Massively Parallel CRISPR-Cas9 Knockout Screening in Sheep Granulosa Cells for FSH Response Genes
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Isolation and Culture of Granulosa Cells
2.2. Effects of FSH on the Viability of Granulosa Cells
2.3. Genome-Wide sgRNA Library Design, Lentivirus Packaging, and Titration
- (1)
- Design sgRNA sequence: ➀ Utilizing sgRNACas9 online software, we designed sgRNA sequences of protein-coding genes on the sheep chromosomes 2, 3, and X were, to search for sgRNAs with higher specificity to act as candidate sgRNA. ➁ The length of sgRNA was designed to be 20 nt.
- (2)
- Synthesis of sgRNA sequences: ➀ Synthesize sgRNA sequences with the Syno® 3.0 technology platform. ➁ Perform PCR amplification on synthesized oligonucleotide probes using high-fidelity enzymes. ➂ Separate amplification products by 2% agarose gel electrophoresis and recover the desired bands.
- (3)
- Cloning into the vector: Clone the amplified product into the Lenti CRISPR.v2 lentiviral expression vector to form a linearized vector.
- (4)
- Construction of a library: ➀ Use Gibson Assembly® MasterMix to spliced multiple DNA fragments together in one step. ➁ Ligated the recovered library fragment product with a linearized vector via Gibson Assembly® MasterMix. ➂ Transformed the Gibson assembly product into Trans1 T1 competent cells. ➃ Extract the sgRNA plasmid library using plasmid extraction kit.
- (5)
- Packaging and transfection: ➀ Transfected the lentivirus-related packaging plasmid and the recombinant plasmid carrying the sgRNA library into 293T cells. ➁ The constructed sgRNA library vector was packaged into the lentivirus. ➂ Use the produced lentivirus to infect sheep granulosa cells for gene editing experiments.
2.4. Determination of the Optimal Concentration of Puromycin in Granulosa Cells
2.5. Construction of the Massively Parallel CRISPR-Cas9 Knockout Cell Library of Granulosa Cells
2.6. Massively Parallel CRISPR/Cas9 Screening of FSH Response Genes in Granulosa Cells
- The above GC knockout cells were cultured in a complete medium containing 10 ng/mL FSH for 3 consecutive rounds, and 1 × 106 cells were collected for genomic DNA extraction. The total genomic DNA was extracted using TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver.5.0; for specific extraction steps, refer to the instructions.
- PCR was used to analyze the sgRNA information (Table 1). Briefly, 4 μg genomic DNA was taken and amplified with 2× Taq Plus Master Mix (Dye Plus) as a PCR enzyme. The total volume of the reaction was 50 μL and the specific reaction was as follows:
2 × Taq Plus Master Mix Π | 25 μL | ||
sgRNA2F | 2 μL | ||
sgRNA2R | 2 μL | ||
Geneme DNA | 4 μL | ||
Add sterile enzyme-free water | 50 μL |
- c
- We carried out gel recovery and purification of the target fragment using the purification process according to the gel recovery kit.
- d
- The purified product library was constructed for second-generation sequencing, and the second-generation sequencing was entrusted to the source of Novobio.
- e
- The raw data after sequencing were subjected to quality control with FASTQC software Version 0.12.0, and the clean data after cleaning were obtained for subsequent analysis.
- f
- MAGeCK software (v1) [18] was used to compare the clean data with the sgRNA library sequence, and the sgRNA was counted and standardized. The MAGeCK screening method selects candidate genes with multiple enriched or depleted sgRNAs to reduce the possibility that the observed changes in sgRNA distribution are caused by the off-target activity of a single sgRNA. The R package MAGeCKFlute [19] was used for downstream analysis, statistical comparisons, and functional enrichment for positive and negative selection. Positive and negative selection were based on the phenotype of interest and available selection pressures for the screen. Positive selection exerts a certain screening pressure on the cell library that has successfully integrated sgRNAs, and the number of phenotype-related sgRNAs increases relative to the rest of the sgRNAs. Depending on the enrichment of sgRNA, genetic perturbations that produce screening phenotypes due to cell proliferation can be obtained and can screen resistance genes. Negative selection involves the depletion of phenotypic corresponding sgRNAs due to cell death, and the genes necessary for cell survival can be screened [20].
2.7. Granulosa Cells’ RNA-Seq and Bioinformatics Analyses under FSH Hormone Treatment
2.7.1. RNA Extraction, Library Construction, and RNA-Seq
2.7.2. Differential Expression Genes and Functional Annotation Analysis
2.8. Analysis of FSH Dose-Dependent Genes
3. Results
3.1. Effects of FSH on the Viability of Granulosa Cells
3.2. Sheep CRISPR-Cas9 Massively Parallel Knockout Library Coverage and Homogeneity Testing
3.3. Construction of Massively Parallel CRISPR-Cas9 Knockout Cell Library of Granulosa Cells
3.4. Sheep Massively Parallel CRISPR-Cas9 Technology for Identifying FSH Responsive Genes in Granulosa Cells
3.4.1. Knockout Cell Bank PCR Next-Generation Sequencing
3.4.2. FSH Response-Related Gene Screening
3.5. FSH-Regulated Granulosa Cells’ Transcriptome Analysis
3.5.1. Gene Expression Analysis
3.5.2. Differential Expression Gene Analysis
3.5.3. Systematic Function Analysis of Differentially Expressed Genes
3.6. Screening and Analysis of FSH Dose-Dependent Genes
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Liu, Z.; Fu, S.; He, X.; Dai, L.; Liu, X.; Narisu; Shi, C.; Gu, M.; Wang, Y.; Manda; et al. Integrated Multi-Tissue Transcriptome Profiling Characterizes the Genetic Basis and Biomarkers Affecting Reproduction in Sheep (Ovis aries). Genes 2023, 14, 1881. [Google Scholar] [CrossRef] [PubMed]
- Duggavathi, R.; Murphy, B.D. Ovulation Signals. Science 2009, 324, 890–891. [Google Scholar] [CrossRef] [PubMed]
- George, J.W.; Dille, E.A.; Heckert, L.L. Current Concepts of Follicle-Stimulating Hormone Receptor Gene Regulation. Biol. Reprod. 2011, 84, 7–17. [Google Scholar] [CrossRef] [PubMed]
- Richards, J.S. Perspective: The Ovarian Follicle—A Perspective in 2001. Endocrinology 2001, 142, 2184–2193. [Google Scholar] [CrossRef] [PubMed]
- Gittens, J.E.I.; Barr, K.J.; Vanderhyden, B.C.; Kidder, G.M. Interplay between Paracrine Signaling and Gap Junctional Communication in Ovarian Follicles. J. Cell Sci. 2005, 118, 113–122. [Google Scholar] [CrossRef]
- Casarini, L.; Crépieux, P. Molecular Mechanisms of Action of FSH. Front. Endocrinol. 2019, 10, 305. [Google Scholar] [CrossRef]
- Barros, C.M.; Satrapa, R.A.; Castilho, A.C.S.; Fontes, P.K.; Razza, E.M.; Ereno, R.L.; Nogueira, M.F.G. Effect of Superstimulatory Treatments on the Expression of Genes Related to Ovulatory Capacity, Oocyte Competence and Embryo Development in Cattle. Reprod. Fertil. Dev. 2012, 25, 17–25. [Google Scholar] [CrossRef]
- Lonergan, P.; Fair, T. Maturation of Oocytes in Vitro. Annu. Rev. Anim. Biosci. 2016, 4, 255–268. [Google Scholar] [CrossRef]
- Galway, A.B.; Lapolt, P.S.; Tsafriri, A.; Dargan, C.M.; Boime, I.; Hsueh, A.J. Recombinant Follicle-Stimulating Hormone Induces Ovulation and Tissue Plasminogen Activator Expression in Hypophysectomized Rats. Endocrinology 1990, 127, 3023–3028. [Google Scholar] [CrossRef] [PubMed]
- Raju, G.A.R.; Chavan, R.; Deenadayal, M.; Gunasheela, D.; Gutgutia, R.; Haripriya, G.; Govindarajan, M.; Patel, N.H.; Patki, A.S. Luteinizing Hormone and Follicle Stimulating Hormone Synergy: A Review of Role in Controlled Ovarian Hyper-Stimulation. J. Hum. Reprod. Sci. 2013, 6, 227–234. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Hua, Y.; Wang, J.; Li, L.; Yuan, J.; Zhang, B.; Wang, Z.; Ji, J.; Kong, D. RNA Polymerase III Is Required for the Repair of DNA Double-Strand Breaks by Homologous Recombination. Cell 2021, 184, 1314–1329.e10. [Google Scholar] [CrossRef] [PubMed]
- Kasimanickam, V. Application of CRISPR-Cas9 Technology in Bovine Reproduction. In Bovine Reproduction; Hopper, R.M., Ed.; Wiley: Hoboken, NJ, USA, 2021; pp. 1157–1166. ISBN 978-1-119-60248-4. [Google Scholar]
- Wu, Y.; Zhou, H.; Fan, X.; Zhang, Y.; Zhang, M.; Wang, Y.; Xie, Z.; Bai, M.; Yin, Q.; Liang, D.; et al. Correction of a Genetic Disease by CRISPR-Cas9-Mediated Gene Editing in Mouse Spermatogonial Stem Cells. Cell Res. 2015, 25, 67–79. [Google Scholar] [CrossRef] [PubMed]
- Chapman, K.M.; Medrano, G.A.; Jaichander, P.; Chaudhary, J.; Waits, A.E.; Nobrega, M.A.; Hotaling, J.M.; Ober, C.; Hamra, F.K. Targeted Germline Modifications in Rats Using CRISPR/Cas9 and Spermatogonial Stem Cells. Cell Rep. 2015, 10, 1828–1835. [Google Scholar] [CrossRef]
- Xie, S.-L.; Bian, W.-P.; Wang, C.; Junaid, M.; Zou, J.-X.; Pei, D.-S. A Novel Technique Based on in Vitro Oocyte Injection to Improve CRISPR/Cas9 Gene Editing in Zebrafish. Sci. Rep. 2016, 6, 34555. [Google Scholar] [CrossRef]
- Vilarino, M.; Rashid, S.T.; Suchy, F.P.; McNabb, B.R.; van der Meulen, T.; Fine, E.J.; Ahsan, S.D.; Mursaliyev, N.; Sebastiano, V.; Diab, S.S.; et al. CRISPR/Cas9 Microinjection in Oocytes Disables Pancreas Development in Sheep. Sci. Rep. 2017, 7, 17472. [Google Scholar] [CrossRef]
- Xie, S.; Shen, B.; Zhang, C.; Huang, X.; Zhang, Y. sgRNAcas9: A Software Package for Designing CRISPR sgRNA and Evaluating Potential off-Target Cleavage Sites. PLoS ONE 2014, 9, e100448. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Xu, H.; Xiao, T.; Cong, L.; Love, M.I.; Zhang, F.; Irizarry, R.A.; Liu, J.S.; Brown, M.; Liu, X.S. MAGeCK Enables Robust Identification of Essential Genes from Genome-Scale CRISPR/Cas9 Knockout Screens. Genome Biol. 2014, 15, 554. [Google Scholar] [CrossRef]
- Wang, B.; Wang, M.; Zhang, W.; Xiao, T.; Chen, C.-H.; Wu, A.; Wu, F.; Traugh, N.; Wang, X.; Li, Z.; et al. Integrative Analysis of Pooled CRISPR Genetic Screens Using MAGeCKFlute. Nat. Protoc. 2019, 14, 756–780. [Google Scholar] [CrossRef]
- Joung, J.; Konermann, S.; Gootenberg, J.S.; Abudayyeh, O.O.; Platt, R.J.; Brigham, M.D.; Sanjana, N.E.; Zhang, F. Genome-Scale CRISPR-Cas9 Knockout and Transcriptional Activation Screening. Nat. Protoc. 2017, 12, 828–863. [Google Scholar] [CrossRef]
- Love, M.I.; Huber, W.; Anders, S. Moderated Estimation of Fold Change and Dispersion for RNA-Seq Data with DESeq2. Genome Biol. 2014, 15, 550. [Google Scholar] [CrossRef]
- Reimand, J.; Arak, T.; Adler, P.; Kolberg, L.; Reisberg, S.; Peterson, H.; Vilo, J. G:Profiler-a Web Server for Functional Interpretation of Gene Lists (2016 Update). Nucleic Acids Res. 2016, 44, W83–W89. [Google Scholar] [CrossRef]
- Erickson, G.F.; Sorensen, R.A. In Vitro Maturation of Mouse Oocytes Isolated from Late, Middle, and Pre-Antral Graafian Follicles. J. Exp. Zool. 1974, 190, 123–127. [Google Scholar] [CrossRef]
- Peluso, J.J.; Steger, R.W. Role of FSH in Regulating Granulosa Cell Division and Follicular Atresia in Rats. J. Reprod. Fertil. 1978, 54, 275–278. [Google Scholar] [CrossRef]
- Richards, J.S.; Fitzpatrick, S.L.; Clemens, J.W.; Morris, J.K.; Alliston, T.; Sirois, J. Ovarian Cell Differentiation: A Cascade of Multiple Hormones, Cellular Signals, and Regulated Genes. Recent. Prog. Horm. Res. 1995, 50, 223–254. [Google Scholar] [CrossRef]
- Li, Z.; Wang, J.; Zhao, Y.; Ma, D.; Zhao, M.; Li, N.; Men, Y.; Zhang, Y.; Chu, H.; Lei, C.; et al. scRNA-Seq of Ovarian Follicle Granulosa Cells from Different Fertility Goats Reveals Distinct Expression Patterns. Reprod. Domest. Anim. 2021, 56, 801–811. [Google Scholar] [CrossRef]
- Madogwe, E.; Tanwar, D.K.; Taibi, M.; Schuermann, Y.; St-Yves, A.; Duggavathi, R. Global Analysis of FSH-regulated Gene Expression and Histone Modification in Mouse Granulosa Cells. Mol. Reprod. Dev. 2020, 87, 1082–1096. [Google Scholar] [CrossRef]
- Nivet, A.-L.; Dufort, I.; Gilbert, I.; Sirard, M.-A. Short-Term Effect of FSH on Gene Expression in Bovine Granulosa Cells in Vitro. Reprod. Fertil. Dev. 2018, 30, 1154–1160. [Google Scholar] [CrossRef]
- Zhu, M.; Wang, D.; Zou, K.; Wang, F.; Zhang, Z.; Song, X.; Jia, C.; Wei, Z. Insulin-like Growth Factor-1 Regulates Follicle Selection of Hens by Promoting Proliferation and Inhibiting Apoptosis of Granulosa Cells in Prehierarchical Follicles in Vitro. Anim. Reprod. Sci. 2022, 247, 107091. [Google Scholar] [CrossRef] [PubMed]
- Kalds, P.; Zhou, S.; Cai, B.; Liu, J.; Wang, Y.; Petersen, B.; Sonstegard, T.; Wang, X.; Chen, Y. Sheep and Goat Genome Engineering: From Random Transgenesis to the CRISPR Era. Front. Genet. 2019, 10, 750. [Google Scholar] [CrossRef] [PubMed]
- Zhou, Y.; Zhu, S.; Cai, C.; Yuan, P.; Li, C.; Huang, Y.; Wei, W. High-Throughput Screening of a CRISPR/Cas9 Library for Functional Genomics in Human Cells. Nature 2014, 509, 487–491. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Li, H.; Zhao, L.; Koopman, P.; Zhang, F.; Huang, J.X. Genome-Wide Off-Target Analysis in CRISPR-Cas9 Modified Mice and Their Offspring. G3 (Bethesda) 2019, 9, 3645–3651. [Google Scholar] [CrossRef]
- Zhang, J.; Hu, S.; Zhao, C.; Zhou, Y.; Zhang, L.; Liu, H.; Zhou, P.; Li, S.; Fu, L.; Zheng, Z.; et al. Genome-Scale CRISPR Knockout Screening Identifies BACH1 as a Key Regulator of Aflatoxin B1-Induced Oxidative Damage. Antioxidants 2022, 11, 1787. [Google Scholar] [CrossRef]
- Chojnacka-Puchta, L.; Sawicka, D. CRISPR/Cas9 Gene Editing in a Chicken Model: Current Approaches and Applications. J. Appl. Genet. 2020, 61, 221–229. [Google Scholar] [CrossRef]
- Shalem, O.; Sanjana, N.E.; Hartenian, E.; Shi, X.; Scott, D.A.; Mikkelsen, T.S.; Heckl, D.; Ebert, B.L.; Root, D.E.; Doench, J.G.; et al. Genome-Scale CRISPR-Cas9 Knockout Screening in Human Cells. Science 2014, 343, 84–87. [Google Scholar] [CrossRef] [PubMed]
- Baumgarten, S.C.; Convissar, S.M.; Fierro, M.A.; Winston, N.J.; Scoccia, B.; Stocco, C. IGF1R Signaling Is Necessary for FSH-Induced Activation of AKT and Differentiation of Human Cumulus Granulosa Cells. J. Clin. Endocrinol. Metab. 2014, 99, 2995–3004. [Google Scholar] [CrossRef] [PubMed]
- Bi, Y.; Yang, S.; Wang, H.; Chang, G.; Chen, G. Follicle-Stimulating Hormone Is Expressed in Ovarian Follicles of Chickens and Promotes Ovarian Granulosa Cell Proliferation. J. Integr. Agric. 2021, 20, 2749–2757. [Google Scholar] [CrossRef]
Primer Name | Primer Sequence (5′-3′) |
---|---|
sgRNA-F | AATTAATTTGACTGTAAACACAA |
sgRNA-R | TTCAAGTTGATAACGGACT |
Chr | sgRNA Sequencing 1 | Number of sgRNAs 2 | Number of Coding Genes 3 | Coverage Number 4 | Coverage 5 | Homogeneity 6 |
---|---|---|---|---|---|---|
chr2 | 13,750,412 | 5612 | 1433 | 5611 | 99.98% | 11.2 |
chr3 | 15,763,418 | 7750 | 1990 | 7749 | 99.98% | 4.1 |
chrX | 14,493,832 | 3095 | 812 | 3095 | 100.00% | 4.5 |
Type | KEGG_Name | KEGG_id | Adjusted p_Value | Gene_Count |
---|---|---|---|---|
all-up_DEGs | TNF signaling pathway | KEGG:04668 | 0.001371046 | 106 |
PI3K-Akt signaling pathway | KEGG:04151 | 0.006758773 | 306 | |
ECM–receptor interaction | KEGG:04512 | 0.022827729 | 82 | |
all-down_DEGs | Arrhythmogenic right ventricular cardiomyopathy | KEGG:05412 | 0.002590425 | 72 |
Neuroactive ligand–receptor interaction | KEGG:04080 | 0.010170701 | 283 | |
cAMP signaling pathway | KEGG:04024 | 0.04874159 | 203 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Z.; Dai, L.; Sun, T.; Liu, Y.; Bao, Y.; Gu, M.; Fu, S.; He, X.; Shi, C.; Wang, Y.; et al. Massively Parallel CRISPR-Cas9 Knockout Screening in Sheep Granulosa Cells for FSH Response Genes. Animals 2024, 14, 898. https://doi.org/10.3390/ani14060898
Liu Z, Dai L, Sun T, Liu Y, Bao Y, Gu M, Fu S, He X, Shi C, Wang Y, et al. Massively Parallel CRISPR-Cas9 Knockout Screening in Sheep Granulosa Cells for FSH Response Genes. Animals. 2024; 14(6):898. https://doi.org/10.3390/ani14060898
Chicago/Turabian StyleLiu, Zaixia, Lingli Dai, Tianhao Sun, Yongbin Liu, Yanchun Bao, Mingjuan Gu, Shaoyin Fu, Xiaolong He, Caixia Shi, Yu Wang, and et al. 2024. "Massively Parallel CRISPR-Cas9 Knockout Screening in Sheep Granulosa Cells for FSH Response Genes" Animals 14, no. 6: 898. https://doi.org/10.3390/ani14060898