Next Article in Journal
Molecular Diagnosis of Footrot and Contagious Ovine Digital Dermatitis in Small Ruminants in the Iberian Peninsula
Previous Article in Journal
Assessing and Screening of Female Fertility in Artificially Bred Asian Yellow Pond Turtles (Mauremys mutica) Based on Parentage Assignment
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 3
10.3390/ani14030480
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers

by
Bolin Zhang
1,2,*,†,
Qian Yang
3,†,
Ning Liu
3,
Qingzhen Zhong
3 and
Zewei Sun
3,*
1
College of Animal Science and Technology, Qingdao Agricultural University, Chang Cheng Road, Cheng Yang District, Qingdao 266109, China
2
Department of Biology and Agriculture, Zunyi Normal College, Ping’an Avenue, Hong Huagang District, Zunyi 563006, China
3
College of Animal Science and Technology, Jilin Agricultural University, No. 2888, Xincheng Road, Jingyue District, Changchun 130118, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2024, 14(3), 480; https://doi.org/10.3390/ani14030480
Submission received: 5 December 2023 / Revised: 21 January 2024 / Accepted: 27 January 2024 / Published: 1 February 2024
(This article belongs to the Section Animal Nutrition)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Our previous study suggested that glutamine (Gln), defined as a conditionally essential amino acid, contributed to improving growth performance, alleviating inflammatory responses and intestinal permeability, as well as rescuing the destroyed intestinal mucosa induced by LPS exposure. In addition, it was demonstrated that LPS-induced immune stress led to a severe loss of muscle mass. Here, Gln was proven to function in regulating inflammatory responses, protein synthesis, and degradation during sepsis. Our results showed that Gln administration attenuated liver inflammatory reactions, elevated protein synthesis, and inhibited protein degradation of broilers subjected to LPS challenge.

Abstract

The aim of our present study was to investigate the effects of Gln supplementation on liver inflammatory responses as well as protein synthesis and degradation in the muscle of LPS-challenged broilers. A total of 120 one-day-old male broiler chickens (Arbor Acres Plus) were randomly arranged in a 2 × 2 factorial design with five replicates per treatment and six broilers per replicate, containing two main factors: immune challenge (injected with LPS in a dose of 0 or 500 µg/kg of body weight) and dietary treatments (supplemented with 1.22% alanine or 1% Gln). After feeding with an alanine or Gln diet for 15 days, broilers were administrated an LPS or a saline injection at 16 and 21 days. The results showed that Gln supplementation alleviated the increased mRNA expressions of interleukin-6, interleukin-1β, and tumor necrosis factor-α induced by LPS in liver. Moreover, the increased activity of aspartate aminotransferase combined with the decreased expression of glutaminase in muscle were observed following Gln addition. In addition, in comparison with the saline treatment, LPS challenge altered the signaling molecules’ mRNA expressions associated with protein synthesis and degradation. However, Gln supplementation reversed the negative effects on protein synthesis and degradation in muscle of LPS-challenged broilers. Taken together, Gln supplementation had beneficial effects: alleviating inflammatory responses, promoting protein synthesis, and inhibiting protein degradation of LPS-challenged broilers.

1. Introduction

Under intensive breeding conditions, broilers commonly suffer from immune stress that is induced by diverse pathogenic and nonpathogenic microorganisms, which cause adverse changes in body metabolism and immune system and ultimately result in impaired growth performance [1]. Lipopolysaccharide (LPS), an active component of Gram-negative bacterial cell membranes and an effective immunostimulatory component, can be preferentially used to establish an immune stress model via intraperitoneal injection in broilers [2,3]. Previous studies proved that an acute systemic inflammatory response, such as the production of inflammatory factors and the altered expression of genes involved in the immune system, occur in response to LPS stimulation [4]. Our previous study showed that LPS challenge resulted in impaired growth performance, elevated inflammatory cytokines in serum, and destroyed intestinal mucosal barriers in broilers [5]. In a previous study, it was also demonstrated that LPS-induced immune stress led to a severe loss of muscle mass [6]. Moreover, LPS challenge altered the molecular pathways regulating the catabolism of muscle mass, which contain the signaling molecules responsible for increased protein degradation and decreased protein synthesis [7].
It has been well documented that the rapamycin mammalian target of rapamycin (mTOR) signaling pathway is responsible for protein synthesis in skeletal muscle and that the activation of the ubiquitin–proteasome pathway primarily mediates the protein degradation of skeletal muscle [7,8]. It was reported that LPS administration depressed protein synthesis in skeletal muscle, associated with the reduced expression of eukaryotic initiation factor eIF4E binding protein 1 (4E-BP1) and ribosomal protein 6 kinase 1 (S6K1), which are the downstream targets of the mTOR signaling pathway that is involved in protein synthesis [9,10]. In addition, LPS challenge resulted in increased expressions of muscle atrophy F-box (MAFbx) and muscle ring finger 1 (MuRF1), which are considered the key regulators of muscle protein degradation [7,11]. Therefore, it is worthwhile to search for effective measures of nutritional modulation to suppress proinflammatory cytokines and attenuate muscle atrophy in broilers during sepsis and inflammation.
The concentration of glutamine (Gln), which is the most abundant amino acid in plasma and skeletal muscle, falls dramatically in the circulation and tissues during stress conditions [12]. Therefore, Gln is a conditionally essential amino acid during inflammatory conditions [13]. It has been demonstrated that Gln has a wide range of biological functions and serves important roles in promoting growth performance, maintaining intestinal health, and improving immune responses [5,14,15,16]. Dai et al. [12] suggested that dietary supplementation with 1% Gln improved the growth performance of broilers suffering from heat stress. Xue et al. [17] demonstrated that compared with broilers subjected to necrotic enteritis challenge, 1% Gln supplementation increased their feed intake and weight gain and decreased the feed conversion ratio. Furthermore, Gln addition contributed to alleviating the inflammatory reactions evidenced as decreased concentrations of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) in the plasma [5]. Additionally, Gln is considered to be one of the important amino acids in the regulation of the mTOR pathway and autophagy [18,19], which are responsible for protein synthesis and degradation, respectively. It has been demonstrated that the in vitro addition of Gln elevated the protein synthesis and reduced the protein degradation of porcine intestinal epithelial cells [20].
However, the effects of Gln regulation on the protein synthesis and degradation of muscle in LPS-challenged broilers is still not well understood. Therefore, the objective of the current study was to investigate the effects of Gln supplementation on liver inflammatory responses and the protein synthesis and degradation in the muscles of LPS-challenged broilers.

2. Materials and Methods

2.1. Diets, Experimental Design, and Animal Management

The protocols of this experiment were performed according to the guidelines of the Institutional Animal Care and Use Committee of Zunyi Normal College and approved by the Animal Care and Use Committee.
The dosages of Gln (1.0%) supplementation and Ala (1.22%) as the isonitrogenous control were set according to our previous study [5]. Both Ala and Gln were purchased from Shanghai Feiya Technology Development Co., Ltd. (Shanghai, China).
One hundred and twenty one-day-old male broilers (Arbor Acres Plus) were randomly arranged in a 2 × 2 factorial design, containing five replicates per treatment and six broilers per replicate. Broilers were fed either an Ala or a Gln diet for 21 days. After 15 days of feeding broilers were intraperitoneally injected with LPS solution at a dosage of 500 μg LPS/kg of body weight or an equal volume of 0.9% sterile saline at 8.00 a.m. on days 16 and 21, respectively. The four experimental treatments were as follows: (1) Ala-saline group, in which birds were fed a diet containing 1.22% Ala and received intraperitoneal administration of sterile saline; (2) Gln-saline group, in which birds were fed a diet containing 1% Gln and received intraperitoneal administration of sterile saline; (3) Ala-LPS group, in which birds were fed a diet containing 1.22% Ala and received intraperitoneal LPS injection; (4) Gln-LPS group, in which birds were fed a diet containing 1% Gln and received intraperitoneal LPS injection. All broilers were kept in a temperature-controlled room with a humidity of 60–65% and a light protocol of 23 h light and 1 h dark. The temperature was kept at 34–36 °C and gradually decreased by 2–3 °C weekly until it reached a final temperature of around 26 °C. The growth performance of broilers receiving the aforementioned treatments was reported in our previous study [5]. The broilers used in the present study were purchased from Jilin Dexiang Animal Husbandry Co., Ltd. (Changchun, China). The ingredients of the diets and nutrition contents are presented in Table 1. Throughout the entire experiment, broilers were given ad libitum access to feed in mash form and fresh water.

2.2. Sample Collection

Two hours after LPS injection, 10 broilers at 21 days of age (2 broilers per replicate) were randomly selected to obtain blood samples from the wing vein. The collected blood samples were centrifuged at 4 °C and 3000× g for 10 min to collect plasma and stored at −20 °C until further analysis. Immediately after blood sampling, the selected broilers were sacrificed via cervical dislocation followed by exsanguination. About 10 g Pectoralis Major muscle was collected into sterile tubes and stored in liquid nitrogen until subsequent analysis. All samples were collected within 10 min of euthanasia.

2.3. Determination of Enzyme Activities in Pectoralis Major Muscles

The activities of alanine aminotransferase (ALT), aspartate aminotransferase (AST), and glutamine synthetase (GS) in Pectoralis Major muscles were determined using commercial kits purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). The protocols were conducted according to the instructions of the manufacturers.

2.4. Real-Time PCR Analysis

Total RNA extractions from Pectoralis Major muscle samples using RNAiso Plus reagent (catalogue No. 9108, TaKaRa Biotechnology (Dalian) Co., Ltd., Dalian China) were reverse-transcribed into cDNA using PrimeScript TM RT Master Mix (catalogue No. RR037A, TaKaRa), followed by real-time RT-PCR analysis with TB Green Premix Ex Taq (catalogue No. RR420A), according to the instructions of the manufacturer. The PCR program consisted of one cycle at 95 °C for 30 s, 40 cycles of denaturation at 95 °C for 5 s, followed by a 60 °C annealing step for 30 s. The expressions of selected genes relative to the housekeeping gene (β-actin) were analyzed according to the method of Livak and Schmittgen [21]. The primer sequences of the target genes are shown in Table 2: toll-like receptor 4 (TLR4), forkhead box O1 (FOXO1), forkhead box O4 (FOXO4), protein kinase B (Akt), MAFbx, MuRF1, mTOR, 4E-BP1, S6K1, and β-actin.

2.5. Statistical Analysis

Data analysis was conducted using a 2 × 2 factorial arrangement (SPSS version 20.0), and significant differences among different treatments were analyzed using two-factorial analysis of variance. The statistical model contained diet (1.2% Ala or 1.0% Gln) and intraperitoneal injection challenge (LPS or saline) and their interactions. p < 0.05 was considered significant. All values are shown as means and standard error of the mean.

3. Results

3.1. mRNA Expressions of TNF-α, IL-6, IL-1β in the Liver

As illustrated in Table 3, there were significant interactions for liver IL-6 and IL-1β mRNA expression between Gln addition and LPS challenge (p < 0.05). But, no interaction for TNF-α mRNA expression in liver was observed between Gln addition and LPS challenge (p > 0.05) In comparison with those receiving saline treatment, LPS challenge significantly increased the mRNA expression of TNF-α in the livers of the broilers (p < 0.05). Similarly, the IL-6 and IL-1β mRNA expressions in the livers of the broilers were also elevated by LPS challenge (p < 0.05). However, Gln supplementation decreased the increased expression of TNF-α in the liver. Moreover, Gln addition reversed the mRNA expressions of IL-6 and IL-1β in the livers of the broilers that were stimulated via LPS challenge (p < 0.05).

3.2. The Activities of ALT and AST in the Muscle of Broilers

As shown in Table 4, no interaction for the activities of AST or ALT was observed between the LPS treatment and Gln supplementation (p > 0.05). The activity of AST in the Pectoralis Major muscle of the broilers decreased with LPS administration in comparison with those treated with saline injection (p < 0.05). However, no difference in the activity of ALT in the Pectoralis Major muscle of the broilers was observed in the LPS treatment group (p > 0.05). In contrast, compared with the broilers fed an Ala-supplemented diet, dietary Gln supplementation significantly elevated the activity of AST in the Pectoralis Major muscle of the broilers (p < 0.05). But, Gln supplementation did not affect the activity of ALT in the Pectoralis Major muscle of the broilers (p > 0.05).

3.3. GS Activity and mRNA Expression of GA in the Pectoralis Major Muscle of Broilers

As presented in Figure 1, there were no interactions for GA mRNA expression between LPS challenge and Gln supplementation (p > 0.05). However, a significant trend was observed in the activity of GS between LPS challenge and Gln supplementation (p = 0.086). In comparison with the broilers receiving saline injection, LPS challenge significantly increased the activity of GS in the Pectoralis Major muscle of the broilers (p < 0.05). Meanwhile, the mRNA expressions of GA in the Pectoralis Major muscle of LPS-challenged broilers were also upregulated by LPS treatment (p < 0.05). However, Gln supplementation increased the activity of GS in the Pectoralis Major muscle of the broilers in comparison with those receiving diets supplemented with Ala (p < 0.05). But, the increased mRNA expression of GA was not affected by Gln supplementation (p > 0.05).

3.4. mTOR Signaling Molecules in the Pectoralis Major Muscle

There were no interactions for mTOR and S6K1 between LPS challenge and Gln supplementation (p > 0.05); however, a significant interaction for 4E-BP1 was observed between LPS challenge and Gln supplementation (p < 0.05). In comparison with the saline treatment, the LPS treatment significantly lowered the mRNA expressions of mTOR, 4E-BP1, and S6K1 in the Pectoralis Major muscle of the broilers (p < 0.05, Figure 2). However, compared with the broilers fed the Ala diet, the mRNA expressions of both mTOR and S6K1 in the broilers supplemented with Gln were elevated (p < 0.05). Moreover, diets supplemented with Gln reversed the reduction in the 4E-BP1 mRNA expression in the Pectoralis Major muscle of the broilers challenged with LPS stimuli (p < 0.05).

3.5. mRNA Expression of Akt/FOXO Signals Mediated by TLR4

As shown in Table 5, there were significant interactions for TLR4, FOXO1, and MuRF1 between the LPS challenge and Gln supplementation (p < 0.05). However, no interactions for Akt, FOXO4, or MAFbx were observed between the LPS challenge and Gln supplementation (p > 0.05). When compared with broilers receiving saline treatment, LPS challenge significantly decreased Akt mRNA expression, but increased the mRNA expressions of TLR4, FOXO4, FOXO1, MAFbx, and MuRF1 (p < 0.05). In contrast, compared with broilers fed the Ala diet, Gln supplementation upregulated the Akt mRNA expression and downregulated the mRNA expressions of FOXO4 and MAFbx (p < 0.05). In addition, diets supplemented with Gln reversed the increased mRNA expressions of TLR4, FOXO1, and MuRF1 in the Pectoralis Major muscle of the LPS-challenged broilers (p < 0.05).

4. Discussion

It has been demonstrated that LPS is a potential stimulant that triggers the release of proinflammatory cytokines [22,23]. The secretion of proinflammatory cytokines is crucial for activating the innate host defense system and subsequently regulating the adaptive immune response, such as IL-6, TNF-α, and IL-1β [24]. TNF-α, IL-6, and IL-1β, which originate from macrophages, are the major regulators of diverse inflammatory responses [5]. The results of our present study showed that LPS challenge increased the mRNA expressions of TNF-α, IL-6, and IL-1β in the liver, indicating that the LPS challenge induced an acute inflammatory response. It was demonstrated that the LPS challenge resulted in higher mRNA expressions of TNF-α, IL-6, and IL-1β in the liver of the broilers [25]. Similarly, increased mRNA expressions of IL-6 and IL-1β were observed in the LPS-challenged broilers [24]. The results of our previous study suggested that Gln supplementation decreased the contents of TNF-α, IL-6, and IL-1β in the plasma of LPS-challenged broilers [5]. In addition, Gln, serving as a neutral and multifunctional essential amino acid, is particularly prominent in the antistress response [13,26]. Moreover, it was proven that Gln deprivation exacerbated the production of proinflammatory cytokines, whereas Gln supplementation limited the inflammatory response in vitro [27]. The results mentioned above indicate that Gln supplementation might help to alleviate the inflammatory responses induced by LPS challenge.
Because the physiological demand for Gln exceeds its synthesis capacity under catabolic stresses, it becomes a conditionally essential amino acid [28]. Skeletal muscle plays an important role in Gln metabolism and is quantitatively the most relevant site for Gln stock, synthesis, and release [29]. The two intracellular enzymes are GS and GA, which are responsible for Gln synthesis and Gln hydrolysis, respectively [30]. It has been proven that there is a concomitant increase in GA expression under catabolic conditions such as sepsis and infections [31,32]. Similarly, in our present study, LPS administration significantly increased the mRNA expression of GA in the muscles of the broilers, suggesting that the LPS challenge accelerated Gln consumption. In addition, an increased GS enzyme activity in skeletal muscle was observed during severe catabolic states [30]. In accordance with this, our results also showed that LPS challenge elevated the activity of GS in the muscle. Moreover, Gln metabolism is influenced by glutamine aminotransferase. In this study, Gln supplementation increased the AST activity in the muscle. Consistent with our results, it was also reported that 1% Gln supplementation increased the AST activity in the muscle, associated with Gln metabolism [33]. However, Gln addition significantly decreased GA mRNA expression in the muscle, indicating that Gln supplementation might have compensated for the decline in Gln in the muscle under stress and partly contributed to inhibiting the catabolism of Gln.
It has been well documented that the mTOR signaling pathway is an evolutionally conserved protein kinase and is important in regulating protein synthesis. The activation of mTOR and its downstream regulators 4E-BP1 and S6K1 synergistically leads to the initiation of polypeptide formation [34]. But, mTOR signaling is inhibited by sepsis and endotoxin-related inflammation [35]. In the present study, we found that LPS challenge downregulated the mRNA expressions of mTOR, 4E-BP1, and S6K1 in the muscle. It was also reported that the expressions of mTOR, 4E-BP1, and S6K1 were inhibited in septic rats or animals treated with LPS [35], indicating that protein synthesis was inhibited by LPS challenge. Independent of LPS administration, increased mRNA expressions of mTOR, combined with 4E-BP1 and S6K1 in the muscle, were observed after Gln addition. In accordance with this, in our previous report, it was demonstrated that Gln supplementation ameliorated the growth performance of LPS-challenged broilers, evidenced by decreases in ADFI and ADG as well as the increase in F/G. It was reported that Gln addition increased the yield and weight of the breast muscle of broilers suffering from heat stress [36], indicating that Gln could contribute to ameliorating the development of breast muscle of broilers under stress conditions. In addition, it was demonstrated that Gln is required for the activation of mTOR signaling [37]. Similarly, in a previous study, Gln supplementation significantly elevated the protein expressions of mTOR, 4E-BP1, and S6K1 in skeletal muscle [28]. The addition of Gln to a medium stimulated protein synthesis through the mTOR signaling pathway [20]. The results mentioned above suggest that Gln contributes to promoting protein synthesis, associated with the activation of mTOR signaling.
The majority of intracellular proteins are degraded by the ubiquitin–proteasome pathway in all tissues [38], which contributes to 75% of protein degradation during skeletal muscle atrophy [39]. The activation of Akt and the inactivation of FOXO transcriptionally upregulated of the FOXO gene targets MAFbx and MuRF1 and subsequently induced muscle protein degradation [40]. TLR4 was also demonstrated to be a master regulator of the muscle wasting induced by endotoxemia [41]. The present study found that LPS challenge significantly decreased the mRNA expression of Akt and increased the mRNA expressions of TLR4, FOXO1, FOXO4, MAFbx, and MuRF1 in muscle. It was demonstrated that decreased Akt protein expression and increased mRNA expressions of MAFbx and MuRF1 occurred in response to LPS-induced endotoxemia [42]. Furthermore, in a previous study, it was demonstrated that increased mRNA expressions of FOXO1 and FOXO4, combined with increased MAFbx and MuRF1 mRNA expressions, were induced by LPS challenge [7]. Similarly, in a previous study about LPS-administered rats, it was demonstrated that LPS challenge downregulated Akt expression and upregulated MAFbx and MuRF1 in skeletal muscle [40]. Currently, Gln was also shown to be an amino acid involved in the regulation of autophagy [43]. It was proven that Gln administration inhibited the protein degradation of intestinal epithelial cells [20]. Our results also showed that Gln addition increased the Akt mRNA expression and lowered the mRNA expression of MAFbx and MuRF1, which are associated with protein degradation. Moreover, in our previous study using piglets, alanyl-glutamine (a dipeptide of Gln) supplementation decreased mRNA expressions of both MAFbx and MuRF1 in skeletal muscle under normal and LPS conditions [7,28]. In addition, Gln administration induced reduced mRNA expressions of MAFbx and MuRF1, and the loss in the skeletal muscle mass was alleviated partially by Gln supplementation [44]. Therefore, based on the results mentioned above, we speculate that Gln supplementation could contribute to inhibiting the protein degradation in skeletal muscle via the TLR4/Akt/UPP signaling pathway.

5. Conclusions

In summary, Gln supplementation alleviated inflammatory responses in the livers of LPS-challenged broilers. Moreover, Gln supplementation increased the expressions of the signaling molecules in the mTOR and Akt/FOXO/UPP pathways, indicating that Gln addition might contribute to promoting protein synthesis and inhibiting protein degradation of LPS-challenged broilers.

Author Contributions

Conceptualization, B.Z. and Z.S.; methodology, Q.Y. and N.L.; investigation, Q.Y. and N.L.; data curation, Q.Y. and N.L.; writing-original draft preparation, B.Z., Q.Y. and N.L. writing-review and editing, Q.Z. and Z.S. project administration, B.Z. and Z.S.; funding acquisition, B.Z. All authors have read and agreed to the published version of the manuscript.

Funding

This work was supported by the Basic Project of Guizhou Provincial Natural Science Foundation (Qian Kehe jichu-ZK (2022) Yiban 578) and Characteristic Laboratory of Animal Resources Conservation and Utilization of Chishui River Basin (Qianjiaohe KY [2013]111-03).

Institutional Review Board Statement

The animal study protocol was approved by the Institutional Ethics Committee of Zunyi Normal College (Zunshi2018[08] and 20220515).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Liu, K.; Zhen, W.; Bai, D.; Tan, H.; He, X.; Li, Y.; Liu, Y.; Zhang, Y.; Ito, K.; Zhang, B.; et al. Lipopolysaccharide-induced immune stress negatively regulates broiler chicken growth the COX-2-PGE-EP4 signaling pathway. Front. Immunol. 2023, 14, 1193798. [Google Scholar] [CrossRef] [PubMed]
  2. Bi, S.; Shao, J.; Qu, Y.; Hu, W.; Ma, Y.; Cao, L. Hepatic transcriptomics and metabolomics indicated pathways associated with immune stress of broilers induced by lipopolysaccharide. Poult. Sci. 2022, 101, 102199. [Google Scholar] [CrossRef] [PubMed]
  3. Wu, Y.; Li, Q.; Liu, J.; Liu, Y.; Xu, Y.; Zhang, R.; Yu, Y.; Wang, Y.; Yang, C. Integrating Serum Metabolome and Gut Microbiome to Evaluate the Benefits of Lauric Acid on Lipopolysaccharide-Challenged Broilers. Front. Immunol. 2021, 12, 759323. [Google Scholar] [CrossRef]
  4. Lee, Y.; Lee, S.-H.; Gadde, U.D.; Oh, S.-T.; Lillehoj, H.S. Dietary Allium hookeri reduces inflammatory response and increases expression of intestinal tight junction proteins in LPS-induced young broiler chicken. Res. Vet. Sci. 2017, 112, 149–155. [Google Scholar] [CrossRef] [PubMed]
  5. Zhang, B.; Zhong, Q.; Liu, N.; Song, P.; Zhu, P.; Zhang, C.; Sun, Z. Dietary Glutamine Supplementation Alleviated Inflammation Responses and Improved Intestinal Mucosa Barrier of LPS-Challenged Broilers. Animals 2022, 12, 1729. [Google Scholar] [CrossRef]
  6. Orellana, R.A.; Suryawan, A.; Wilson, F.A.; Gazzaneo, M.C.; Fiorotto, M.L.; Nguyen, H.V.; Davis, T.A. Development aggravates the severity of skeletal muscle catabolism induced by endotoxemia in neonatal pigs. Am. J. Physiol. Regul. Integr. Comp. Physiol. 2012, 302, R682–R690. [Google Scholar] [CrossRef]
  7. Zhang, B.L.; Yu, C.N.; Lin, M.; Fu, Y.N.; Zhang, L.; Meng, M.J.; Xing, S.; Li, J.L.; Sun, H.; Gao, F. Regulation of skeletal muscle protein synthetic and degradative signaling by alanyl-glutamine in piglets challenged with Escherichia coli lipopolysaccharide. Nutrition 2015, 31, 749–756. [Google Scholar] [CrossRef]
  8. Jagoe, R.T.; Goldberg, A.L. What do we really know about the ubiquitin-proteasome pathway in muscle atrophy? Curr. Opin. Clin. Nutr. Metab. Care 2001, 4, 183–190. [Google Scholar] [CrossRef]
  9. A Orellana, R.; Kimball, S.R.; Nguyen, H.V.; A Bush, J.; Suryawan, A.; Thivierge, M.C.; Jefferson, L.S.; A Davis, T. Regulation of muscle protein synthesis in neonatal pigs during prolonged endotoxemia. Pediatr. Res. 2004, 55, 442–449. [Google Scholar] [CrossRef]
  10. Orellana, R.A.; O’Connor, P.M.J.; Nguyen, H.V.; Bush, J.A.; Suryawan, A.; Thivierge, M.C.; Fiorotto, M.L.; Davis, T.A. Endotoxemia reduces skeletal muscle protein synthesis in neonates. Am. J. Physiol. Endocrinol. Metab. 2002, 283, E909–E916. [Google Scholar] [CrossRef]
  11. Liu, Y.; Chen, F.; Odle, J.; Lin, X.; Zhu, H.; Shi, H.; Hou, Y.; Yin, J. Fish oil increases muscle protein mass and modulates Akt/FOXO, TLR4, and NOD signaling in weanling piglets after lipopolysaccharide challenge. J. Nutr. 2013, 143, 1331–1339. [Google Scholar] [CrossRef] [PubMed]
  12. Dai, S.; Wen, A.; Wang, L.; Jin, G. Dietary glutamine supplementation improves growth performance, meat quality and colour stability of broilers under heat stress. Br. Poult. Sci. 2009, 50, 333–340. [Google Scholar] [CrossRef] [PubMed]
  13. Bai, X.; Wang, K.; Khan, R.U.; Zhang, C.; Hu, H. Effect of Glutamine on the Growth Performance, Oxidative Stress, and Nrf2/p38 MAPK Expression in the Livers of Heat-Stressed Broilers. Animals 2023, 13, 652. [Google Scholar] [CrossRef] [PubMed]
  14. Wu, Q.J.; Zhu, D.D.; Wang, D.D.; Zhang, B.B.; Ren, A.; Bin Zhang, Z. Effects of dietary supplementation with glutamine on the lymphocyte proliferation and intestinal immune gene expression in broiler chickens infected with Salmonella Enteritidis. Res. Vet. Sci. 2021, 139, 18–24. [Google Scholar] [CrossRef] [PubMed]
  15. Zhang, B.; Liu, N.; Hao, M.; Xie, Y.; Song, P. Effects of substitution of soybean meal with rapeseed meal and glutamine supplementation on growth performance, intestinal morphology, and intestinal mucosa barrier of Qiandongnan Xiaoxiang Chicken. Anim. Biosci. 2022, 35, 1711–1724. [Google Scholar] [CrossRef] [PubMed]
  16. Xing, S.; Zhang, B.; Lin, M.; Zhou, P.; Li, J.; Zhang, L.; Gao, F.; Zhou, G. Effects of alanyl-glutamine supplementation on the small intestinal mucosa barrier in weaned piglets. Asian-Australas. J. Anim. Sci. 2017, 30, 236–245. [Google Scholar] [CrossRef] [PubMed]
  17. Xue, G.; Barekatain, R.; Wu, S.; Choct, M.; Swick, R. Dietary L-glutamine supplementation improves growth performance, gut morphology, and serum biochemical indices of broiler chickens during necrotic enteritis challenge. Poult. Sci. 2018, 97, 1334–1341. [Google Scholar] [CrossRef] [PubMed]
  18. Zhou, J.; Chen, H.; Du, J.; Tai, H.; Han, X.; Huang, N.; Wang, X.; Gong, H.; Yang, M.; Xiao, H. Glutamine Availability Regulates the Development of Aging Mediated by mTOR Signaling and Autophagy. Front. Pharmacol. 2022, 13, 924081. [Google Scholar] [CrossRef]
  19. Yi, D.; Hou, Y.; Wang, L.; Ouyang, W.; Long, M.; Zhao, D.; Ding, B.; Liu, Y.; Wu, G. L-Glutamine enhances enterocyte growth via activation of the mTOR signaling pathway independently of AMPK. Amino Acids 2015, 47, 65–78. [Google Scholar] [CrossRef]
  20. Xi, P.; Jiang, Z.; Dai, Z.; Li, X.; Yao, K.; Zheng, C.; Lin, Y.; Wang, J.; Wu, G. Regulation of protein turnover by L-glutamine in porcine intestinal epithelial cells. J. Nutr. Biochem. 2012, 23, 1012–1017. [Google Scholar] [CrossRef]
  21. Livak, K.J.; Schmittgen, T.D. Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2−ΔΔCt Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  22. Wu, Q.J.; Wang, Y.Q.; Qi, Y.X. Influence of procyanidin supplementation on the immune responses of broilers challenged with lipopolysaccharide. Anim. Sci. J. 2017, 88, 983–990. [Google Scholar] [CrossRef] [PubMed]
  23. Ramires, C.C.; Balbinot, D.T.; Cidral-Filho, F.J.; Dias, D.V.; dos Santos, A.R.; da Silva, M.D. Acupuncture reduces peripheral and brainstem cytokines in rats subjected to lipopolysaccharide-induced inflammation. Acupunct. Med. 2021, 39, 376–384. [Google Scholar] [CrossRef] [PubMed]
  24. Yang, L.; Liu, G.; Zhu, X.; Luo, Y.; Shang, Y.; Gu, X.-L. The anti-inflammatory and antioxidant effects of leonurine hydrochloride after lipopolysaccharide challenge in broiler chicks. Poult. Sci. 2019, 98, 1648–1657. [Google Scholar] [CrossRef] [PubMed]
  25. Yang, L.; Liu, G.; Liang, X.; Wang, M.; Zhu, X.; Luo, Y.; Shang, Y.; Yang, J.Q.; Zhou, P.; Gu, X.L. Effects of berberine on the growth performance, antioxidative capacity and immune response to lipopolysaccharide challenge in broilers. Anim. Sci. J. 2019, 90, 1229–1238. [Google Scholar] [CrossRef] [PubMed]
  26. Sifa, D.; Bai, X.; Zhang, D.; Hu, H.; Wu, X.; Wen, A.; He, S.; Zhao, L. Dietary glutamine improves meat quality, skeletal muscle antioxidant capacity and glutamine metabolism in broilers under acute heat stress. J. Appl. Anim. Res. 2018, 46, 1412–1417. [Google Scholar] [CrossRef]
  27. Achamrah, N.; Déchelotte, P.; Coëffier, M. Glutamine and the regulation of intestinal permeability: From bench to bedside. Curr. Opin. Clin. Nutr. Metab. Care 2017, 20, 86–91. [Google Scholar] [CrossRef] [PubMed]
  28. Zhang, B.; Lin, M.; Yu, C.; Li, J.; Zhang, L.; Zhou, P.; Yang, W.; Gao, F.; Zhou, G. Alanyl-glutamine supplementation regulates mTOR and ubiquitin proteasome proteolysis signaling pathways in piglets. Nutrition 2016, 32, 1123–1131. [Google Scholar] [CrossRef] [PubMed]
  29. Newsholme, E.; Parry-Billings, M. Properties of glutamine release from muscle and its importance for the immune system. J. Parenter. Enter. Nutr. 1990, 14, 63S–67S. [Google Scholar] [CrossRef]
  30. Cruzat, V.; Macedo Rogero, M.; Keane, K.N.; Curi, R.; Newsholme, P. Glutamine: Metabolism and Immune Function, Supplementation and Clinical Translation. Nutrients 2018, 10, 1564. [Google Scholar] [CrossRef]
  31. Labow, B.I.; Souba, W.W.; Abcouwer, S.F. Mechanisms governing the expression of the enzymes of glutamine metabolism--glutaminase and glutamine synthetase. J. Nutr. 2001, 131, 2467S–2474S. [Google Scholar] [CrossRef]
  32. Karinch, A.M.; Pan, M.; Lin, C.-M.; Strange, R.; Souba, W.W. Glutamine metabolism in sepsis and infection. J. Nutr. 2001, 131, 2535S–2538S. [Google Scholar] [CrossRef]
  33. Xiao, Y.P.; Li, X.Y.; Wu, T.X.; Yang, L.; Hong, Q.H.; Yang, C.M.; Chen, A.G. Effects of dietary glutamine supplementation on nutrient absorption and activity of enzymes involved in glutamine metabolism and energy production in the jejunum of weaned piglets. J. Anim. Vetrinary Adv. 2012, 11, 1441–1449. [Google Scholar] [CrossRef]
  34. Cao, Y.; Liu, S.; Liu, K.; Abbasi, I.H.R.; Cai, C.; Yao, J. Molecular mechanisms relating to amino acid regulation of protein synthesis. Nutr. Res. Rev. 2019, 32, 183–191. [Google Scholar] [CrossRef]
  35. Frost, R.A.; Lang, C.H. mTOR signaling in skeletal muscle during sepsis and inflammation: Where does it all go wrong? Physiology 2011, 26, 83–96. [Google Scholar] [CrossRef]
  36. Dai, S.F.; Gao, F.; Zhang, W.H.; Song, S.X.; Xu, X.L.; Zhou, G.H. Effects of dietary glutamine and gamma-aminobutyric acid on performance, carcass characteristics and serum parameters in broilers under circular heat stres. Anim. Feed. Sci. Technol. 2011, 168, 51–60. [Google Scholar] [CrossRef]
  37. Nicklin, P.; Bergman, P.; Zhang, B.; Triantafellow, E.; Wang, H.; Nyfeler, B.; Yang, H.; Hild, M.; Kung, C.; Wilson, C.; et al. Bidirectional transport of amino acids regulates mTOR and autophagy. Cell 2009, 136, 521–534. [Google Scholar] [CrossRef] [PubMed]
  38. Lecker, S.H.; Goldberg, A.L.; Mitch, W.E. Protein degradation by the ubiquitin-proteasome pathway in normal and disease states. J. Am. Soc. Nephrol. 2006, 17, 1807–1819. [Google Scholar] [CrossRef]
  39. A Franch, H.; Price, S.R. Molecular signaling pathways regulating muscle proteolysis during atrophy. Curr. Opin. Clin. Nutr. Metab. Care 2005, 8, 271–275. [Google Scholar] [CrossRef] [PubMed]
  40. Crossland, H.; Constantin-Teodosiu, D.; Gardiner, S.M.; Constantin, D.; Greenhaff, P.L. A potential role for Akt/FOXO signalling in both protein loss and the impairment of muscle carbohydrate oxidation during sepsis in rodent skeletal muscle. J. Physiol. 2008, 586, 5589–5600. [Google Scholar] [CrossRef]
  41. Doyle, A.; Zhang, G.; Fattah, E.A.A.; Eissa, N.T.; Li, Y.-P. Toll-like receptor 4 mediates lipopolysaccharide-induced muscle catabolism via coordinate activation of ubiquitin-proteasome and autophagy-lysosome pathways. FASEB 2011, 25, 99–110. [Google Scholar] [CrossRef] [PubMed]
  42. Crossland, H.; Constantin-Teodosiu, D.; Greenhaff, P.L.; Gardiner, S.M. Low-dose dexamethasone prevents endotoxaemia-induced muscle protein loss and impairment of carbohydrate oxidation in rat skeletal muscle. J. Physiol. 2010, 588, 1333–1347. [Google Scholar] [CrossRef] [PubMed]
  43. Tan, H.W.S.; Sim, A.Y.L.; Long, Y.C. Glutamine metabolism regulates autophagy-dependent mTORC1 reactivation during amino acid starvation. Nat. Commun. 2017, 8, 338. [Google Scholar] [CrossRef]
  44. Lambertucci, A.C.; Lambertucci, R.H.; Hirabara, S.M.; Curi, R.; Moriscot, A.S.; Alba-Loureiro, T.C.; Guimarães-Ferreira, L.; Levada-Pires, A.C.; Vasconcelos, D.A.A.; Sellitti, D.F.; et al. Glutamine supplementation stimulates protein-synthetic and inhibits protein-degradative signaling pathways in skeletal muscle of diabetic rats. PLoS ONE 2012, 7, e50390. [Google Scholar] [CrossRef] [PubMed]
Animals 14 00480 g001
Figure 1. Effects of Gln supplementation on GS activity (A) and GA mRNA expression (B) in muscle of 21-day-old LPS-challenged broilers. GS, glutamine synthetase; GA, glutaminase; Ala, alanine; Gln, glutamine; LPS, lipopolysaccharide. Values are means ± SEM, n = 10.
Figure 1. Effects of Gln supplementation on GS activity (A) and GA mRNA expression (B) in muscle of 21-day-old LPS-challenged broilers. GS, glutamine synthetase; GA, glutaminase; Ala, alanine; Gln, glutamine; LPS, lipopolysaccharide. Values are means ± SEM, n = 10.
Animals 14 00480 g001
Animals 14 00480 g002
Figure 2. Effects of Gln supplementation on mRNA expressions of mTOR (A), 4E-BP1 (B), and S6K1 (C) in muscle of 21-day-old LPS-challenged broilers. mTOR, mammalian target of rapamycin; S6K1, ribosomal protein S6 kinase; 4E-BP1, eIF-4E binding protein-1; Ala, alanine; Gln, glutamine; LPS, lipopolysaccharide. Values are means ± SEM, n = 10. Different superscripts above the column denote differences, p < 0.05.
Figure 2. Effects of Gln supplementation on mRNA expressions of mTOR (A), 4E-BP1 (B), and S6K1 (C) in muscle of 21-day-old LPS-challenged broilers. mTOR, mammalian target of rapamycin; S6K1, ribosomal protein S6 kinase; 4E-BP1, eIF-4E binding protein-1; Ala, alanine; Gln, glutamine; LPS, lipopolysaccharide. Values are means ± SEM, n = 10. Different superscripts above the column denote differences, p < 0.05.
Animals 14 00480 g002
Table 1. Ingredients and nutrient content of the basal diets.
Table 1. Ingredients and nutrient content of the basal diets.
Ingredients (g/kg Diet) Nutrient Content (g/kg Diet)
Maize563.0Crude protein ‡210.8
Wheat bran51.30Metabolism energy (MJ/kg)121.2
Soybean meal285.0Calcium (%)10.00
Corn gluten meal43.0Phosphorus (%)4.50
DL-methionine1.50DL-methionine (%)8.60
Phytase0.40L-Lysine (%)10.60
Choline1.50Threonine (%)8.0
Dicalcium phosphate18.70
Limestone12.60
Salt1.50
Soybean oil16.50
Vitamin and mineral premix †5.00
† Premix per kg diet provided: vitamin A 12,000 IU; vitamin D3 2500 IU; vitamin E 30 mg; menadione 2.8 mg; thiamin 2.21 mg; riboflavin 7.8 mg; nicotinamide 40 mg; calcium pantothenate 10 mg; pyridoxine·HCl 4 mg; biotin 0.04 mg; folic acid 1.2 mg; Vitamin B12 0.015 mg; Fe 80 mg; Cu 8 mg; Mn 110 mg; Zn 65 mg; I 0.35 mg; Se 0.3 mg. ‡ Nutrient contents of the diets are the measured values.
Table 2. Primer sequences for RT-PCR analysis.
Table 2. Primer sequences for RT-PCR analysis.
GenesIDPrimer Sequences (5′-3′)Product Size (bp)
MAFbxNM_001030956.1F: GCCAGTACCACTTCACAGACAGAC
R: GCGTGTCACCATACTGCTCCTTC		132
MuRF1XM_424369.4F: GAACGACCGCATCCAGACCATC
R: TCCGTCTTCTTCTCCTCCAGCAG		138
FOXO1NM_204328.1F: GACCTCATCACCAAGGCCATCG
R: GCACGCTCTTGACCATCCACTA		85
AktNM_205055.1F: GGCTACAAGGAACGACCGCAAG
R: TACTGTGGTCCACTGGAGGCATC		141
TLR4NM_001030693.1F: TTCGGTTGGTGGACCTGAATCTTG
R: ACAGCTTCTCAGCAGGCAATTCC		114
GANM_001031248.1F: TCCTCGCAGAGAAGGTGGTGATC
R: TACGTGCAATGCTGTTCGTGAGTC		154
S6K1NM_001030721.1F: GTTCAGGCTCACCCGTTCTTCAG
R: TGGCTCACATCCTCTTCAGATTGC		107
FOXO4XM_015278657.2F: CAACGTTCCACCACCCGTGA
R: TGGAGGCAGATTGCTGGGTA		101
TNF-αNM_204267.1F: TGTGTATGTGCAGCAACCCG
R: AACAACCAGCTATGCACCCC		178
mTORXM_417614.6F: AACCACTGCTCGCCACAATGC
R: CATAGGATCGCCACACGGATTAGC		120
4E-BP1XM_424384.6F: GACCGTAAGTTCCTGATGGAGTGC
R: ATTGGGCTGGTAACACCTGGAATG		92
IL-1βNM_204524.1F: AAGCCTCGCCTGGATTCTAG
R: TCAGGTCGCTGTCAGCAAAG		90
IL-6NM_204628.1F: TCCCTCCTCGCCAATCTGAA
R: AAATAGCGAACGGCCCTCAC		80
β-actinNM_205518.1F: ATTGTCCACCGCAAATGCTTC
R: AAATAAAGCCATGCCAATCTCGTC		113
MAFbx, muscle atrophy F-box; MuRF1, muscle ring finger 1; FOXO1, forkhead box O1; Akt, protein kinase B, also named PKB; TLR4, toll-like receptor 4; GA, glutaminase; S6K1, ribosomal protein S6 kinase; FOXO4, forkhead box O4; TNF-α, tumor necrosis factor-α; mTOR, mammalian target of rapamycin; 4E-BP1, eIF-4E binding protein-1; IL-1β: interleukin-1β; IL-6: interleukin-6.
Table 3. Effects of glutamine supplementation on the mRNA expressions of TNF-α (A), IL-6 (B) and IL-1β (C) in the livers of LPS-challenged 21-day-old broilers.
Table 3. Effects of glutamine supplementation on the mRNA expressions of TNF-α (A), IL-6 (B) and IL-1β (C) in the livers of LPS-challenged 21-day-old broilers.
TreatmentTNF-αIL-6IL-1β
Ala-saline1.151.04 bc1.00 b
Ala-LPS1.871.48 a1.76 a
Gln-saline0.520.98 c0.69 c
Gln-LPS1.461.18 b1.03 b
SEM0.1080.0440.084
Main effect
Diet
Ala1.51 a 1.26 a 1.38 a
Gln0.99 b1.08 b0.86 b
Stress
Saline0.84 b1.01 b0.85 b
LPS1.67 a1.33 a 1.40 a
p-value
Gln<0.001<0.001<0.001
LPS<0.001<0.001<0.001
Gln × LPS0.1170.005<0.001
TNF-α, tumor necrosis factor-α; IL-1β: interleukin-1β; IL-6: interleukin-6; Ala, alanine; Gln, glutamine; LPS, lipopolysaccharide. Values are means ± SEM, n = 10. Different superscripts above the column denote differences, p < 0.05.
Table 4. Effects of Gln supplementation on the activities of ALT and AST in muscle of LPS-challenged 21-day-old broilers.
Table 4. Effects of Gln supplementation on the activities of ALT and AST in muscle of LPS-challenged 21-day-old broilers.
TreatmentALT (u/g of Protein)AST (u/g of Protein)
Ala-saline2.9322.97
Ala-LPS2.4316.49
Gln-saline3.0527.79
Gln-LPS2.6824.63
SEM0.5424.587
Main effect
Diet
Ala2.6819.73 b
Gln2.8726.21 a
Stress
Saline2.9925.38 a
LPS2.5620.56 b
p-value
Gln0.603<0.001
LPS0.2360.002
Gln × LPS0.8480.160
ALT, alanine aminotransferase; AST, aspartate aminotransferase; Ala, alanine; Gln, glutamine; LPS, lipopolysaccharide. Values are means and SEM, n = 10. Different superscripts in an array denote differences, p < 0.05.
Table 5. Effects of Gln supplementation on mRNA expressions of protein-degradation-related genes in the muscles of 21-day-old LPS-challenged broilers.
Table 5. Effects of Gln supplementation on mRNA expressions of protein-degradation-related genes in the muscles of 21-day-old LPS-challenged broilers.
TreatmentTLR4AktFOXO4FOXO1MAFbxMuRF1
Ala-Saline1.00 c1.000.991.04 b1.01.07 c
Ala-LPS1.43 a0.591.422.93 a1.42.81 a
Gln-Saline0.86 d1.390.920.94 b0.691.03 c
Gln-LPS1.01 b0.961.111.28 b1.141.47 b
SEM0.2340.3010.2490.8680.2920.762
Main Effect
Diet
Ala1.22 a0.80 b1.21 a1.99 a1.29 a1.94 a
Gln0.94 b1.18 a1.02 b1.11 b0.92 b1.25 b
Stress
Saline0.93 b1.20 a0.96 b0.99 b0.89 b1.05 b
LPS1.22 a0.78 b1.27 a2.11 a1.32 a2.14 a
p Value
Gln<0.001<0.001<0.001<0.001<0.001<0.001
LPS<0.001<0.001<0.001<0.001<0.001<0.001
Gln × LPS0.0020.9320.091<0.0010.266<0.001
TLR4: toll-like receptor 4; Akt: protein kinase B; FOXO4: forkhead box O 4; FOXO1: forkhead box O 1; MAFbx: muscle atrophy F-box; MuRF1: muscle ring finger 1; Ala, alanine; Gln, glutamine; LPS, lipopolysaccharide. Values are means ± SEM, n = 10. Different superscripts in an array denote differences, p < 0.05.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Zhang, B.; Yang, Q.; Liu, N.; Zhong, Q.; Sun, Z. The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers. Animals 2024, 14, 480. https://doi.org/10.3390/ani14030480

AMA Style

Zhang B, Yang Q, Liu N, Zhong Q, Sun Z. The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers. Animals. 2024; 14(3):480. https://doi.org/10.3390/ani14030480

Chicago/Turabian Style

Zhang, Bolin, Qian Yang, Ning Liu, Qingzhen Zhong, and Zewei Sun. 2024. "The Effects of Glutamine Supplementation on Liver Inflammatory Response and Protein Metabolism in Muscle of Lipopolysaccharide-Challenged Broilers" Animals 14, no. 3: 480. https://doi.org/10.3390/ani14030480

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop