Next Article in Journal
Effects of Dietary Selenium Yeast Supplementation in Pregnant Cashmere Goats on the Development of Offspring Hair Follicles
Previous Article in Journal
Identification, Expression and Antimicrobial Functional Analysis of Interleukin-8 (IL-8) in Response to Streptococcus iniae and Flavobacterium covae in Asian Seabass (Lates calcarifer Bloch, 1790)
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 3
10.3390/ani14030476
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Identification of Babesia and Theileria Infections in Livestock in the Qinghai–Tibetan Plateau Area, China

by
Yihong Ma
1,
Yingna Jian
2,
Geping Wang
2,
Xiuping Li
2,
Guanghua Wang
2,
Yong Hu
2,
Naoaki Yokoyama
1,
Liqing Ma
2,* and
Xuenan Xuan
1,*
1
National Research Center for Protozoan Diseases, Obihiro University of Agriculture and Veterinary Medicine, Inada-cho, Obihiro 080-8555, Japan
2
Qinghai Academy of Animal Sciences and Veterinary Medicine, Centre for Biomedicine and Infectious Diseases, Qinghai University, Xining 810016, China
*
Authors to whom correspondence should be addressed.
Animals 2024, 14(3), 476; https://doi.org/10.3390/ani14030476
Submission received: 16 December 2023 / Revised: 24 January 2024 / Accepted: 29 January 2024 / Published: 1 February 2024
(This article belongs to the Section Veterinary Clinical Studies)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

The Qinghai–Tibetan Plateau (QTPA), in the northwestern region of China, is characterized by diverse geographical features, earning it the title of “the roof of the world”. Despite this, limited information exists on the distribution of tick-borne pathogens in this region. This study aimed to evaluate the infection rates of Babesia and Theileria species in QTPA. Blood samples collected from livestock species (n = 366) were analyzed using different PCR-sequencing techniques. Results showed a high infection rate of Theileria spp. (38.2%). B. motasi-like Lintan/Ningxia/Tianzhu was detected in 0.3% of samples. Notably, this study reported infection rates of Babesia and Theileria species in goats, horses, and donkeys in the Qinghai–Tibetan Plateau for the first time.

Abstract

The northwestern region of China, known as the Qinghai–Tibet Plateau Area (QTPA), is characterized by unique climate conditions that support the breeding of various highly-adapted livestock species. Tick vectors play a significant role in transmitting Babesia and Theileria species, posing serious risks to animal health as well as the economy of animal husbandry in QTPA. A total of 366 blood samples were collected from Tibetan sheep (n = 51), goats (n = 67), yaks (n = 43), cattle (n = 49), Bactrian camels (n = 50), horses (n = 65), and donkeys (n = 40). These samples were examined using conventional and nested PCR techniques to detect Theileria and Babesia species. The overall infection rates were 0.3% (1/366) for Babesia spp. and 38.2% (140/366) for Theileria spp. Notably, neither Babesia nor Theileria species were detected in donkeys and yaks. The infection rates of Babesia and Theileria species among animals in different prefectures were significantly different (p < 0.05). Furthermore, Babesia bovis, B. bigemina, B. caballi, and B. ovis were not detected in the current study. To our knowledge, this is the first documented detection of Theileria luwenshuni infection in Bactrian camels and goats, as well as T. sinesis in cattle and T. equi in horses on the Qinghai plateau. These novel findings shed light on the distribution of Babesia and Theileria species among livestock species in QTPA.

1. Introduction

The Qinghai–Tibet Plateau area (QTPA), located in the northwestern region of China and with an elevation exceeding 4500 m (14,800 ft) above sea level, is defined by challenging environmental conditions. Renowned for its lofty altitudes and frigid temperatures, it has earned the distinguished titles of “the roof of the world” and “the third pole of the Earth” [1]. The high altitude and thin air in this region give rise to distinct climatic conditions, leading to significant variations in weather patterns. Frequent occurrences of strong winds, minimal yearly temperature fluctuations, and notable daily temperature variations are observed in this area [2].
The QTPA is home to a diverse range of livestock species adapted to the high altitude and cold climate [3], including Tibetan sheep, goats, yaks, cattle, horses, camels, and donkeys [4]. Within the QTPA, the cohabitation of various animal species in shared pastures presents a potential risk for interspecies pathogen transmission, including tick-borne pathogens (TBPs). Additionally, the Qinghai plateau, with a focal point at Qinghai Lake, functions as a vital migratory route, intersecting the Central Asian Flyway from western Siberia through central Asia to India and the East Asian Flyway from Russia through eastern China to Australia [5]. This route is frequented by 292 various bird species, including passerines such as Przevalski’s redstart, slaty-blue flycatcher, great rosefinch, Tarim Babbler, and others, during their respective migration seasons. As passerines can be parasitized by Ixodid ticks, they serve as carriers, contributing to the dissemination of tick-borne pathogens [6,7], which may include infections such as Babesia spp. [8]. With complex topography and diverse landscapes, Qinghai features grasslands covering 54.8% of its total area, wetlands at 27.01%, and forests at 4.8% [9], creating an environment conducive to tick proliferation and raising the potential risks of transmitting diverse tick-borne pathogens to livestock [10]. Babesia and Theileria, two genera of TBPs, have a significant impact on the health of livestock as well as the economy of animal husbandry in the QTPA.
Theileriosis, caused by Theileria species, poses significant limitations to the development of livestock husbandry in China. Among cattle, the most prevalent and virulent pathogens associated with bovine theileriosis are T. sergenti and T. annulata. In sheep and goats, T. lestoquardi, T. luwenshuni, and T. uilenbergi are recognized as highly pathogenic species [11]. Within Qinghai, six species of Theileria, including T. ovis, T. sinensis, T. luwenshuni, T. uilenbergi, T. equi, and Theileria sp. OT3, have been detected, infecting yaks, Tibetan sheep, and camels [12,13,14,15]. Notably, the detection of T. sinensis in yaks from Qinghai was reported for the first time in 2020 [10].
Babesiosis represents a globally pervasive tick-borne disease stemming from the invasion and infection of red blood cells by Babesia species [16]. In China, ovine babesiosis is mainly caused by B. ovis and B. motasi-like Lintan/Ningxia/Tianzhu [17]. The most prevalent species infecting both cattle and water buffaloes are B. bovis and B. bigemina [18,19]. In Gansu province, yaks have been found to be infected with B. bigemina [20] and B. bovis [14]. Three Babesia species, namely B. motasi, B. bigemina, and B. caballi, were detected in sheep and wild yaks in Qinghai [21,22,23].
While prior research in the Qinghai region has delved into the study of Babesia and Theileria, it predominantly focused on ticks [12,24], yaks [13,14,25], and Tibetan sheep [13,15]. In contrast, this study employs a more comprehensive approach, investigating various key livestock species in the Qinghai region, including Tibetan sheep, goats, yaks, cattle, Bactrian camels, horses, and donkeys. Moreover, the analysis considers the distinct administrative divisions within Qinghai Province. Thus, the primary objective of this study is to evaluate the infection rates of Babesia and Theileria species affecting livestock in the QTPA.

2. Materials and Methods

2.1. Sample Collection and Preparation

In this study, a total of 366 blood samples from livestock were randomly collected from five different prefectures in the QTPA between May 2020 and January 2022. The sample size used was estimated based on a representative sample size of 1/200,000 of the total livestock populations on the Qinghai plateau [26]. Additionally, considerations were made based on the prevalent areas for ticks, such as regions abundant in water sources, covered by forests, and used for grazing. The livestock species included in this study were Tibetan sheep (n = 51), goats (n = 67), yaks (n = 43), cattle (n = 49), Bactrian camels (n = 50), horses (n = 65), and donkeys (n = 40). The sampling areas encompassed the following regions: (1) Haixi Mongolian and Tibetan Autonomous Prefecture (latitude 35°01′–39°19′ N, longitude 90°07′–99°46′ E), (2) Haibei Tibetan Autonomous Prefecture (latitude 36°44′00″–39°05′18″ N, longitude 98°5′00″–102°41′03″ E), (3) Hainan Tibetan Autonomous Prefecture (latitude 34°38′–37°10′ N, longitude 98°55′–105°50′ E), (4) Haidong (latitude 35°25.9′–37°05′ N, longitude 100°41.5′–103°04′ E), and (5) Xining (latitude 36°13′–37°28′ N, longitude 100°52′–101°54′ E) (Figure 1, Table S1). All protocols were carried out according to the ethical guidelines approved by the Obihiro University of Agriculture and Veterinary Medicine (Permit for animal experiment: 22–23). Livestock owners were invited to take part in this study, and their oral consent was obtained before sample collection.
Genomic DNA was extracted from blood samples using the TIANamp Genomic DNA Kit (Tiangen, Beijing, China) according to the manufacturer’s manual. The DNA concentration was measured using a Biochrom WPA Biowave DNA Life Science Spectrophotometer (Biochrom, Cambrige, UK) and stored at −20 °C until further use.

2.2. Molecular Detection of Theileria and Babesia Species

Theileria and Babesia species were detected using primers listed in Table 1. Briefly, a PCR reaction was prepared with a total volume of 10 μL. This included 1 μL of the DNA template, 0.5 μL of forward and reverse primers (100 μM), 0.2 μL of deoxyribonucleotide triphosphate (200 μM; New England BioLab, Ipswich, MA, USA), 1 μL of 10× ThermoPol Reaction Buffer (New England BioLab, USA), 0.1 μL of Taq polymerase (0.5 U; New England BioLab, USA), and double-distilled water up to 10 μL [15]. The thermal cycling condition for each PCR reaction was carried out following the protocols outlined in previously published studies mentioned in Table 1. PCR products were subsequently subjected to electrophoresis in a 1.5% agarose gel, stained with ethidium bromide, and visualized by UV transillumination.

2.3. Sequencing Reaction

For the sequencing protocol, the PCR product of some positive samples was chosen. All positive samples for each pathogen were sequenced if their numbers were fewer than ten. However, if their numbers were more than ten, we sequenced at least 30% of the positive samples from different study areas. These samples represented different livestock species from various sampling areas included in this study. The PCR product of the positive samples was purified using the EasyPure Quick Gel Extraction Kit (TransGen Biotech, Beijing, China) and cloned into E. coli DH5α cells (Takara, Shiga, Japan) using the pMD™18-T Vector Cloning Kit (Takara, Shiga, Japan). Plasmid purification was performed using the EasyPure® Plasmid MiniPrep Kit (TransGen Biotech, Beijing, China) according to the manufacturer’s manual. Subsequently, at least three positive clones were sent to Genewiz company, Suzhou, China, for sequencing.
The good-quality sequence reads obtained in this study were compared with published sequences deposited in the GenBank databases (https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 7 October 2022)) using the BLASTn search tool. Phylogenetic trees were constructed using the maximum likelihood method in MEGA X with the bootstrap method, employing 1000 replications [32].

2.4. GenBank Accession Numbers

Accession numbers for the sequences generated in this study were obtained through depositing in the GenBank database of the National Center for Biotechnology Information (NCBI). The assigned accession numbers for the sequences generated in this study are listed in Table 2.

2.5. Statistical Analyses

The comparison of infection rates for Babesia and Theileria species detected in this study was conducted using the R 4.3.1 software. Statistical analyses were performed using the multifactorial analysis of variance (ANOVA) test. Statistical significance was determined when the resulting p-values were <0.05.

3. Results

3.1. Overall Infection Rates

The overall infection rates were 0.3% (1/366) for B. motasi-like (Babesia sp. L/N/T) and 38.2% (140/366) for Theileria spp. B. bovis, B. bigemina, B. caballi, and B. ovis were not detected in this study.
In this study, Babesia species (B. motasi-like) was detected only in goats. Theileria species were detected in 94.2% (49/52) of Tibetan sheep, 100% (67/67) of goats, 9% (6/65) of horses, 18% (9/49) of cattle, and 18% (9/50) of Bactrian camels (Table 3). Neither Babesia nor Theileria species were detected in donkeys and yaks (Figure 2). Despite this, there was no significant difference in infection rates among different animal species.
The data analysis revealed that Haibei prefecture had the highest infection rate among the examined areas in this study (68.4%; 39/57). In contrast, Xining had the lowest infection rate (2.5%; 1/40) (Figure 1). The infection rates of Babesia and Theileria from different prefectures show significant differences (p = 0.0359) (Table S2).

3.2. Sequencing Analyses

In this study, we detected only one Babesia species (Babesia cf. motasi) as well as seven Theileria species (including Theileria sp. OT3, T. luwenshuni, T. uilenbergi, T. capreoli, Theileria sp. Iwate, T. sinensis, and T. equi). The BLASTn search revealed that the 18S rRNA sequences of Theileria spp. exhibited 99.1–100.0% identities with T. luwenshuni (MN394815), 99.5–99.8% with T. uilenbergi (MN394818), 100.0% with Theileria sp. OT3 (MG930118), 100% with T. sinensis (MN628025), and 99.7–99.8% with T. equi (MT093500). Furthermore, one Theileria spp. isolate from sheep showed 98.6% homology with T. capreoli from China (KJ188219), and an isolate from goat displayed 97.98% homology with Theileria sp. Iwate from Japan (AB602881). The rap-1b sequence of Babesia cf. motasi exhibited 99.7% identity with Babesia cf. motasi detected in sheep from Qinghai province, China (MH908949) (Table 2).

3.3. Phylogenetic Analyses

The phylogenetic analyses of the Babesia cf. motasi sequence (OQ776776) based on the rap-1b gene revealed its placement in the same clade as Babesia cf. motasi isolates from sheep and tick samples in China (Figure 3).
Additionally, our study yielded significant findings regarding the 18S rRNA sequences of Theileria species. We classified Theileria species isolates from sheep and goats as T. uilenbergi, T. luwenshuni, and Theileria sp. OT3, based on their placement within the same clade. On the other hand, all cattle isolates were placed with T. sinensis isolates from cattle and tick populations in the neighboring Gansu province [19]. Notably, this is the first detection of T. sinensis in Qinghai, a region located near the QTPA. Furthermore, the phylogenetic analyses of horse isolates confirmed their infection with T. equi, supporting existing knowledge in this regard. Importantly, our research also revealed the detection of T. luwenshuni among Bactrian camels within the QTP area, marking the initial documentation of such an occurrence (Figure 4).

4. Discussion

This study sheds light on the prevalence and diversity of Babesia and Theileria species among various livestock species in the challenging environment of the QTPA. The QTPA, renowned for its extreme altitude and harsh climate, hosts a diverse range of livestock species, contributing to the complexity of interspecies interactions and potential transmission of TBPs. In the Qinghai Plateau, a total of 31 tick species belonging to 6 genera and 2 families have been documented. Among them, Dermacentor nuttalli and Haemaphysalis qinghaiensis emerge as the predominant tick species in Qinghai Province, exhibiting extensive distribution across most regions [33], which potentially facilitates Babesia [24] and Theileria [12,24] transmission on the Qinghai plateau.
Previous studies have reported the presence of different Babesia species in the Qinghai Plateau, including B. motasi, B. bigemina, and B. caballi, infecting sheep, yaks, and ticks [15,25]. In the current study, only one of the examined goats was positive for Babesia motasi-like Lintan/Ningxia/Tianzhu, giving the possibility that the Qinghai plateau area has a low infection rate with Babesia species. This finding contributes to our understanding of the distribution of these pathogens in the region. Earlier investigations detected six different species of Theileria, namely T. ovis, T. sinensis, T. luwenshuni, T. uilenbergi, T. equi, and Theileria sp. OT3, in the Qinghai Plateau area [12,13,14,15]. In this study, we identified a wide range of Theileria species with an infection rate of 38.2% (140/366). Through sequencing, we identified various Theileria species, including Theileria sp. OT3, T. luwenshuni, T. uilenbergi, T. capreoli, Theileria sp. Iwate, T. sinensis, and T. equi. The results highlight that T. luwenshuni exhibits the highest infection rate among the different Theileria species. This suggests that T. luwenshuni may be the predominant species responsible for infecting livestock in Qinghai Plateau domestic animals. Notably, we present the first documented evidence of T. sinensis presence in cattle from the Qinghai Plateau. A previous study has shown its detection in yaks in Qinghai [14]. Furthermore, our analysis provides confirmation of T. equi infection in horses within the Qinghai plateau, marking the initial recorded identification of T. equi in horses within this region.
Our comprehensive approach, spanning across Tibetan sheep, goats, yaks, cattle, Bactrian camels, horses, and donkeys, provides a more inclusive understanding compared to previous research primarily focused on specific animals. Furthermore, we consider distinct administrative divisions within Qinghai Province, adding granularity to our analysis. Goats and Tibetan sheep were found to be more susceptible to infection with Theileria spp., possibly due to variations in susceptibility and immune responses [34], whereas TBPs were not detected in yaks and donkeys. Yaks demonstrate a reduced prevalence or potential resistance to Theileria spp., a phenomenon likely attributed to specific immune mechanisms [35], notably high-altitude-induced modifications in blood composition. The heightened levels of erythrocytes and hemoglobin [36], may influence Theileria (erythrocyte parasite) infection. Additionally, the dense and long hair of yaks acts as a physical barrier, hindering tick attachment and reducing the likelihood of Theileria spp. transmission. The statistical analysis of the multifactorial analysis of variance (ANOVA) does not show statistical significance for the observed differences in infection rates among different livestock in the region (p = 0.063 > 0.05). Although the majority of animals exhibit good health, we have identified the presence of Babesia and Theileria in their blood samples. This observation may imply potential infection risks or indicate varying susceptibility levels among certain individuals to these parasites. Consequently, the transmission dynamics of these parasites in the animal population will be further investigated, and potential prevention and control strategies will be explored. Additionally, the findings of this study revealed that Haibei Prefecture, renowned for hosting the crucial avian migration route of Qinghai Lake [5] and boasting abundant water resources [37], exhibited the highest prevalence of Theileria among the scrutinized regions. Rigorous statistical analyses further underscored a statistically significant difference in infection rates across the diverse study areas (p < 0.05). To gain a deeper understanding of the potential factors influencing the infection rate of TBPs in QTPA, future investigations could consider expanding the sample size, implementing more extensive data collection methods, or exploring alternative statistical approaches.
In summary, this study focused on the molecular detection of Theileria and Babesia species in various livestock on the Qinghai–Tibetan Plateau. The findings underscore the importance of monitoring tick-borne pathogens in this region. However, it is essential to acknowledge certain limitations in our study. Firstly, the blood samples from donkeys were collected from various farmers within the same region who practiced intensive management instead of extensive management, resulting in reduced tick exposure compared to grazing. Additionally, the inclusion of donkey blood from different farms within the same region introduces constraints on its representativeness [38]. Secondly, while most animals appeared healthy, our study’s design hinders the identification of potential infection risk factors. Asymptomatic carriers may be present, and the lack of visible signs of illness does not guarantee the absence of exposure or infection, impacting our understanding of the epidemiological landscape. Thirdly, potential diagnostic biases exist, as variations in methods or sensitivity may influence tick-borne pathogen detection rates. This introduces uncertainty in our results, emphasizing the need for careful interpretation due to the complexities of diagnostic procedures. Future studies should explore factors influencing Babesia and Theileria infection rates in the QTPA by incorporating broader sample sets and diverse diagnostic methods. This approach will contribute to the refinement of prevention and control strategies in this challenging environment.

5. Conclusions

This study significantly contributes to our understanding of the prevalence and diversity of Babesia and Theileria species within the challenging environment of the Qinghai–Tibet Plateau Area (QTPA). By investigating a broad spectrum of livestock species, including Tibetan sheep, goats, yaks, cattle, Bactrian camels, horses, and donkeys, we offer a more comprehensive perspective compared to previous research focused on specific animals. Noteworthy findings include the low infection rate of Babesia species in the Qinghai Plateau area, with only one examined goat testing positive for Babesia motasi-like Lintan/Ningxia/Tianzhu. Theileria species exhibited a higher infection rate of 38.2%, with T. luwenshuni identified as the predominant species. Our study also presents the first documented evidence of T. sinensis in cattle and T. equi in horses within the Qinghai Plateau. Notably, distinct susceptibility patterns were observed among livestock species, with goats and Tibetan sheep being more susceptible to Theileria spp., while yaks and donkeys showed resistance. The observed prevalence of Babesia and Theileria in apparently healthy animals suggests varying susceptibility levels among individuals, prompting further investigation into transmission dynamics and the exploration of potential prevention and control strategies. Additionally, the regional analysis revealed that Haibei Prefecture exhibited the highest prevalence of Theileria, emphasizing the need for more in-depth studies to understand the factors influencing infection rates across diverse regions in the QTPA.

Supplementary Materials

The following supporting information can be downloaded at: https://www.mdpi.com/article/10.3390/ani14030476/s1, Table S1: The blood sample collected in different places from Qinghai Plateau; Table S2: The effect of livestock species and localities on infection rate of TBPs.

Author Contributions

Y.M., methodology, validation, formal analysis, and writing—original draft; Y.J., data curation, formal analysis; G.W. (Geping Wang), validation and investigation; X.L., validation and investigation; G.W. (Guanghua Wang), investigation and recording data; Y.H., investigation and recording data; N.Y., writing—review and editing, and visualization; L.M., conceptualization, writing—review and editing, and funding acquisition; X.X., conceptualization, writing—review and editing, and funding acquisition. All authors have read and agreed to the published version of the manuscript.

Funding

This study has been generously supported by esteemed funding sources from both China and Japan. In China, the Transformation of Scientific and Technological Achievements of Qinghai Province (Grant No. 2021-SF-146), the Agriculture Research System of China (Grant No. CARS-39-16), and the National Foreign Experts Program of China (Grant No. G2022043003L) have provided crucial financial assistance. We extend our sincere gratitude for their support. Furthermore, we would like to express our deep appreciation for the support received from Japan. The AMED project (Grant No. JP23WM02250317), the JSPS Core-to-Core program, and a grant from the Strategic International Collaborative Research Project (JPJ008837) facilitated by the Ministry of Agriculture, Forestry, and Fisheries of Japan have played a pivotal role in enabling the successful execution of this research endeavor. We are grateful for their invaluable financial contributions.

Institutional Review Board Statement

The experimental procedures were conducted in accordance with the ethical guidelines approved by Obihiro University of Agriculture and Veterinary Medicine (Permit for animal experimentation: 22–23).

Informed Consent Statement

Not applicable.

Data Availability Statement

Data are contained within the article.

Acknowledgments

The authors would like to extend their sincere gratitude to the individuals whose invaluable contributions were instrumental in the successful completion of this project. In particular, we would like to express our deepest appreciation to the dedicated technical staff at the Animal Husbandry and Veterinary Station. Their unwavering commitment and expertise played a crucial role in collecting blood and tick samples from various regions, including Minhe, Ledu, Huzhu, Menyuan, Huangyuan, Datong, and other counties of Qinghai province, China. Furthermore, we would like to express our sincere appreciation to Mingming Liu, Jixu Li, Moaz M. Amer, and Hang Li for their significant contributions in refining the manuscript and providing invaluable assistance in enhancing its scientific rigor and coherence. And we extend our heartfelt thanks to all those who have played a part in this project, directly or indirectly. Your support and collaboration have been indispensable, and we are deeply appreciative of your contributions.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Tang, W.; Zhou, T.; Sun, J.; Li, Y.; Li, W. Accelerated urban expansion in Lhasa city and the implications for sustainable development in a plateau city. Sustainability 2017, 9, 1499. [Google Scholar] [CrossRef]
  2. Long, R.J.; Ding, L.M.; Shang, Z.H.; Guo, X.H. The yak grazing system on the Qinghai-Tibetan plateau and its status. Rangeland J. 2008, 30, 241. [Google Scholar] [CrossRef]
  3. Spicer, R.A.; Su, T.; Valdes, P.J.; Farnsworth, A.; Wu, F.-X.; Shi, G.; Spicer, T.E.V.; Zhou, Z. Why ‘the uplift of the Tibetan plateau’ is a myth? Natl. Sci. Rev. 2020, 8, nwaa091. [Google Scholar] [CrossRef]
  4. Qi, T.; Ai, J.; Yang, J.; Zhu, H.; Zhou, Y.; Zhu, Y.; Zhang, H.; Qin, Q.; Kang, M.; Sun, Y.; et al. Seroepidemiology of neosporosis in various animals in the Qinghai-Tibetan plateau. Front. Vet. Sci. 2022, 9, 953380. [Google Scholar] [CrossRef]
  5. Prosser, D.J.; Cui, P.; Takekawa, J.Y.; Tang, M.; Hou, Y.; Collins, B.M.; Yan, B.; Hill, N.J.; Li, T.; Li, Y.; et al. Wild bird migration across the Qinghai-Tibetan Plateau: A transmission route for highly pathogenic H5N1. PLoS ONE 2011, 6, e17622. [Google Scholar] [CrossRef] [PubMed]
  6. Wang, Y.; Han, S.; He, H. Research status of tick distribution and tick-borne diseases in Qinghai Province. Prog. Vet. Med. 2022, 43, 115–119. [Google Scholar]
  7. Hasle, G.; Bjune, G.; Edvardsen, E.; Jakobsen, C.; Linnehol, B.; Røer, J.E.; Mehl, R.; Røed, K.H.; Pedersen, J.; Leinaas, H.P. Transport of ticks by migratorypasserine birds to Norway. J. Parasitol. 2009, 95, 1342–1351. [Google Scholar] [CrossRef]
  8. Hasle, G.; Leinaas, H.P.; Røed, K.H.; Øines, Ø. Transport of Babesia venatorum-infected Ixodes ricinus to Norway by northward migrating passerine birds. Acta Vet. Scand. 2011, 53, 41. [Google Scholar] [CrossRef]
  9. He, J.; Chen, J.; Xiao, J.; Zhao, T.; Cao, P. Defining Important Areas for Ecosystem Conservation in Qinghai Province under the Policy of Ecological Red Line. Sustainability 2023, 15, 5524. [Google Scholar] [CrossRef]
  10. Yue, J.; Shi, Y. Epidemiological investigation of Lyme disease in parts of forest areas in Qinghai province. Chin. J. Vector Biol. Control 2009, 20, 358–359. [Google Scholar]
  11. Yin, H.; Schnittger, L.; Luo, J.; Seitzer, U.; Ahmed, J.S. Ovine theileriosis in China: A new look at an old story. Parasitol. Res. 2007, 101, 191–195. [Google Scholar] [CrossRef]
  12. Jian, Y.; Zhang, X.; Li, X.; Wang, G.; Wang, G.; Ma, L. Identification of ticks and tick-borne pathogens in different areas of Haibei of Qinghai province. Chin. Qinghai J. Anim. Vet. Sci. 2020, 50, 35. [Google Scholar]
  13. Li, J.; Jian, Y.; Jia, L.; Galon, E.M.; Benedicto, B.; Wang, G.; Cai, Q.; Liu, M.; Li, Y.; Ji, S.; et al. Molecular characterization of tick-borne bacteria and protozoans in yaks (Bos grunniens), Tibetan sheep (Ovis aries) and bactrian camels (Camelus bactrianus) in the Qinghai-Tibetan plateau area, China. Ticks Tick Borne Dis. 2020, 11, 101466. [Google Scholar] [CrossRef] [PubMed]
  14. Wang, Y.; Wang, B.; Zhang, Q.; Li, Y.; Yang, Z.; Han, S.; Yuan, G.; Wang, S.; He, H. The common occurrence of Theileria ovis in Tibetan sheep and the first report of Theileria sinensis in yaks from southern Qinghai, China. Acta Parasit. 2021, 66, 1177–1185. [Google Scholar] [CrossRef]
  15. Li, J.; Ma, L.; Moumouni, P.F.A.; Jian, Y.; Wang, G.; Zhang, X.; Li, X.; Wang, G.; Lee, S.H.; Galon, E.M.; et al. Molecular survey and characterization of tick-borne pathogens in sheep from Qinghai, China. Small Rumin. Res. 2019, 175, 23–30. [Google Scholar] [CrossRef]
  16. Clark, I.A.; Jacobson, L.S. Do babesiosis and malaria share a common disease process? Ann. Trop. Med. Parasitol. 1998, 92, 483–488. [Google Scholar] [CrossRef] [PubMed]
  17. Guan, G.; Liu, J.; Liu, A.; Li, Y.; Niu, Q.; Gao, J.; Luo, J.; Chauvin, A.; Yin, H.; Moreau, E. A Member of the HSP90 family from ovine Babesia in China: Molecular characterization, phylogenetic analysis and antigenicity. Parasitology 2015, 142, 1387–1397. [Google Scholar] [CrossRef]
  18. Niu, Q.; Liu, Z.; Yu, P.; Yang, J.; Abdallah, M.O.; Guan, G.; Liu, G.; Luo, J.; Yin, H. Genetic characterization and molecular survey of Babesia bovis, Babesia bigemina and Babesia ovata in cattle, dairy cattle and yaks in China. Parasites Vectors 2015, 8, 518. [Google Scholar] [CrossRef]
  19. Sun, M.; Guan, G.; Liu, Z.; Wang, J.; Wang, D.; Wang, S.; Ma, C.; Cheng, S.; Yin, H.; Luo, J. Molecular survey and genetic diversity of Babesia spp. and Theileria spp. in cattle in Gansu province, China. Acta Parasit. 2020, 65, 422–429. [Google Scholar] [CrossRef] [PubMed]
  20. Qin, S.Y.; Wang, J.L.; Ning, H.R.; Tan, Q.D.; Yin, M.Y.; Zhang, X.X.; Zhou, D.H.; Zhu, X.Q. First report of Babesia bigemina infection in white yaks in China. Acta Trop. 2015, 145, 52–54. [Google Scholar] [CrossRef]
  21. Estrada-Peña, A.; Ayllón, N.; de la Fuente, J. Impact of climate trends on tick-borne pathogen transmission. Front. Physiol. 2012, 3, 64. [Google Scholar] [CrossRef] [PubMed]
  22. Liu, Q.; Wang, W.; Meng, Q. Research progress of ticks and tick-borne disease. J. Anhui Agric. 2013, 41, 1107–1109. [Google Scholar]
  23. Yu, Z.; Wang, H.; Wang, T.; Sun, W.; Yang, X.; Liu, J. Tick-borne pathogens and the vector potential of ticks in China. Parasites Vectors 2015, 8, 24. [Google Scholar] [CrossRef]
  24. Gao, Y. Distribution of Tick Species and Epidemiological Investigation of 3 Species of Bacterial and Protozoal in Qinghai Province. Master’s Thesis, Jilin Agricultural University, Changchun, China, 2018. [Google Scholar]
  25. Li, Y.; Liu, P.; Wang, C.; Chen, G.; Kang, M.; Liu, D.; Li, Z.; He, H.; Dong, Y.; Zhang, Y. Serologic evidence for Babesia bigemina infection in wild yak (Bos mutus) in Qinghai province, China. J. Wildl. Dis. 2015, 51, 872–875. [Google Scholar] [CrossRef]
  26. Qinghai Province. Available online: https://www.gov.cn/test/2013-03/26/content_2362781.htm (accessed on 22 August 2023).
  27. Terkawi, M.A.; Huyen, N.X.; Shinuo, C.; Inpankaew, T.; Maklon, K.; Aboulaila, M.; Ueno, A.; Goo, Y.K.; Yokoyama, N.; Jittapalapong, S.; et al. Molecular and serological prevalence of Babesia bovis and Babesia bigemina in water buffaloes in the northeast region of Thailand. Vet. Parasitol. 2011, 178, 201–207. [Google Scholar] [CrossRef]
  28. Alhassan, A.; Pumidonming, W.; Okamura, M.; Hirata, H.; Battsetseg, B.; Fujisaki, K.; Yokoyama, N.; Igarashi, I. Development of a single-round and multiplex PCR method for the simultaneous detection of Babesia caballi and Babesia equi in horse blood. Vet. Parasitol. 2005, 129, 43–49. [Google Scholar] [CrossRef]
  29. Niu, Q.; Liu, Z.; Yang, J.; Yu, P.; Pan, Y.; Zhai, B.; Luo, J.; Yin, H. Genetic diversity and molecular characterization of Babesia motasi-like in small uuminants and Ixodid ticks from China. Infect. Genet. Evol. 2016, 41, 8–15. [Google Scholar] [CrossRef]
  30. Aktaş, M.; Altay, K.; Dumanlı, N. Development of a polymerase chain reaction method for diagnosis of Babesia ovis infection in sheep and goats. Vet. Parasitol. 2005, 133, 277–281. [Google Scholar] [CrossRef] [PubMed]
  31. Cao, S.; Zhang, S.; Jia, L.; Xue, S.; Yu, L.; Kamyingkird, K.; Moumouni, P.F.A.; Moussa, A.A.E.M.; Zhou, M.; Zhang, Y.; et al. Molecular Detection of Theileria Species in Sheep from Northern China. J. Vet. Med. Sci. 2013, 75, 1227–1230. [Google Scholar] [CrossRef]
  32. Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef]
  33. Han, R.; Yang, J.F.; Mukhtar, M.U.; Chen, Z.; Niu, Q.L.; Lin, Y.Q.; Liu, G.Y.; Luo, J.X.; Yin, H.; Liu, Z.J. Molecular detection of Anaplasma Infections in Ixodid ticks from the Qinghai-Tibet plateau. Infect. Dis. Poverty 2019, 8, 12. [Google Scholar] [CrossRef]
  34. VanderWaal, K.L.; Ezenwa, V.O. Heterogeneity in Pathogen Transmission: Mechanisms and Methodology. Funct. Ecol. 2016, 30, 1606–1622. [Google Scholar] [CrossRef]
  35. Wu, M.; Zhao, H.; Tang, X.; Zhao, W.; Yi, X.; Li, Q.; Sun, X. Organization and complexity of the yak (Bos grunniens) immunoglobulin loci. Front. Immunol. 2022, 13, 876509. [Google Scholar] [CrossRef]
  36. Guan, J.; Long, K.; Ma, J.; Zhang, J.; He, D.; Jin, L.; Tang, Q.; Jiang, A.; Wang, X.; Hu, Y.; et al. Comparative Analysis of the MicroRNA Transcriptome between Yak and Cattle Provides Insight into High-Altitude Adaptation. PeerJ 2017, 5, e3959. [Google Scholar] [CrossRef] [PubMed]
  37. Wang, Y.; Ye, A.; Zhang, Y.; Yang, F. The Quantitative Attribution of Climate Change to Runoff Increase over the Qinghai-Tibetan Plateau. Sci. Total Environ. 2023, 897, 165326. [Google Scholar] [CrossRef]
  38. Faber, J.; Fonseca, L.M. How sample size influences research outcomes. Dental Press. J. Orthod. 2014, 19, 27–29. [Google Scholar] [CrossRef]
Animals 14 00476 g001
Figure 1. Sample map of Qinghai province and the infection rates across different sampling areas within the Qinghai plateau. Colored regions indicate the areas from which blood samples were collected from livestock animals. The figure was generated and modified using Datav Atlas (https://datav.aliyun.com/portal/school/atlas (accessed on 9 June 2023)).
Figure 1. Sample map of Qinghai province and the infection rates across different sampling areas within the Qinghai plateau. Colored regions indicate the areas from which blood samples were collected from livestock animals. The figure was generated and modified using Datav Atlas (https://datav.aliyun.com/portal/school/atlas (accessed on 9 June 2023)).
Animals 14 00476 g001
Animals 14 00476 g002
Figure 2. Infection rates of tick-borne protozoa among different animal species examined in the study.
Figure 2. Infection rates of tick-borne protozoa among different animal species examined in the study.
Animals 14 00476 g002
Animals 14 00476 g003
Figure 3. Phylogenetic tree of Babesia cf. motasi based on rap-1b sequence analysis. The tree was constructed with Maximum likelihood method using MEGA X with Tamura 3-parameter model, and numbers at nodes represent percentage of occurrence of clades in 1000 bootstrap replications of data. The sequences obtained in this study and their accession numbers are marked in red with dot superscript. T. equi (XM004831306) was used as an outgroup.
Figure 3. Phylogenetic tree of Babesia cf. motasi based on rap-1b sequence analysis. The tree was constructed with Maximum likelihood method using MEGA X with Tamura 3-parameter model, and numbers at nodes represent percentage of occurrence of clades in 1000 bootstrap replications of data. The sequences obtained in this study and their accession numbers are marked in red with dot superscript. T. equi (XM004831306) was used as an outgroup.
Animals 14 00476 g003
Animals 14 00476 g004
Figure 4. Phylogenetic tree of Theileria species based on 18S rRNA sequence analysis. The tree was constructed with Maximum likelihood method using MEGA X with Tamura 3-parameter model, and numbers at nodes represent percentage of occurrence of clades in 1000 bootstrap replications of data. Different colors represent different Theileria species, as shown in figure legend. The sequences obtained in this study and their accession numbers are marked in red with dot superscript. B. microti (AB190459) was used as an outgroup.
Figure 4. Phylogenetic tree of Theileria species based on 18S rRNA sequence analysis. The tree was constructed with Maximum likelihood method using MEGA X with Tamura 3-parameter model, and numbers at nodes represent percentage of occurrence of clades in 1000 bootstrap replications of data. Different colors represent different Theileria species, as shown in figure legend. The sequences obtained in this study and their accession numbers are marked in red with dot superscript. B. microti (AB190459) was used as an outgroup.
Animals 14 00476 g004
Table 1. The list of primer sequences used in this study.
Table 1. The list of primer sequences used in this study.
PathogenTarget GeneMethodPrimer Sequence (5′→3′)Annealing Temperature (°C)Amplicon Size (bp)Reference
B. bovissbp-4PCRFAGTTGTTGGAGGAGGCTAAT55907[27]
RTCCTTCTCGGCGTCCTTTTC
nPCRnFGAAATCCCTGTTCCAGAG55503
nRTCGTTGATAACACTGCAA
B. bigeminarap-1aPCRFGAGTCTGCCAAATCCTTAC55879[27]
RTCCTCTACAGCTGCTTCG
nPCRnFAGCTTGCTTTCACAACTCGCC55412
nRTTGGTGCTTTGACCGACGACAT
B. caballibc48PCRFGGCTCCCAGCGACTCTGTGG63570[28]
RCTTAAGTGCCCTCTTGATGC
B. motasi-like
(Babesia sp. L/N/T)		rap-1bPCRFTGCGCCTTCGAGTTGTACAAGAG58765[29]
RGACGGGTTGCRTAGGCTGAC
nPCRnFTGCGTGGAAGATAGAAAGTTAGCC60536
nRATGACTGATCTCGACTCTCCATTAGCTGG
B. ovisssu rRNAPCRFTGGGCAGGACCTTGGTTCTTCT62549[30]
RCCGCGTAGCGCCGGCTAAATA
Theileria spp.18S rRNAPCRFGAAACGGCTACCACATCT55778[31]
RAGTTTCCCCGTGTTGAGT
nPCRnFTTAAACCTCTTCCAGAGT581
nRTCAGCCTTGCGACCATAC
Table 2. GenBank accession numbers were assigned to Theileria and Babesia species sequences generated in this study.
Table 2. GenBank accession numbers were assigned to Theileria and Babesia species sequences generated in this study.
Obtained SequencesThe Closest BLASTn Match
PathogenIsolation SourceTarget GeneGenBank NumberLength (bp)Identity (%)Pathogen GenBank Number (Host, Country)
Theileria spp.Sheep18s rRNAOQ69244758499.14%T. luwenshuniMN394815 (yak, China)
Sheep18s rRNAOQ69247358698.64%T. capreoliKJ188219 (deer, China)
Sheep18s rRNAOQ69247458099.66%T. uilenbergiMN394818 (yak, China)
Sheep18s rRNAOQ692478589100%Theileria sp. OT3MG930118 (goat, China)
Goat18s rRNAOQ69248958299.83%T. luwenshuniMN394815 (yak, China)
Goat18s rRNAOQ69249259397.98%Theileria sp. IwateAB602881 (serow, Japan)
Goat18s rRNAOQ69250257999.66%T. uilenbergiMN394818 (yak, China)
Goat18s rRNAOQ692548589100%Theileria sp. OT3MG930118 (goat, China)
Cattle18s rRNAOQ692553579100%T. sinensisMN628025 (cattle, China)
Horse18s rRNAOQ69256558399.83%T. equiMT093500 (horse, China)
Camel18s rRNAOQ692560582100%T. luwenshuniMN394815 (yak, China)
Babesia spp.Goatrap-1bOQ77677653599.63%Babesia cf. motasiMH908949 (sheep, China)
Table 3. The detection rates of Theileria and Babesia species among livestock in QTPA.
Table 3. The detection rates of Theileria and Babesia species among livestock in QTPA.
AreaAnimal SpeciesTBP 1Babesia spp.Theileria spp.
nB. bigeminaB. bovisB. caballiBabesia cf. motasiB. ovis
HaidongDonkey40------
Tibetan sheep52-----49 (94.2)
Goat31---1 (3.2)-31 (100.0)
Yak43------
Horse1------
Cattle38-----9 (23.7)
Subtotal205---1 (0.5)-89 (43.4)
HaibeiGoat36-----36 (100.0)
Horse10-----3 (30.0)
Cattle11------
Subtotal57-----39 (68.4)
HainanHorse14-----2 (14.3)
Subtotal14-----2 (14.3)
HaixiBactrian camels50-----9 (18.0)
Subtotal50-----9 (18.0)
XiningHorse40-----1 (2.5)
Subtotal40-----1 (2.5)
Total3661 (0.3)140 (38.2)
1 The data are represented in terms of the number of infected individuals (infection rate (%)).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Ma, Y.; Jian, Y.; Wang, G.; Li, X.; Wang, G.; Hu, Y.; Yokoyama, N.; Ma, L.; Xuan, X. Molecular Identification of Babesia and Theileria Infections in Livestock in the Qinghai–Tibetan Plateau Area, China. Animals 2024, 14, 476. https://doi.org/10.3390/ani14030476

AMA Style

Ma Y, Jian Y, Wang G, Li X, Wang G, Hu Y, Yokoyama N, Ma L, Xuan X. Molecular Identification of Babesia and Theileria Infections in Livestock in the Qinghai–Tibetan Plateau Area, China. Animals. 2024; 14(3):476. https://doi.org/10.3390/ani14030476

Chicago/Turabian Style

Ma, Yihong, Yingna Jian, Geping Wang, Xiuping Li, Guanghua Wang, Yong Hu, Naoaki Yokoyama, Liqing Ma, and Xuenan Xuan. 2024. "Molecular Identification of Babesia and Theileria Infections in Livestock in the Qinghai–Tibetan Plateau Area, China" Animals 14, no. 3: 476. https://doi.org/10.3390/ani14030476

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop