-A.: helping in laboratory work, data analysis, and draft—editing. F.M.: helping in laboratory work. I.E.: preparing all equipment for larval and juvenile rearing. J.G.: funding acquisition, supervision, conceptualized the study, and draft—editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Iran National Science Foundation (INSF), Grant/Award Number: 98010579, also University de Barcelona financial help for all analysis.

Institutional Review Board Statement

All the experimental animal procedures involved in this study were approved by the animal care and welfare of the experimental basic principles by the ARRIVE guidelines. The reporting carried out in the manuscript follows the recommendations in the ARRIVE guidelines for Reporting Animal Research. No distress or suffering was produced by the procedures used to perform this study. The study was evaluated and approved by the University of Guilan, Vice Presidency for Research and Technology (the Ethics Certification approval number 101708/P 15).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.

Acknowledgments

We would like to thank the staff of Yousefpour Marine Fishes Restocking and Genetic Conservation Center for their help during the sampling. The authors are also thankful to their colleagues at the University de Barcelona for providing lab facilities and analyses.

Conflicts of Interest

The authors declare that they have no conflict of interest.

References

  1. Nguinkal, J.A.; Brunner, R.M.; Verleih, M. The first highly contiguous genome assembly of pikeperch (Sander lucioperca), an emerging aquaculture species in Europe. Genes 2019, 10, 708. [Google Scholar] [CrossRef] [PubMed]
  2. Kimmel, C.B.; Ballard, W.W.; Kimmel, S.R.; Ullmann, B.; Schilling, T.F. Stages of embryonic development of the zebrafish. Dev. Dyn. 1995, 203, 253–310. [Google Scholar] [CrossRef] [PubMed]
  3. Demska-Zakęś, K.; Kowalska, A.; Zakęś, Z. The development of the swim bladder of pikeperch Sander lucioperca (L.) reared in intensive culture. Fish. Aquac. Life 2003, 11, 45–55. [Google Scholar]
  4. Ostaszewska, T. Developmental changes of digestive system structures in pikeperch (Sander lucioperca L.). Electron. J. Ichthyol. 2005, 2, 65–78. [Google Scholar]
  5. FAO. FAO Yearbook. Fishery and Aquaculture Statistics 2018; FAO: Rome, Italy, 2020. [Google Scholar] [CrossRef]
  6. Javid Rahmdel, K.; Falahatkar, B. Adaptation of pikeperch (Sander lucioperca) to formulated diets: A review. Fish. Aquat. Life 2021, 29, 1–12. [Google Scholar] [CrossRef]
  7. Schäfer, N.; Kaya, Y.; Rebl, H.; Stüeken, M.; Rebl, A.; Nguinkal, J.A.; Franz, J.P.; Brunner, R.M.; Goldammer, T.; Grunow, B.; et al. Insights into early ontogenesis: Characterization of stress and development key genes of pikeperch (Sander lucioperca) in vivo and in vitro. Fish Physiol. Biochem. 2021, 47, 515–532. [Google Scholar] [CrossRef]
  8. Johnston, J.A.; Bower, N.I.; Macqueen, D.J. Growth and the regulation of myotomal muscle mass in teleost fish. J. Exp. Biol. 2011, 214, 1617–1628. [Google Scholar] [CrossRef]
  9. Fuentes, E.N.; Valdés, J.A.; Molina, A.; Björnsson, B.T. Regulation of skeletal muscle growth in fish by the growth hormone-insulin-like growth factor system. Gen. Comp. Endocrinol. 2013, 192, 136–148. [Google Scholar] [CrossRef]
  10. Woll, S.C.; Podrabsky, J.E. Insulin-like growth factor signaling regulates developmental trajectory associated with diapause in embryos of the annual killifish Austrofundulus limnaeus. J. Exp. Biol. 2011, 220, 2777–2786. [Google Scholar] [CrossRef]
  11. Al-Samerria, S.; Radovick, S. The Role of insulin-like growth factor-1 (igf-1) in the control of neuroendocrine regulation of growth. Cells 2021, 10, 2664. [Google Scholar] [CrossRef]
  12. Franz, A.C.; Faass, O.; Köllner, B.; Shved, N.; Link, K.; Casanova, A.; Wenger, M.; Cotta, H.D.; Baroiller, J.F.; Ullrich, O.; et al. Endocrine and local igf-I in the bony fish immune system. Biology 2016, 5, 9. [Google Scholar] [CrossRef] [PubMed]
  13. Zhang, Y.; Tan, X.; Xu, P.; Sun, W.; Xu, Y.; Pei-jun, Z. Quantitative comparison of the expression of myogenic regulatory factors in flounder (Paralichthys olivaceus) embryos and adult tissues. Chin. J. Oceanol. Limnol. 2010, 28, 248–253. [Google Scholar] [CrossRef]
  14. Franz, G.P.; Tönißen, K.; Rebl, A.; Lutze, P.; Grunow, B. The expression of myogenic gene markers during the embryo-larval-transition in pikeperch (Sander lucioperca). Aquac. Res. 2022, 53, 4767–4781. [Google Scholar] [CrossRef]
  15. Hinits, Y.; Osborn, D.P.; Hughes, S.M. Differential requirements for myogenic regulatory factors distinguish medial and lateral somitic, cranial and fin muscle fibre populations. Development 2009, 136, 403–414. [Google Scholar] [CrossRef] [PubMed]
  16. Vélez, E.J.; Azizi, S.; Verheyden, D.; Salmeron, C.; Lutfi, E.; Sanchez-Moya, A.; Navarro, I.; Gutierrez, J.; Capilla, E. Proteolytic systems’ expression during myogenesis and transcriptional regulation by amino acids in gilthead sea bream cultured muscle cells. PLoS ONE 2017, 12, e0187339. [Google Scholar] [CrossRef]
  17. Du, Y.; Zhang, L.; Wang, Z.; Zhao, X.; Zou, J. Endocrine regulation of extra-skeletal organs by bone-derived secreted protein and the effect of mechanical stimulation. Front. Cell. Dev. Biol. 2021, 9, 778015. [Google Scholar] [CrossRef]
  18. Lavajoo, F.; Perelló-Amorós, M.; Vélez, E.J.; Moya, A.S.; Balbuena Pecino, S.; Riera-Heredia, N.; Borras, F.; Blasco, J.; Navarro, I.; Capilla, E.; et al. Regulatory mechanisms involved in muscle and bone remodeling during refeeding in gilthead sea bream. Sci. Rep. 2020, 10, 184. [Google Scholar] [CrossRef]
  19. Schlumberger, O.; Proteau, J.P. Reproduction of pikeperch (Stizostedion lucioperca) in captivity. J. Appl. Ichthyol. 1996, 12, 149–152. [Google Scholar] [CrossRef]
  20. Kestemont, P.; Mélard, C. Aquaculture. In Percid Fishes: Systematics, Ecology and Exploitation; Craig, J.F., Ed.; Blackwell Science: Oxford, UK, 2000; pp. 191–224. [Google Scholar]
  21. Briland, R.D.; Doyle, C.M.; Culver, D.A. Large-scale production of yellow perch, walleye, and hybrid walleye in ponds. In Biology and Culture of Percid Fishes; Kestemont, P., Dabrowski, K., Summerfelt, R.C., Eds.; Springer: Dordrecht, The Netherlands, 2015; pp. 469–498. [Google Scholar]
  22. Paray, B.L.; Al-Sadoon, M.K. Utilization of organic manure for culture of cladocerans, Daphnia carinata, Ceriodaphnia carnuta and copepod, Thermocyclops decipiens under laboratory conditions. Indian J. Mar. Sci. 2016, 45, 399–404. [Google Scholar]
  23. Sorgeloos, P.; Bossuyt, E.; Lavina, E.; Baeza-Mesa, M.; Persoone, G. Decapsulation of Artemia cysts: A simple technique for the improvement of the use of brine shrimp in aquaculture. Aquaculture 1977, 12, 311–315. [Google Scholar] [CrossRef]
  24. Falahatkar, B.; Efatpanah, I.; Kestemont, P. Pikeperch Sander lucioperca production in the south part of the Caspian Sea: Technical notes. Aquac. Int. 2018, 26, 391–401. [Google Scholar] [CrossRef]
  25. Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
  26. Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J. The MIQE guidelines: Minimum information for publication of quantitative real time PCR experiments. Clin. Chem. 2009, 55, 611–622. [Google Scholar] [CrossRef] [PubMed]
  27. Salmerón, C.; Navarro, I.; Johnston, I.A.; Gutierrez, J.; Capilla, E. Characterisation and expression analysis of cathepsins and ubiquitin-proteasome genes in gilthead sea bream (Sparus aurata) skeletal muscle. BMC Res. Notes 2015, 8, 149. [Google Scholar] [CrossRef] [PubMed]
  28. Pang, Z.; Chong, J.; Li, S.; Xia, J. Metabo Analyst R 3.0: Toward an optimized workflow for global metabolomics. Metabolites 2020, 10, 186. [Google Scholar] [CrossRef]
  29. Zhao, H.; Liu, M.; Lv, Y.; Fang, M. Dose-response metabolomics and pathway sensitivity to map molecular cartography of bisphenol exposure. Environ. Int. 2022, 158, 106893. [Google Scholar] [CrossRef]
  30. Riley, L.G.; Richman, N.H.; Tetsuya, H.; Grau, E.G. Activation of the growth hormone/insulin-like growth factor axis by treatment with 17 alpha-methyltestosterone and seawater rearing in the tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 2002, 127, 285–292. [Google Scholar] [CrossRef]
  31. Vélez, E.J.; Lutfi, E.; Azizi, S.; Perello, M.; Salmeron, C.; Riera-Codina, M.; Ibarz, A.; Fernandez-Borras, J.; Blasco, J.; Capilla, E.; et al. Understanding fish muscle growth regulation to optimize aquaculture production. Aquaculture 2017, 467, 28–40. [Google Scholar] [CrossRef]
  32. Pierce, A.L.; Fukada, H.; Dickhoff, W.W. Metabolic hormones modulate the effect of growth hormone (gh) on insulin-like growth factor-I (igf-I) mRNA level in primary culture of salmon hepatocytes. J. Endocrinol. 2005, 184, 341–349. [Google Scholar] [CrossRef]
  33. Prinzio, C.D.; Botta, P.; Barriga, E.; Rios, E.; Reyes, A.; Arranz, S. Growth hormone receptors in zebrafish (Danio rerio): Adult and embryonic expression patterns. Gene Expr. Patterns. 2010, 10, 214–225. [Google Scholar] [CrossRef]
  34. Teng, T.; Zhao, X.; Li, C. Cloning and expression of igf-I, igf-II, and ghr genes and the role of their single-nucleotide polymorphisms in the growth of pikeperch (Sander lucioperca). Aquac. Int. 2020, 28, 1547–1561. [Google Scholar] [CrossRef]
  35. Xu, Z.; Li, C.; Ling, Q.; Gaughan, S.; Wang, G.; Han, X. Early development and the point of no return in pikeperch (Sander lucioperca L.) larvae. Chin. J. Oceanol. Limn. 2017, 35, 1493–1500. [Google Scholar] [CrossRef]
  36. Nipkow, M.; Wirthgen, E.; Luft, P.; Rebl, A.; Hoeflich, A.; Goldammer, T. Characterization of igf1 and igf2 genes during maraena whitefish (Coregonus maraena) ontogeny and the effect of temperature on embryogenesis and igf expression. Growth Horm. IGF Res. 2018, 40, 32–43. [Google Scholar] [CrossRef] [PubMed]
  37. Wen, H.; Qi, Q.; Hu, J.; Si, Y.; He, F.; Li, J. Expression analysis of the insulin-like growth factors I and II during embryonic and early larval development of turbot (Scophthalmus maximus). J. Ocean. Univ. China. 2015, 14, 309–316. [Google Scholar] [CrossRef]
  38. Rius-Francino, M.; Acerete, L.; Jiménez-Amilburu, V.; Capilla, E.; Navarro, I.; Gutierrez, J. Differential effects on proliferation of gh and igfs in sea bream (Sparus aurata) cultured myocytes. Gen. Comp. Endocrinol. 2011, 172, 44–49. [Google Scholar] [CrossRef]
  39. Sánchez-Moya, A.; Balbuena-Pecino, S.; Vélez, E.J.; Perelló-Amorós, M.; García-Meilán, I.; Fontanillas, R.; Calduch-Giner, J.A.; Perez-Sanchez, J.; Fernandez-Borras, J.; Blasco, J.; et al. Cysteamine improves growth and the GH/IGF axis in gilthead sea bream (Sparus aurata): In vivo and in vitro approaches. Front. Endocrinol. 2023, 14, 1211470. [Google Scholar] [CrossRef]
  40. Bahrami Kamangar, B.; Jean-Charles, G.; Bobe, J. Insulin-like growth factor-binding protein (igfbp)-1, -2, -3, -4, -5, and -6 and igfbp-related protein 1 during rainbow trout post vitellogenesis and oocyte maturation: Molecular characterization, expression profiles, and hormonal regulation. Endocrinology 2006, 147, 2399–2410. [Google Scholar] [CrossRef]
  41. Azizi, S.; Nematollahi, M.A.; Mojazi Amiri, B.; Velez, E.J.; Lutfi, E.; Navarro, I.; Capilla, E.; Gutierrez, J. Lysine and leucine deficiencies affect myocytes development and igf signaling in gilthead sea bream (Sparus aurata). PLoS ONE 2016, 11, e0147618. [Google Scholar] [CrossRef]
  42. Garcia de la Serrana, D.; Macqueen, D.J. Insulin-like growth factor-binding proteins of teleost fishes. Front. Endocrinol. 2018, 9, 80. [Google Scholar] [CrossRef]
  43. Montserrat, N.; Gabillard, J.C.; Capilla, E.; Navarro, M.I.; Gutierrez, J. Role of insulin, insulin-like growth factors, and muscle regulatory factors in the compensatory growth of the trout (Oncorhynchus mykiss). Gen. Comp. Endocrinol. 2007, 150, 462–472. [Google Scholar] [CrossRef]
  44. Escobar, S.; Fuentes, E.N.; Poblete, E.; Valdes, J.A.; Safian, D.; Reyes, A.E.; Alvarez, M.; Molina, A. Molecular cloning of igf-1 and igf-1 receptor and their expression pattern in the Chilean flounder (Paralichthys adspersus). Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2011, 159, 140–147. [Google Scholar] [CrossRef] [PubMed]
  45. Akolkar, D.B.; Asaduzzaman, M.D.; Kinoshita, S.; Asakawa, S.; Watabe, S. Characterization of pax3 and pax7 genes and their expression patterns during different development and growth stages of Japanese pufferfish Takifugu rubripes. Gene 2016, 575, 21–28. [Google Scholar] [CrossRef] [PubMed]
  46. White, R.B.; Ziman, M.R. Genome-wide discovery of pax7 target genes during development. Physiol. Genom. 2008, 33, 41–49. [Google Scholar] [CrossRef] [PubMed]
  47. Rescan, P.Y. Regulation and functions of myogenic regulatory factors in lower vertebrates. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2001, 130, 1–12. [Google Scholar] [CrossRef] [PubMed]
  48. Berberoglu, M.A.; Gallagher, T.L.; Morrow, Z.T.; Talbot, J.C.; Hromowyk, K.J.; Tenete, I.M.; Langenau, D.M.; Amacher, S.L. Satellite-like cells contribute to pax7-dependent skeletal muscle repair in adult zebrafish. Dev. Biol. 2017, 424, 162–180. [Google Scholar] [CrossRef]
  49. Wang, M.; Song, W.; Jin, C.; Huang, K.; Yu, Q.; Qi, J.; Zhang, Q.; He, Y. Pax3 and pax7 exhibit distinct and overlapping functions in marking muscle satellite cells and muscle repair in a marine teleost, Sebastes schlegelii. Int. J. Mol. Sci. 2021, 22, 3769. [Google Scholar] [CrossRef]
  50. Zhang, Y.; Tan, X.; Zhang, P.J.; Xu, Y. Characterization of muscle-regulatory gene, myod, from flounder (Paralichthys olivaceus) and analysis of its expression patterns during embryogenesis. Mar. Biotechnol. 2006, 8, 139–148. [Google Scholar] [CrossRef]
  51. Si, Y.; Wen, H.; Du, S. Genetic mutations in jamb, jamc, and myomaker revealed different roles on myoblast fusion and muscle growth. Mar. Biotechnol. 2019, 21, 111–123. [Google Scholar] [CrossRef]
  52. Sengupta, A.; Mukherjee, S.; Bhattacharya, S.; Kumar Saha, S.; Chattopadhay, A. Expression pattern of myogenic regulatory transcription factor mrnas in the embryo and adult Labeo rohita (Hamilton, 1822). Int. J. Zool. 2014, 2014, 259685. [Google Scholar] [CrossRef]
  53. Weinberg, E.S.; Allende, M.L.; Kelly, C.S.; Abdelhamid, A.; Murakami, T. Developmental regulation of zebrafish myod in wild-type, no tail and spadetail embryos. Development 1996, 122, 271–280. [Google Scholar] [CrossRef]
  54. Bladgen, C.S.; Currie, P.D.; Ingham, P.W.; Hughes, S.M. Notochord induction of zebrafish slow muscle mediated by sonic hedgehog. Gen. Dev. 2000, 11, 2163–2175. [Google Scholar]
  55. Vianello, S.; Brazzoduro, L.; Dalla Valle, L.; Belvedere, P.; Colombo, L. Myostatin expression during development and chronic stress in zebrafish (Danio rerio). J. Endocrinol. 2003, 176, 47–59. [Google Scholar] [CrossRef] [PubMed]
  56. Rodgers, B.D.; Weber, G.M.; Sullivan, C.V.; Levine, M.A. Isolation and characterization of myostatin complementary deoxyribonucleic acid clones from two commercially important fish: Oreochromis mossambicus and Morone chrysops. Endocrinology 2001, 142, 1412–1418. [Google Scholar] [CrossRef] [PubMed]
  57. Durán, I.; Marí-Beffa, M.; Santamaría, J.A.; Becerra, J.; Santos-Ruiz, L. Actinotrichia collagens and their role in fin formation. Dev. Biol. 2011, 354, 160–172. [Google Scholar] [CrossRef]
  58. Gistelinck, C.; Gioia, R.; Gagliardi, A.; Tonelli, F.; Marchese, L.; Landi, C.; Bini, L.; Huysseune, A.; Witten, P.E.; Staes, A.; et al. Zebrafish collagen type I: Molecular and biochemical characterization of the major structural protein in bone and skin. Sci. Rep. 2016, 6, 21540. [Google Scholar] [CrossRef]
  59. Lin, X.; Patil, S.; Gao, Y.G.; Qian, A. The bone extracellular matrix in bone formation and regeneration. Front. Pharmacol. 2020, 11, 757. [Google Scholar] [CrossRef]
  60. Stein, G.S.; Lian, J.B.; Owen, T.A. Relationship of cell growth to the regulation of tissue-specific gene expression during osteoblast differentiation. FASEB J. 1990, 4, 3111–3123. [Google Scholar] [CrossRef]
  61. Owen, T.A.; Aronow, M.; Shalhoub, V.; Barone, L.M.; Wilming, L.; Tassinari, M.S.; Kennedy, M.B.; Pockwinse, S.; Lian, J.B.; Stein, G.S. Progressive development of the rat osteoblast phenotype in vitro: Reciprocal relationships in expression of genes associated with osteoblast proliferation and differentiation during formation of the bone extracellular matrix. J. Cell. Physiol. 1990, 143, 420–430. [Google Scholar] [CrossRef]
  62. Stein, G.S.; Lian, J.B. Molecular mechanisms mediating proliferation/differentiation interrelationships during progressive development of the osteoblast phenotype. Endocr. Rev. 1993, 14, 424–442. [Google Scholar] [CrossRef]
  63. Aubin, J.E.; Triffitt, J. Mesenchymal stem cells and the osteoblast lineage. In Principles of Bone Biology; Bilezikian, J.P., Raisz, L.G., Rodan, G.A., Eds.; Academic Press: Cambridge, MA, USA, 2002; pp. 59–81. [Google Scholar]
  64. Riera-Heredia, N.; Martins, R.; Mateus, A.P.; Costa, R.A.; Gisbert, E.; Navarro, I.; Gutierrez, J.; Power, D.M.; Capilla, E. Temperature responsiveness of gilthead sea bream bone: An in vitro and in vivo approach. Sci. Rep. 2018, 8, 11211. [Google Scholar] [CrossRef]
  65. Ytteborg, E.; Torgersen, J.; Baeverfjord, G.; Takle, H. The atlantic salmon (Salmo salar) vertebra and cellular pathways to vertebral deformities. In Health and Environment in Aquaculture; Carvalho, E.D., David, G.S., Silva, R.J., Eds.; Intech Open: London, UK, 2012; pp. 329–358. [Google Scholar] [CrossRef]
Figure 1. Feeding scheme for rearing of pikeperch (Sander lucioperca) and water temperature fluctuations during the first 40 days post-hatch.
Figure 1. Feeding scheme for rearing of pikeperch (Sander lucioperca) and water temperature fluctuations during the first 40 days post-hatch.
Animals 14 03089 g001
Figure 2. Relative gene expression of skeletal muscle ghr (a), igfI (b), igfII (c), igf1bp4 (d), igf1bp5 (e), igf1ra (f), and igf1rb (g) in pikeperch during the ontogenesis. Data are shown as means ± SEM (n = 10). Letters indicate significant differences (p < 0.05) by one-way ANOVA and Tukey HSD test. Sample 0 pointed to the sample egg before the hatch.
Figure 2. Relative gene expression of skeletal muscle ghr (a), igfI (b), igfII (c), igf1bp4 (d), igf1bp5 (e), igf1ra (f), and igf1rb (g) in pikeperch during the ontogenesis. Data are shown as means ± SEM (n = 10). Letters indicate significant differences (p < 0.05) by one-way ANOVA and Tukey HSD test. Sample 0 pointed to the sample egg before the hatch.
Animals 14 03089 g002aAnimals 14 03089 g002b
Figure 3. Relative gene expression of skeletal muscle pax7 (a), myf5 (b), myod1 (c), myod2 (d), myogenin (e), mrf4 (f), mymk (g), and mstnb (h) in pikeperch during the ontogenesis. Data are shown as means ± SEM (n = 10). Letters indicate significant differences (p < 0.05) by one-way ANOVA and Tukey HSD test. Sample 0 indicated to the sample egg before hatch.
Figure 3. Relative gene expression of skeletal muscle pax7 (a), myf5 (b), myod1 (c), myod2 (d), myogenin (e), mrf4 (f), mymk (g), and mstnb (h) in pikeperch during the ontogenesis. Data are shown as means ± SEM (n = 10). Letters indicate significant differences (p < 0.05) by one-way ANOVA and Tukey HSD test. Sample 0 indicated to the sample egg before hatch.
Animals 14 03089 g003aAnimals 14 03089 g003b
Figure 4. Relative gene expression of bone col1a1a (a), fib1a (b), on (c), op (d), and ostn (e) in pikeperch during the ontogenesis. Data are shown as means ± SEM (n = 10). Letters indicate significant differences (p < 0.05) by one-way ANOVA and Tukey HSD test. Sample 0 pointed to the sample egg before the hatch.
Figure 4. Relative gene expression of bone col1a1a (a), fib1a (b), on (c), op (d), and ostn (e) in pikeperch during the ontogenesis. Data are shown as means ± SEM (n = 10). Letters indicate significant differences (p < 0.05) by one-way ANOVA and Tukey HSD test. Sample 0 pointed to the sample egg before the hatch.
Animals 14 03089 g004aAnimals 14 03089 g004b
Figure 5. Overview of the PLS-DA model with the % of variability explained by each component (A) and the quality assessment of the model with the R2 and Q2 values (B). The asterisk indicates which number of components combined gives a higher Q2 value.
Figure 5. Overview of the PLS-DA model with the % of variability explained by each component (A) and the quality assessment of the model with the R2 and Q2 values (B). The asterisk indicates which number of components combined gives a higher Q2 value.
Animals 14 03089 g005
Figure 6. Scatter 3D score plot of the PLS-DA shows the discrimination between the clustered samples corresponding to the different ontogenic stages of Sander lucioperca. The position of each dot along the axis indicates the strength and direction of the relationship between the variable and the principal component.
Figure 6. Scatter 3D score plot of the PLS-DA shows the discrimination between the clustered samples corresponding to the different ontogenic stages of Sander lucioperca. The position of each dot along the axis indicates the strength and direction of the relationship between the variable and the principal component.
Animals 14 03089 g006
Figure 7. Overview of the main variable importance in projection (VIP) corresponding to the three main components (Comp), and the colored boxes on the right of each graph indicate the relative expression of the corresponding gene in each group. Only VIPs ≥ 1 are considered relevant for accurate prediction and robustness of the model. The colored boxes on the right of each graph indicate the relative expression of the corresponding gene in each group. 0 day (egg).
Figure 7. Overview of the main variable importance in projection (VIP) corresponding to the three main components (Comp), and the colored boxes on the right of each graph indicate the relative expression of the corresponding gene in each group. Only VIPs ≥ 1 are considered relevant for accurate prediction and robustness of the model. The colored boxes on the right of each graph indicate the relative expression of the corresponding gene in each group. 0 day (egg).
Animals 14 03089 g007
Table 1. Overview of selected genes and primers for pikeperch qPCR analysis.
Table 1. Overview of selected genes and primers for pikeperch qPCR analysis.
Gene SymbolSense Primer (5′-3′)Annealing Temperature (°C)Amplification Efficiency (%)Accession Number
Reference genes
βactinF: CGACATCCGTAAGGACCTGT5592.9XM_031320710.2
R: GCTGGAAGGTGGACAGAGAG
Ef1aF: TGATGACACCAACAGCCACT5590.1XM_031295658.2
R: AAGATTGACCGTCGTTCTGG
rps18F: TGACGGAAGGGCACCACCAG
R: AATCGCTCCACCAACTAAGAACGG
6091.7XR_004103451.1
Target genes
Growth genes
GhrF: GGAGAGCACCTTAGCCACAGAG
R: GTGGTGTAGCCGCTTCCTTCT
5899.6XM_031305905.2
IgfIF: CTGTGCACCTGCCAAGACTA
R: TGTGCCCTTGTCCACTTTGT
6092.8XM_031313442.2
IgfIIF: AAGACACGGACACCACTCAC
R: TGCCGAGGCTATTTCCACAG
5894.3XM_031282902.2
Igf1bp4F: CCATTTAATCCAGCCCCCGA
R: GCTATGGCACATGAAACGGC
5895.9XM_031284490.2
Igf1bp5F: CCATTTAATCCAGCCCCCGA
R: GCTATGGCACATGAAACGGC
55104.6XR_004896646.1
Igf1raF: ACATTCATTCACCCCTCCCCT
R: ATACTCGGACCACAGATCTCTCC
5497.1XM_031293486.2
Igf1rbF: ATAACTGCCCCTTACCCTGTC
R: TGACGGTGAGGTTGGGAAAG
5695.7
Muscle genes
Pax7F: GTCCCTTCAGGTGAGGCTTCC
R: GACTCCACGTCTGACACTTCA
5595.9XM_031301093.2
Myf5F: CCAGTGTGGCACCATCTGAA
R: GTTGCCTAAACTGTCGTTCCTC
5696.2XM_031313525.2
Myod1F: CAAACGGCGGTCTGAAGAGT
R: GTGTGAGTGGACGGTTAGGC
5896.4XM_031279879.1
Myod2F: GGGATGACGGCTTCTACTCG
R: TTCGGGTTGAACACGGAGAG
5797.1XM_031323772.2
MyogeninF: CCCAGCCCAGAGTGTCGTC5896.7XM_031323467.2
R: GTGCACATATGGGTCCGCTG
Mrf4F: AAAGTCAGCCCCGACGGATA
R: CTCCACCTTGGGTAGCCTCT
5798.7XM_031313716.2
MymkF: ATGTTCTTCACTGCGATCTACC5596.1XM_031305655.2
R: AGAGAGCTGTGCCGTAAACAC
MstnbF: TCTGTCCTCCCGCCTTATGA
R: TTTCCCTTTGTGCTGGTCGT
58101.2XM_031304808.2
Bone genes
Col1A1AF: GGAGGGACTTAAAGGAAACCGT
R: CTCACGTCCTGGCTCACCG
5883.6XM_031292502.2
Fib1aF: CACAAACCACTGCCCCTGAT5485.8XM_031281780.2
R: AGTCACAGATGTTGCCGTGT
OnF: CGACACCTCTTGCCAGTTCT5697.2XM_031317122.2
R: CTCATACGCAGGGGGAACTC
OpF: CAGTGTACAAGGTAAAGGCTCT5291.2XM_031277598.2
R: CTGAGTTCCTGGTCCTGAGA
OstcF: GGCTGTCGTCTGTCTGACTTC
R: CTCTCCACAAACAAACCCTCCTG
5693.3XM_035996639.1
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lavajoo Bolgouri, F.; Falahatkar, B.; Perelló-Amorós, M.; Moshayedi, F.; Efatpanah, I.; Gutiérrez, J. The Pattern of Gene Expression (Igf Family, Muscle Growth Regulatory Factors, and Osteogenesis-Related Genes) Involved in the Growth of Skeletal Muscle in Pikeperch (Sander lucioperca) During Ontogenesis. Animals 2024, 14, 3089. https://doi.org/10.3390/ani14213089

AMA Style

Lavajoo Bolgouri F, Falahatkar B, Perelló-Amorós M, Moshayedi F, Efatpanah I, Gutiérrez J. The Pattern of Gene Expression (Igf Family, Muscle Growth Regulatory Factors, and Osteogenesis-Related Genes) Involved in the Growth of Skeletal Muscle in Pikeperch (Sander lucioperca) During Ontogenesis. Animals. 2024; 14(21):3089. https://doi.org/10.3390/ani14213089

Chicago/Turabian Style

Lavajoo Bolgouri, Fatemeh, Bahram Falahatkar, Miquel Perelló-Amorós, Fatemeh Moshayedi, Iraj Efatpanah, and Joaquim Gutiérrez. 2024. "The Pattern of Gene Expression (Igf Family, Muscle Growth Regulatory Factors, and Osteogenesis-Related Genes) Involved in the Growth of Skeletal Muscle in Pikeperch (Sander lucioperca) During Ontogenesis" Animals 14, no. 21: 3089. https://doi.org/10.3390/ani14213089

APA Style

Lavajoo Bolgouri, F., Falahatkar, B., Perelló-Amorós, M., Moshayedi, F., Efatpanah, I., & Gutiérrez, J. (2024). The Pattern of Gene Expression (Igf Family, Muscle Growth Regulatory Factors, and Osteogenesis-Related Genes) Involved in the Growth of Skeletal Muscle in Pikeperch (Sander lucioperca) During Ontogenesis. Animals, 14(21), 3089. https://doi.org/10.3390/ani14213089

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop