Exploring the Sheep MAST4 Gene Variants and Their Associations with Litter Size
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Animals and Data
2.3. Genomic DNA Extraction
2.4. Primer Design and PCR-Based Genotyping
2.5. Whole-Genome Sequences (WGS) Data and Bioinformatic Analysis
2.6. Statistical Analyses
3. Results
3.1. Indel Genotyping and Sequencing
3.2. Genotypic c and Allelic Frequencies
3.3. Linkage Disequilibrium
3.4. Association of the MAST4 Gene with Litter Size in AUW Sheep
4. Discussion
5. Conclusions
Author Contributions
Funding
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Tao, L.; Wang, X.; Zhong, Y.; Liu, Q.; Xia, Q.; Chen, S.; He, X.; Di, R.; Chu, M. Combined approaches identify known and novel genes associated with sheep litter size and non-seasonal breeding. Anim. Genet. 2021, 52, 857–867. [Google Scholar] [CrossRef] [PubMed]
- Taberlet, P.; Coissac, E.; Pansu, J.; Pompanon, F. Conservation genetics of cattle, sheep, and goats. Comptes Rendus Biol. 2011, 334, 247–254. [Google Scholar] [CrossRef] [PubMed]
- Pulina, G.; Milán, M.J.; Lavín, M.P.; Theodoridis, A.; Morin, E.; Capote, J.; Thomas, D.L.; Francesconi, A.H.D.; Caja, G. Invited review: Current production trends, farm structures, and economics of the dairy sheep and goat sectors. J. Dairy. Sci. 2018, 101, 6715–6729. [Google Scholar] [CrossRef] [PubMed]
- Cleland, J. World Population Growth; Past, Present and Future. Environ. Resour. Econ. 2013, 55, 543–554. [Google Scholar] [CrossRef]
- El Abbadi, S.H.; Criddle, C.S. Engineering the Dark Food Chain. Environ. Sci. Technol. 2019, 53, 2273–2287. [Google Scholar] [CrossRef] [PubMed]
- La, Y.; He, X.; Zhang, L.; Di, R.; Wang, X.; Gan, S.; Zhang, X.; Zhang, J.; Hu, W.; Chu, M. Comprehensive Analysis of Differentially Expressed Profiles of mRNA, lncRNA, and circRNA in the Uterus of Seasonal Reproduction Sheep. Genes 2020, 11, 301. [Google Scholar] [CrossRef] [PubMed]
- Chong, Y.; Liu, G.; Jiang, X. Effect of BMPRIB gene on litter size of sheep in China: A meta-analysis. Anim. Reprod. Sci. 2019, 210, 106175. [Google Scholar] [CrossRef] [PubMed]
- Zonaed Siddiki, A.M.A.M.; Miah, G.; Islam, M.S.; Kumkum, M.; Rumi, M.H.; Baten, A.; Hossain, M.A. Goat Genomic Resources: The Search for Genes Associated with Its Economic Traits. Int. J. Genom. 2020, 2020, 5940205. [Google Scholar] [CrossRef]
- Abd El-Hack, M.E.; Abdelnour, S.A.; Swelum, A.A.; Arif, M. The application of gene marker-assisted selection and proteomics for the best meat quality criteria and body measurements in Qinchuan cattle breed. Mol. Biol. Rep. 2018, 45, 1445–1456. [Google Scholar] [CrossRef]
- Dekkers, J.C. Commercial application of marker- and gene-assisted selection in livestock: Strategies and lessons. J. Anim. Sci. 2004, 82 (Suppl. 13), E313–E328. [Google Scholar]
- Wang, J.T.; Wang, G.S.; Gong, Y.F.; Qiao, X.; Li, X.; Wang, G.Z.; Zheng, Y.Z.; Lv, J.G.; Li, X.L.; Liu, Z.Z. Screening of three-way crossbred combination and genetic effect analysis of the SNP in the CLPG gene in meat sheep. Arch. Anim. Breed. 2022, 65, 417–426. [Google Scholar] [CrossRef] [PubMed]
- Uchida, K.; Scarborough, E.A.; Prosser, B.L. Cardiomyocyte Microtubules: Control of Mechanics, Transport, and Remodeling. Annu. Rev. Physiol. 2022, 84, 257–283. [Google Scholar] [CrossRef]
- Tsuji, C.; Dodding, M.P. Lumenal components of cytoplasmic microtubules. Biochem. Soc. Trans. 2022, 50, 1953–1962. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Gu, S.; Li, X.; Sun, Y.; Zheng, D.; Yu, K.; Ji, C.; Tang, R.; Xie, Y.; Mao, Y. Identification of a novel human MAST4 gene, a new member of the microtubule associated serine-threonine kinase family. Mol. Biol. 2006, 40, 808–815. (In Russian) [Google Scholar] [CrossRef]
- Landoulsi, Z.; Laatar, F.; Noé, E.; Mrabet, S.; Ben Djebara, M.; Achaz, G.; Nava, C.; Baulac, S.; Kacem, I.; Gargouri-Berrechid, A.; et al. Clinical and genetic study of Tunisian families with genetic generalized epilepsy: Contribution of CACNA1H and MAST4 genes. Neurogenetics 2018, 19, 165–178. [Google Scholar] [CrossRef]
- Zhang, X.; Xiao, N.; Cao, Y.; Peng, Y.; Lian, A.; Chen, Y.; Wang, P.; Gu, W.; Xiao, B.; Yu, J.; et al. De novo variants in MAST4 related to neurodevelopmental disorders with developmental delay and infantile spasms: Genotype-phenotype association. Front. Mol. Neurosci. 2023, 16, 1097553. [Google Scholar] [CrossRef]
- Lee, S.J.; Kim, K.H.; Lee, D.J.; Kim, P.; Park, J.; Kim, S.J.; Jung, H.S. MAST4 controls cell cycle in spermatogonial stem cells. Cell Prolif. 2023, 56, e13390. [Google Scholar] [CrossRef]
- Cui, Y.; Wang, F.; Zhang, D.; Huang, J.; Yang, Y.; Xu, J.; Gao, Y.; Ding, H.; Qu, Y.; Zhang, W.; et al. Estrogen-Responsive Gene MAST4 Regulates Myeloma Bone Disease. J. Bone Miner. Res. 2022, 37, 711–723. [Google Scholar] [CrossRef]
- MacArthur Clark, J.A.; Sun, D. Guidelines for the ethical review of laboratory animal welfare People’s Republic of China National Standard GB/T 35892-2018 [Issued 6 February 2018 Effective from 1 September 2018]. Anim. Models Exp. Med. 2020, 3, 103–113. [Google Scholar] [CrossRef]
- Li, R.; Gong, M.; Zhang, X.; Wang, F.; Liu, Z.; Zhang, L.; Yang, Q.; Xu, Y.; Xu, M.; Zhang, H.; et al. A sheep pangenome reveals the spectrum of structural variations and their effects on tail phenotypes. Genome Res. 2023, 33, 463–477. [Google Scholar] [CrossRef]
- Köchl, S.; Niederstätter, H.; Parson, W. DNA extraction and quantitation of forensic samples using the phenol-chloroform method and real-time PCR. Methods Mol. Biol. 2005, 297, 13–30. [Google Scholar]
- Akhatayeva, Z.; Li, H.; Mao, C.; Cheng, H.; Zhang, G.; Jiang, F.; Meng, X.; Yao, Y.; Lan, X.; Song, E.; et al. Detecting novel Indel variants within the GHR gene and their associations with growth traits in Luxi Blackhead sheep. Anim. Biotechnol. 2022, 33, 214–222. [Google Scholar] [CrossRef]
- Kizilaslan, M.; Arzik, Y.; White, S.N.; Piel, L.M.W.; Cinar, M.U. Genetic Parameters and Genomic Regions Underlying Growth and Linear Type Traits in Akkaraman Sheep. Genes 2022, 13, 1414. [Google Scholar] [CrossRef]
- Ma, S.; Ji, X.; Cang, M.; Wang, J.; Yu, H.; Liu, Y.; Zhang, W.; Wu, Y.; Zhao, S.; Cao, G.; et al. Association analysis between novel variants in LEPR gene and litter size in Mongolia and ujimqin sheep breeds. Theriogenology 2022, 183, 79–89. [Google Scholar] [CrossRef]
- DeWoody, J.A.; Harder, A.M.; Mathur, S.; Willoughby, J.R. The long-standing significance of genetic diversity in conservation. Mol. Ecol. 2021, 30, 4147–4154. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; He, S.; Chen, L.; Li, W.; Di, J.; Liu, M. Estimates of linkage disequilibrium and effective population sizes in Chinese Merino (Xinjiang type) sheep by genome-wide SNPs. Genes Genom. 2017, 39, 733–745. [Google Scholar] [CrossRef] [PubMed]
- Fayomi, A.P.; Orwig, K.E. Spermatogonial stem cells and spermatogenesis in mice, monkeys and men. Stem Cell Res. 2018, 29, 207–214. [Google Scholar] [CrossRef] [PubMed]
- Phillips, B.T.; Gassei, K.; Orwig, K.E. Spermatogonial stem cell regulation and spermatogenesis. Philos. Trans. R. Soc. B Biol. Sci. 2010, 365, 1663–1678. [Google Scholar] [CrossRef] [PubMed]
- Buss, C.E.; Afonso, J.; de Oliveira, P.S.N.; Petrini, J.; Tizioto, P.C.; Cesar, A.S.M.; Gustani-Buss, E.C.; Cardoso, T.F.; Rovadoski, G.A.; da Silva Diniz, W.J.; et al. Bivariate GWAS reveals pleiotropic regions among feed efficiency and beef quality-related traits in Nelore cattle. Mamm. Genome 2023, 34, 90–103. [Google Scholar] [CrossRef] [PubMed]
- Fedorova, L.; Fedorov, A. Introns in gene evolution. Genetica 2003, 118, 123–131. [Google Scholar] [CrossRef]
- Irimia, M.; Roy, S.W. Origin of spliceosomal introns and alternative splicing. Cold Spring Harb. Perspect. Biol. 2014, 6, a016071. [Google Scholar] [CrossRef] [PubMed]
- Rose, A.B. Introns as Gene Regulators: A Brick on the Accelerator. Front. Genet. 2019, 9, 672. [Google Scholar] [CrossRef] [PubMed]
Loci | Primer Sequences (5′–3′) | Tm (°C) | Product Sizes (bp) |
---|---|---|---|
P1-del-35 bp | F: TATCCTTAATCAGCCCCACGG | 59.3 | 161/126 |
R: TCCACTGTTCACCCAGATCAA | 58.9 | ||
P2-del-31 bp | F: AGCTGAGGCTGATGTTGGAG | 59.7 | 355/324 |
R: CGGACAGCACTGACATTGAC | 59.2 | ||
P3-ins-29 bp | F: AGGACAAGAGTCAGGGGCAT | 60.5 | 401/372 |
R: GGGTGCAGTGAATAACACGG | 59.2 | ||
P4-del-29 bp | F: CTCCCGACTTGAAACAATCTGC | 59.8 | 299/270 |
R: CCTAACCAAGGGTGGACAGAG | 59.7 | ||
P5-del-24 bp | F: TGCCTACCACAGTATCACTTCAA | 59.4 | 153/129 |
R: ATGGGGCAACATTTGATCTTGG | 59.5 | ||
P6-del-21-bp | F: GACCATCCTGTCCCCTTTAGAC | 59.8 | 198/177 |
R: TTCCAAAGGGTATCTTTATCCTGC | 58.5 | ||
P7-del-21 bp | F: GACCATCCTGTCCCCTTTAGAC | 59.8 | 198/177 |
R: TTCCAAAGGGTATCTTTATCCTGC | 58.5 | ||
P8-del-24 bp | F: TTAAGTGAAGCCTGGTACCTTCA | 59.3 | 424/403 |
R: ACCACTCACCTTCCAGAGGAT | 60.2 | ||
P9-del-21 bp | F: GCAGAGGTCAGGAAAGCAGA | 59.6 | 141/120 |
R: TCTCCATTCTGGGTGCTGTG | 59.6 |
Loci | Sample Sizes | Genotypic Frequencies | Allelic Frequencies | HWE | Molecular Genetic Parameters | ||||||
---|---|---|---|---|---|---|---|---|---|---|---|
II | ID | DD | I | D | p Values | Ho | He | Ne | PIC | ||
P3-del-29 bp | 566 | 0.159 | 0.611 | 0.229 | 0.464 | 0.535 | p < 0.05 | 0.502 | 0.497 | 1.990 | 0.373 |
P5-ins-24 bp | 378 | 0.063 | 0.674 | 0.261 | 0.400 | 0.599 | p < 0.05 | 0.519 | 0.480 | 1.924 | 0.365 |
P6-del-21 bp | 329 | 0.580 | 0.358 | 0.060 | 0.759 | 0.240 | p > 0.05 | 0.635 | 0.364 | 1.574 | 0.298 |
Species/Regions | Sample Size | Breeds | Breed Type | Frequencies of P3-ins-29 bp | Frequencies of P5-del-24 bp | Frequencies of P6-del-21 bp |
---|---|---|---|---|---|---|
Wild | n = 33 | Mouflon | Wild sheep | 0.95 | 0.14 | 0.12 |
China | n = 129 | Hu | Meat | 0.94 | 0.15 | 0.24 |
n = 41 | Altay | Meat | 0.85 | 0.12 | 0.26 | |
n = 33 | Bashibai | Wool–meat | 0.81 | 0.20 | 0.29 | |
n = 31 | Bayinbuluke | Meat–fat | 0.94 | 0.21 | 0.29 | |
n = 40 | Duolang | Meat–fat | 0.93 | 0.18 | 0.45 | |
n = 40 | Cele Black | Lambskin | 0.89 | 0.21 | 0.11 | |
n = 81 | Kazakh | Meat–fat | 0.69 | 0.31 | 0.41 | |
n = 38 | Tan | Wool | 0.97 | 0.12 | 0.28 | |
n = 30 | AUW | Meat | 0.53 | 0.55 | 0.42 | |
n = 188 | Tibetian | Coarse wool | 0.87 | 0.17 | 0.27 | |
n = 146 | Yunnan | Meat–wool–lambskin | 0.97 | 0.03 | 0.33 | |
n = 44 | YSFW | Meat–wool–milk | 0.42 | 0.45 | 0.22 | |
n = 86 | Liangshan Wool | Wool–meat | 0.70 | 0.31 | 0.15 | |
n = 30 | Liangshan Black | Meat | 0.95 | 0.02 | 0.17 | |
Europe | n = 43 | Poll Dorset | Meat | 0.42 | 0.38 | 0.47 |
n = 55 | Romney | Meat | 0.42 | 0 | 0.25 | |
n = 41 | Dorper | Meat | 0.49 | 0.29 | 0.28 | |
n = 62 | Merino Horned | Wool–meat | 0.50 | 0.10 | 0.13 | |
n = 50 | Merino Polled | Wool–meat | 0.45 | 0.14 | 0.2 | |
n = 55 | EFD | Milk | 0.31 | 0.15 | 0.08 | |
n = 38 | Chinese Merino | Meat–wool | 0.36 | 0 | 0.16 | |
Africa | n = 72 | Morocco | Meat | 0.66 | 0.26 | 0.22 |
n = 30 | D’man | Meat | 0.67 | 0.18 | 0.17 | |
n = 40 | Coopworth | Meat–wool | 0.49 | 0.24 | 0.16 | |
n = 31 | Dairy Meade | Meat–milk | 0.45 | 0.02 | 0.07 |
Loci | Parity/Average | Sample Sizes | Genotypes (Mean ± SE) | p-Values | ||
---|---|---|---|---|---|---|
II | ID | DD | ||||
P3-ins-29 bp | I | 394 | 1.32 ± 0.05 (n = 68) | 1.37 ± 0.03 (n = 229) | 1.30 ± 0.04 (n = 97) | 0.513 |
II | 311 | 1.31 ± 0.07 (n = 54) | 1.40 ± 0.03 (n = 178) | 1.51 ± 0.06 (n = 79) | 0.043 | |
III | 204 | 1.29 ± 0.07 (n = 35) | 1.47 ± 0.04 (n = 119) | 1.48 ±0.07 (n = 50) | 0.063 | |
Average | 425 | 1.36 ± 0.04 (n = 73) | 1.39 ± 0.02 (n = 247) | 1.38 ± 0.04 (n = 105) | 0.788 | |
P5-del-24 bp | I | 266 | 1.39 ± 0.1 (n = 18) | 1.30 ± 0.03 (n = 174) | 1.31 ± 0.05 (n = 74) | 0.769 |
II | 212 | 1.69 ± 0.2 (n = 13) | 1.35 ± 0.04 (n = 137) | 1.44 ± 0.07 (n = 62) | 0.031 | |
III | 138 | 1.75 ± 0.1 (n = 8) | 1.49 ± 0.05 (n = 93) | 1.32 ± 0.08 (n = 37) | 0.039 | |
Average | 221 | 1.71 ± 0.2 (n = 13) | 1.39 ± 0.03 (n = 145) | 1.40 ± 0.05 (n = 63) | 0.011 | |
P6-del-21-bp | I | 179 | 1.32 ± 0.04 (n = 109) | 1.46 ± 0.07 (n = 59) | 1.55 ± 0.20 (n = 11) | 0.112 |
II | 146 | 1.36 ± 0.05 (n = 87) | 1.34 ± 0.06 (n = 50) | 1.56 ± 0.33 (n = 9) | 0.282 | |
III | 95 | 1.43 ± 0.06 (n = 56) | 1.41 ± 0.08 (n = 34) | 2.00 ± 0.31 (n = 5) | 0.052 | |
Average | 186 | 1.37 ± 0.03 (n = 115) | 1.39 ± 0.43 (n = 60) | 1.64 ± 0.18 (n = 11) | 0.031 |
Parity | Types | Genotypes | χ2 Values | df | p Values | ||
---|---|---|---|---|---|---|---|
II | ID | DD | |||||
I | single | 12 | 125 | 52 | 0.243 | 2 | 0.858 |
multi | 6 | 49 | 22 | ||||
II | single | 6 | 90 | 37 | 46.903 | 2 | 9.7428 × 10−12 |
multi | 47 | 47 | 25 | ||||
III | single | 2 | 48 | 26 | 6.828 | 2 | 0.034 |
multi | 6 | 45 | 11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Akhmet, N.; Zhu, L.; Song, J.; Akhatayeva, Z.; Zhang, Q.; Su, P.; Li, R.; Pan, C.; Lan, X. Exploring the Sheep MAST4 Gene Variants and Their Associations with Litter Size. Animals 2024, 14, 591. https://doi.org/10.3390/ani14040591
Akhmet N, Zhu L, Song J, Akhatayeva Z, Zhang Q, Su P, Li R, Pan C, Lan X. Exploring the Sheep MAST4 Gene Variants and Their Associations with Litter Size. Animals. 2024; 14(4):591. https://doi.org/10.3390/ani14040591
Chicago/Turabian StyleAkhmet, Nazar, Leijing Zhu, Jiajun Song, Zhanerke Akhatayeva, Qingfeng Zhang, Peng Su, Ran Li, Chuanying Pan, and Xianyong Lan. 2024. "Exploring the Sheep MAST4 Gene Variants and Their Associations with Litter Size" Animals 14, no. 4: 591. https://doi.org/10.3390/ani14040591