Next Article in Journal
Comparative Genomics Reveal Phylogenetic Relationship and Chromosomal Evolutionary Events of Eight Cervidae Species
Previous Article in Journal
Response to Incremental Replacement of Palm Oil with Fish Oil in Starter Diet on Growth Performance, Plasma Metabolites, Ruminal Fermentation, and Behavior of Dairy Calves
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Animals
Volume 14
Issue 7
10.3390/ani14071062
animals-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Strain-Specific Benefits of Bacillus Probiotics in Hybrid Grouper: Growth Enhancement, Metabolic Health, Immune Modulation, and Vibrio harveyi Resistance

by
Congjie Han
1,2,†,
Shizhen Song
1,2,†,
Congcong Cui
1,2,
Yan Cai
1,2,*,
Yongcan Zhou
1,2,
Jiawen Wang
1,2,
Weilie Bei
1,2,
Dongdong Zhang
1,2,
Weiliang Guo
1,2 and
Shifeng Wang
1,2,*
1
Hainan Provincial Key Laboratory for Tropical Hydrobiology and Biotechnology, School of Marine Biology and Fisheries, Hainan University, Haikou 570228, China
2
Collaborative Innovation Center of Marine Science and Technology, Hainan University, Haikou 570228, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Animals 2024, 14(7), 1062; https://doi.org/10.3390/ani14071062
Submission received: 6 February 2024 / Revised: 27 March 2024 / Accepted: 28 March 2024 / Published: 30 March 2024
(This article belongs to the Section Animal Reproduction)
Browse Figures
Versions Notes

Abstract

:

Simple Summary

Probiotics, beneficial bacteria that contribute to the health of both humans and animals, play a crucial role in aquaculture by enhancing digestion and bolstering disease resistance in fish. However, the efficacy of probiotics can vary significantly, even among strains of the same species, based on their origin. This study focused on evaluating the effects of three different Bacillus subtilis strains, derived either from the host fish or external sources, on fish growth and disease resilience. Our findings indicate that the host-derived strain, 6-3-1, offered superior benefits in terms of growth enhancement and health improvement compared to the externally-derived strains. This research underscores the importance of the probiotic source, demonstrating that origin can significantly influence effectiveness. The outcomes suggest the potential for customized probiotic applications to advance aquaculture practices substantially.

Abstract

In the realm of modern aquaculture, the utilization of probiotics has gained prominence, primarily due to their ability to enhance growth, boost immunity, and prevent diseases in aquatic species. This study primarily investigates the efficacy of Bacillus subtilis strains, both host-derived and from other sources, in influencing fish growth, immunity, lipid metabolism, and disease resistance. Employing a 42-day feeding trial, we divided hybrid grouper into four distinct groups: a control group on a basal diet and three experimental groups supplemented with 1 × 108 CFU/g of different Bacillus subtilis strains-BS, 6-3-1, and HAINUP40. Remarkably, the study demonstrated that the 6-3-1 and HAINUP40 groups exhibited significant enhancements across key growth parameters: final body weight (FBW), weight gain rate (WGR), feed intake (FI), feed efficiency ratio (FER), and feed conversion ratio (FCR). The investigation into lipid metabolism revealed that the 6-3-1 strain upregulated seven metabolism-related genes, HAINUP40 affected four metabolism-related genes, and the BS strain influenced two metabolism-related genes, indicating diverse metabolic impacts by different strains. Further, a notable reduction in liver enzymes AST and ALT was observed across all supplemented groups, implying improved liver health. Noteworthy was the BS strain’s superior antioxidative capabilities, positively affecting all four measured parameters (CAT, GSH-Px, MDA). In the sphere of immune-related gene expression, the BS strain significantly decreased the expression of both inflammation and apoptosis-related genes, whereas the HAINUP40 strain demonstrated an upregulation in these genes. The challenge test results were particularly telling, showcasing improved survival rates against Vibrio harveyi infection in the BS and 6-3-1 groups, unlike the HAINUP40 group. These outcomes highlight the strain-specific nature of probiotics and their varying mechanisms of action within the host. In conclusion, this study reveals that probiotic strains, varying by source, demonstrate unique, strain-specific effects in promoting growth and modulating immunity in hybrid grouper. This research highlights the promise of tailored probiotic applications in improving aquaculture practices. Such advancements contribute to more sustainable and efficient fish farming methods.

1. Introduction

Aquaculture, currently the world’s fastest-growing animal production sector, trades approximately 160 million tons of farmed fish annually, valued at around USD 80 billion [1,2,3]. This upward trend is particularly notable in high-value demersal fish like groupers [4,5]. Projections indicate a 30% increase in aquaculture demand in Asia and the Pacific by 2030. To meet this demand sustainably, Asian countries must adopt ecofriendly practices that adhere to industry standards, fostering responsible sector growth while protecting the environment [6]. The hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) has gained popularity in Southeast Asian aquaculture. Its resilience to high-density farming and rapid growth makes it an ideal candidate for intensive cultivation [7,8,9]. However, hyperintensive farming practices have led to reduced growth efficiency and an increase in disease infections in these fish, posing significant challenges to the industry [10]. Traditional strategies to mitigate intensified farming issues, such as using antimicrobials and chemicals to prevent disease, have drawbacks [11]. These agents alter the intestinal and aquatic microbial communities, hinder host immune development, and potentially impact human health due to antibiotic residues and bacterial resistance [11,12,13]. Given these challenges, it is crucial to explore alternative disease control methods that eschew therapeutic chemicals and antibiotics. Such methods should enhance survival, promote growth, and bolster disease resistance in aquaculture [14].
Probiotics, recognized as effective alternatives for disease prevention and control in aquaculture [15], comprise live microorganisms capable of adapting to and proliferating in the host’s intestinal tract. Recent years have highlighted their benefits in aquaculture, notably in enhancing growth performance, disease control, immune response improvement, and digestive enzyme activity [16,17]. Among these, Bacillus species are widely employed as probiotics in aquatic animals [18,19,20,21]. Studies have demonstrated that probiotics do not lead to drug resistance in aquatic species, making them viable antibiotic substitutes [22,23,24].
Presently, a diverse array of probiotic strains is utilized. However, research indicates that the efficacy of these strains is highly specific to each strain. Notable differences in coaggregation, cell adhesion, growth inhibition, and duodenal gene expression have been observed among strains of the same bacterial species, even under identical supplementation protocols and conditions [25,26,27,28]. Furthermore, given the specificity of host microbial communities, it is hypothesized that probiotics derived from the host may be more effective in the host environment than those from other sources [29]. Yet, comparative studies on the in vivo effects of host-derived and externally derived strains are scarce.
In a previous study, we identified three potential Bacillus subtilis probiotic strains (BS, 6-3-1, and HAINUP40) from varied sources. The BS strain, isolated from shrimp paste, exhibited promising probiotic characteristics in vitro [30]. The 6-3-1 strain, derived from hybrid grouper intestines, effectively enhanced growth and boosted both nonspecific immune responses and disease resistance in hybrid grouper [31]. The HAINUP40 strain, sourced from natural pond water, improved growth, digestive enzyme activity, nonspecific immunity, and disease resistance in Nile tilapia (Oreochromis niloticus) [32]. This study aims to compare the modulatory mechanisms of different B. subtilis strains on host fish genes and assess whether host-derived strains are more effective than those from other sources. By examining the impacts on fish growth, immunity, lipid metabolism, and disease resistance, this research yields insights valuable for the application of probiotics in the healthy and sustainable farming of grouper fish.

2. Experimental Design and Methods

2.1. Experimental Location and Holding Preparation

The study was conducted at a cooperative grouper farming base in Haitou Town, Danzhou City, Hainan Province, China. We acclimated 360 healthy hybrid groupers in four 1000 L tanks over 14 days. During this period, the fish were given balanced feed (the same as basal feed) to meet their nutritional needs and facilitate environmental adaptation. The aquatic environmental parameters under acclimation conditions were the same as those in the feeding experiment.

2.2. Fish Growth Parameters Measurement

At the experiment’s start and end, we measured the initial body weight (IBW) and final body weight (FBW) of ten randomly selected fish from each group. We also calculated feed intake (FI, g/day), feed efficiency rate (FER, %), feed conversion rate (FCR, %), and weight gain rate (WGR, %), using the following formulas: FI = feed intake/duration (days); FER = 100 × (FBW − IBW)/feed intake; FCR = 100 × feed intake/(FBW − IBW); WGR = 100 × (FBW − IBW)/IBW.

2.3. Preparation of Probiotic Diet

In our laboratory, we employed three Bacillus subtilis strains-BS, 6-3-1, and HAINUP40-as probiotics. These strains were isolated and identified by our team: BS was derived from traditional Chinese fermented shrimp paste [30], 6-3-1 from the intestines of hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) [31], and HAINUP40 from natural pond water [32]. For the preparation of probiotic-supplemented diets, each Bacillus strain was cultured in liquid LB medium and incubated at 37 °C for 24 h. Following incubation, the cultures were centrifuged, and the resulting pellets were resuspended in sterile PBS. We then sprayed these probiotic suspensions evenly onto basal feed pellets to achieve a concentration of 1 × 108 CFU (colony-forming units) bacteria per gram of feed. For the control group, basal feed was sprayed with a comparable volume of sterile PBS. The final experimental diets included: a BS diet (basal feed with BS strain), a 6-3-1 diet (basal feed with 6-3-1 strain), a HAINUP40 diet (basal feed with HAINUP40 strain), and a control diet (basal feed with PBS only). After spraying, the diets were dried in a bacterial oven at 30 °C for 12 h. This process was conducted on a weekly basis. Post-preparation, the diets were portioned into plastic bags and stored at −20 °C until needed. The basic diet’s ingredients and approximate composition are listed in Table 1.

2.4. Fish Rearing and Experimental Design

In this study, we distributed 360 hybrid grouper fish, each with a similar initial weight (average W0 = 532.28 ± 27.31 g), across twelve 500 L white cylindrical plastic culture vats. These vats were divided into four groups: one control and three probiotic-supplemented groups, with each group comprising three replicates. We maintained a consistent photoperiod in each incubator, consisting of equal 12 h intervals of light and darkness. Additionally, independent oxygen supply systems were installed in each vat to ensure sufficient oxygen levels.
The feeding experiment spanned a total of six weeks. We fed the fish twice daily, at 9:00 a.m. and 5:00 p.m., until they exhibited visual signs of satiation. Post-feeding, we regularly removed any uneaten bait and waste from the tanks and ensured thorough cleaning. To maintain a stable external environment, we replaced the seawater, ensuring it was well aerated, every four days. Throughout the feeding period and subsequent challenge test, we closely monitored and maintained water quality parameters within specific ranges: temperature at 26.5 ± 1.5 °C, dissolved oxygen at 6.50 ± 0.5 mg/L, pH at 7.6 ± 0.5, total ammonia nitrogen at 0.26 ± 0.03 mg/L, and nitrite levels at 0.04 ± 0.01 mg/L.

2.5. Sampling Process

For this study, we subjected the groupers to a 24 h fasting period before sampling. On the sampling day, the fish were anesthetized with 100 mg/L eugenol. We then collected whole blood from the tail vein using a 1 mL syringe. The blood samples were allowed to rest at room temperature for three hours before centrifuging at 3000 rpm for 20 min at 4 °C. This process separated the serum, which we then stored at −20 °C for subsequent analysis of liver health-related enzyme activities and antioxidant capacities. Following blood collection, we performed dissections in a sterile environment. We meticulously extracted liver samples and immediately immersed them in liquid nitrogen for preservation. These samples will be analyzed later to investigate gene expressions related to immunity and lipid metabolism.

2.6. Analysis of Liver Health-Related Enzyme Activities

We measured the activities of liver health-related enzymes, specifically aspartate aminotransferase (AST) and alanine aminotransferase (ALT), utilizing specific assay kits provided by Nanjing Jiancheng Bioengineering Institute, Nanjing, China.

2.7. Antioxidant Capacity Analysis

The antioxidant capacities, including catalase (CAT), total antioxidant capacity (T-AOC), glutathione peroxidase (GSH-Px), and malondialdehyde (MDA) levels, were assessed using commercial assay kits sourced from Nanjing Jiancheng Bioengineering Institute, Nanjing, China.

2.8. Expression of Immune/Lipid Metabolism-Related Genes in Liver

We evaluated the expression of immune-related genes (il-1β, tnfα, tlr22, myd88, p65, bcl-2, bax, caspase3, caspase9) and lipid metabolism-related genes (lpl, aco1, g6pd, dgat2, fas, atgl, pparα, cpt1, srebp-1c) in liver tissues using RT-PCR. The process began by adding 1 mL of Trizol (Thermo Fisher Scientific, Waltham, MA, USA) to a 100 mg liver tissue sample. RNA extraction followed the protocol provided by Takara (Beijing, China). We used the NanoDrop1000 to measure RNA purity and concentration and verified RNA integrity via 10 g/L agarose gel electrophoresis. Following reverse transcription using the Prime-Script TM kit (Takara Bio-company, Dalian, China), the resultant cDNA was stored at −20 °C. RT-PCR experiments utilized SYBR Premix Ex Taq TM reagent (Takara Biocompany, Dalian, China). The specific primers used are listed in Table 2. The PCR conditions were as follows: an initial denaturation at 95 °C for 30 s, followed by 40 cycles of 95 °C for 5 s, and 60 °C for 31 s. We calculated relative gene expression levels using the 2−ΔΔCt method, with β-actin as the internal control.

2.9. Challenge Test

The Vibrio harveyi strain utilized for the challenge test was isolated, sequenced, and identified in our previous research [33]. For the test, we revived the strain from −80 °C storage by culturing it in tryptic soy broth (Merck, Darmstadt, Germany) at 31 °C overnight. The culture was then centrifuged (5000× g, 15 min, 25 °C), and the supernatant was discarded. We washed the resultant bacterial pellets three times with sterile PBS and adjusted the bacterial suspension to 1 × 109 CFU/mL, equivalent to McFarland Standard No. 0.5 at a wavelength of 600 nm. Following the six-week feeding trial, we randomly selected ten fish from each vat (thirty fish per group) for the challenge test. Each fish received an intraperitoneal injection of 0.1 mL of PBS containing 1.27 × 108 CFU/mL of live V. harveyi cells [34]. Post-injection, we monitored and recorded the mortality rates in all groups for 14 days.

2.10. Data Analysis

We first processed the experimental data using Excel. Subsequently, we employed one-way ANOVA and Tukey’s test to analyze growth performance parameters, serum indicators, and gene expression data. For the challenge test, mortality data were analyzed using the Kaplan–Meier method. Differences between the control and probiotic-supplemented groups were assessed using the Mantel–Cox log-rank test. Graphs were generated using GraphPad Prism 9.5(GraphPad Software, San Diego, CA). All data are presented as mean ± SEM. In the results, columns marked with different letters (a, b, c) signify statistically significant differences among the groups. A p-value of less than 0.05 was considered statistically significant.

3. Results

3.1. Fish growth parameters

Compared to the control group, the three probiotic groups significantly enhanced feed intake (FI), feed efficiency ratio (FER), and feed conversion ratio (FCR) in hybrid grouper (p < 0.05). Notably, the 6-3-1 and HAINUP40 groups also significantly improved the final body weight (FBW) and weight gain rate (WGR) of the fish (p < 0.05) (Table 3).

3.2. Liver Function Enzyme Activity Analysis

As depicted in Figure 1, activities of AST (Figure 1A) and ALT (Figure 1B) were significantly lower in the BS, 6-3-1, and HAINUP40 probiotic groups compared to the control group (p < 0.05).

3.3. Antioxidant Capacity Analysis

As shown in Figure 2, The BS group showed significant increases in CAT and GSH-PX levels compared to the control ((p < 0.05). Similarly, the 6-3-1 group displayed a notable increase in both CAT and GSH-PX levels (p < 0.05), while the HAINUP40 group demonstrated significant increases in GSH-PX levels (p < 0.05). All probiotic groups noted a significant reduction in MDA levels relative to the control group (p < 0.05).

3.4. Expression of Immunity-Related Genes in Liver

As shown in Figure 3, The BS group showed a significant decrease in the expression of tnfα, tlr22, myd88, p65, bax, caspase3, and caspase9 genes (p < 0.05). The 6-3-1 group exhibited a significant reduction in myd88, p65, bax expression (p < 0.05). In contrast, the HAINUP40 group displayed significant increases in il-1β, myd88, bax expression and a significant decrease in bcl-2 gene expression (p < 0.05).

3.5. Expression of Lipid Metabolism-Related Genes in Liver

As shown in Figure 4, in the BS group, dgat2 expression significantly increased (p < 0.05), while other genes either did not change significantly or were downregulated (e.g., cpt1, p < 0.05). The 6-3-1 group saw significant upregulation in seven genes (aco1, atgl, dgat2, fas, g6pd, lpl, and srebp-1c) (p < 0.05), and the HAINUP40 group showed significant upregulation in four genes (atgl, cpt1, pparα, and srebp-1c) (p < 0.05).

3.6. Challenge Test

As shown in Figure 5, the BS and 6-3-1 groups exhibited significantly higher survival rates than the control group. Specifically, the BS group had a survival rate of 72.0%, and the 6-3-1 group had 42.9%. Conversely, the survival rate of the HAINUP40 group (33.3%) did not differ significantly from the control group. These results indicated that the BS and 6-3-1 groups had a higher likelihood of survival compared to the control group, while the HAINUP40 group showed no significant difference in survival rate.

4. Discussion

In recent years, the use of dietary supplements, including probiotics and medicinal plants or their derivatives, has significantly increased in aquaculture. These supplements are primarily used to enhance growth, boost immunity, and strengthen resistance against diseases and environmental stressors [35,36,37,38]. Growing concerns over human health, environmental pollution, and antibiotic resistance have spurred research into alternative growth promotion methods in fish and shrimp farming. Probiotics have gained attention as an ecofriendly and residue-free option, with several studies highlighting their effectiveness in improving the growth and health of aquatic organisms [39,40]. Various strains of B. subtilis have been explored as probiotics in aquaculture, but it is important to note that bacteria often display strain-specific properties. This means that different strains of the same bacterial species can have varying effects and mechanisms on the host organism [41]. Increasingly, researchers are focusing on identifying host-derived probiotics, hypothesizing that these are better adapted to the host environment and therefore more effective than nonhost-derived probiotics. However, empirical studies confirming the superiority of host-derived probiotics are scarce. This study aims to investigate and compare the effects and mechanisms of three different B. subtilis strains on the same species of grouper. The findings enhance understanding of the diverse impacts and mechanisms of various probiotic strains on fish.
The growth-promoting effects of B. subtilis strains have been have demonstrated in numerous finfishes including Nile tilapia (O. niloticus), tongue sole (Cynoglossus semilaevis), grass carp (Ctenopharyngodon idellus), juvenile large yellow croaker (Larimichthys crocea), Chinese perch (Siniperca chuatsi), largemouth bass (Micropterus salmoides), and hybrid grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂) [42,43,44,45,46,47]. Particularly, two separate studies on hybrid groupers showed that fish fed B. subtilis strain GPSAK9 and strain 7K showed significantly improved fish growth in comparison to those fed the basal diet [48]. Our research aligned with these findings; all three B. subtilis strain supplemented groups displayed significantly enhanced feed utilization parameters (FI, FER, FCR) (p < 0.05). Previous research has also demonstrated that certain probiotic traits, such as growth-promoting effects, may be widely shared among most strains within a genus. Notably, in our study, the BS group did not exhibit a significant increase in FBW and WGR (p > 0.05) in comparison to the control group, as did the 6-3-1 and HAINUP40 groups. This observed variance in growth promotion effects among the different B. subtilis strains may be attributed to the strain-specific effects of probiotics. It is interesting to notice that although the BS strain showed the least growth-promoting effects among the three B. subtilis strains, it was also the strain with the best antidisease effects. Therefore, we propose that strains with high disease protection effects may not necessarily exhibit growth-promoting properties simultaneously [49].
Serum biochemical indices are critical for assessing the physiological status of enzyme systems in organisms and are extensively used in clinical diagnostics to evaluate fish health [50]. AST and ALT serve as biochemical markers for liver damage assessment under various physiological conditions [51]. Typically localized in liver cells, these enzymes leak into the bloodstream when liver cells are damaged, leading to elevated serum AST and ALT levels. Thus, increased levels of these enzymes are indicative of liver dysfunction in aquatic organisms [52]. In our study, we observed a significant reduction in serum AST and ALT levels in fish groups receiving B. subtilis probiotics compared to the control group (p < 0.05). Similarly, B. subtilis strain GPSAK9 and 1-C-7 significantly reduced the AST and ALT levels in liver of hybrid grouper and serum of Chinese perch (Siniperca chuatsi), respectively [43]. These results suggested a positive impact of B. subtilis strains on the liver health of hybrid grouper [48].
Testing antioxidant capacity is an effective method for assessing fish health [53]. Antioxidant enzymes like SOD, CAT, and GSH-Px play key roles in mitigating oxidative stress. SOD facilitates the breakdown of superoxide radicals into oxygen and hydrogen peroxide [54], while CAT decomposes hydrogen peroxide into water and oxygen [55]. GSH-Px reduces harmful peroxides to nontoxic compounds and converts hydrogen peroxide into water [56]. T-AOC reflects the collective antioxidant potential of various substances and enzymes in the body [47]. MDA is a crucial marker of lipid peroxidation in vivo, with increased levels indicating cellular damage [57]. The administration of B. subtilis strain GPSAK9 led to significant upregulation of serum SOD, CAT, GSH-Px, and T-AOC levels in hybrid grouper [48]. B. subtilis strain 7k significantly enhanced the serum SOD activity in hybrid grouper [58]. In alignment with these studies, our research found that all three B. subtilis strains enhanced a certain array of antioxidant capacity parameters. Specifically, improving all four tested antioxidant parameters, BS and 6-3-1 strain showed the best antioxidant effects within three strains. These findings indicated that different B. subtilis strains could positively influence antioxidant enzyme activities of hybrid grouper at various levels. The antioxidant effects of various B. subtilis stains were also reported in many other fish species [44,48,58]. However, due to the lack of overlap in the fish species studied and the antioxidant parameters measured across different studies, understanding the regulatory effects of specific strains on the antioxidant capacity of organisms remains limited.
Abnormal lipid metabolism can significantly impact liver function, leading to severe health and growth issues in fish [59,60]. Genes such as srebp-1c, fas, g6pd, dgat2, atgl, cpt1, aco1, lpl, and pparα play crucial roles in normal hepatic lipid metabolism in fish [61]. Srebp-1c, fas, g6pd, and dgat2 are lipogenic genes involved in liver fat formation [62,63], while atgl, cpt1, and aco-1 are associated with mitochondrial fatty acid β-oxidation [64,65]; LPL is a key enzyme in lipoprotein tag hydrolysis [66], and activation of pparα can suppress fas mRNA expression [67]. Thus, reducing srebp-1c, fas, g6pd, and dgat2 levels and increasing atgl, cpt-1, aco-1, lpl, and pparα can mitigate lipid accumulation, enhancing fish health and growth by improving lipid metabolism [68]. For example, improved growth performance (FBW and WGR) in hybrid grouper (E. fuscoguttatus♀ × E. lanceolatus♂) has been linked with increased expression of lipolysis-related genes (pparα, cpt1, lpl) and decreased expression of adipogenesis-related genes (srebp-1c, g6pd, fas, dgat2) [68,69]. However, our study suggested a different relationship between fish growth and lipid metabolism-related gene expression: increased growth seems more related to the number of significantly altered genes rather than the specific upregulation or downregulation of certain gene categories. For instance, the 6-3-1 and HAINUP40 groups, which showed the largest number of significantly changed metabolism-related genes, also demonstrated the best growth performance (FBW, WGR). In the 6-3-1 group, both lipolysis-related (aco1, atgl, lpl) and adipogenesis-related genes (srebp-1c, g6pd, fas, dgat2) were upregulated (p < 0.05). Similarly, the HAINUP40 group exhibited upregulation in both lipolysis-related genes (atgl, cpt-1, pparα) and an adipogenesis-related gene (srebp-1c) (p < 0.05). In contrast, the BS group, which showed the fewest significant changes in metabolism-related genes, displayed weaker growth-promoting effects. In addition, a study of B. subtilis strain HGcc-1’s effect on high fat diet zebra fish (Danio rerio) revealed that although HGcc-1 supplementation significantly decreased the expression of lipogenesis genes (c/ebpα, fas, acc1, and dgat2) and increased the expression of lipolysis genes (ucp2, pparα), no significant differences were observed in growth performances of the HGcc-1 supplemented group and non-HGcc-1 supplemented group [70]. These observations not only indicated different lipid metabolism regulatory mechanisms of various B. subtilis strains, they also suggested that fish growth is regulated by a complex network of metabolism-related genes [71]. The expression of these genes is a dynamic process [72], and simple upregulation or downregulation cannot fully reflect the organism’s metabolic status or be directly correlated with growth performance [73].
V. harveyi is a prevalent and severe pathogen in grouper fish, known to cause liver injury and inflammation, which in turn can exacerbate liver damage [74,75]. Apoptosis, particularly under pathological conditions, can act as a pro-inflammatory process since the lipids from apoptotic cells may attract inflammatory cells [76]. Hence, maintaining a balance in inflammation and apoptosis is vital for liver health. In our study, we observed that the anti-inflammatory and anti-apoptotic effects exerted by probiotics seemed linked to their protective role against pathogen infections in fish. Specifically, the downregulation of pro-inflammatory and pro-apoptotic genes in the liver correlated with improved fish survival following V. harveyi infection. In the BS group, four pro-inflammatory genes (tlr22, tnfα, myd88, p65) and three pro-apoptotic genes (bax, caspase3, caspase9) were significantly downregulated compared to the control group (p < 0.05). Similarly, in the 6-3-1 group, the expression of one pro-inflammatory gene (myd88, p65) and one pro-apoptotic gene (bax) was markedly reduced (p < 0.01). Notably, both BS and 6-3-1 groups showed significant improvements in survival rates post-V. harveyi infection, indicating that downregulating pro-inflammatory and pro-apoptotic genes might enhance survival capabilities after infection. Conversely, the HAINUP40 group displayed upregulation in both pro-inflammatory and pro-apoptotic genes, coupled with the downregulation of anti-apoptotic genes (p < 0.05), yet survival rates in this group did not significantly differ from the control group. The contrast between the HAINUP40 and BS strains is intriguing: HAINUP40 showed the most substantial effects in promoting growth and upregulating lipid metabolic genes but did not offer protection against pathogen infection. In contrast, the BS strain, despite exhibiting the least growth-promoting effects and nonsignificant regulatory impact on lipid metabolic genes, demonstrated the strongest protective effects against pathogen infection and inflammation/apoptosis. This suggested that some probiotic strains might enhance host fish disease resistance without significantly promoting growth [49]. Within the three strains, host-derived 6-3-1 displayed the best overall benefits: growth promoting, disease protective, and anti-inflammatory/apoptotic. The all-around benefits of host-derived B. subtilis strains were also reported in [48,58], where two other B. subtilis strains—GPSAK9 and 7k—not only significantly improved the growth performance of hybrid grouper, but also significantly enhanced fish resistance against V. harvey (strain GPSAK9) and Singapore grouper iridovirus (strain 7k). But disparity also exists. GPSAK9 and 7k were reported to significantly upregulate the expression of inflammatory genes (tgfβ by strain GPSAK9 and ilβ and tnfα by strain 7k), while as 6-3-1 downregulated inflammatory genes (myd88, p65) [48,58]. Because the number of immune-related genes was quite limited in each study, it is difficult to tell whether the disparities in the above studies were due to the different function mechanisms of specific probiotic strains or not. Further research is needed to confirm the link between a given mechanism and the benefits.

5. Conclusions

This study rigorously evaluated the effects and functional mechanisms of three B. subtilis strains, each derived from different sources, on hybrid grouper. Over a six-week supplementation period, these strains demonstrated diverse benefits, including enhanced growth, liver health improvement, boosted antioxidant capacity, optimized lipid metabolism, and reduced inflammation and apoptosis. Notably, they also enhanced disease resistance against V. harveyi. Among the strains, 6-3-1, the sole host-derived probiotic, exhibited the most comprehensive benefits, significantly enhancing both growth and disease resistance. The BS strain stood out for its superior antioxidative and antidisease capabilities, while the HAINUP40 strain excelled in promoting growth. Our findings highlighted the distinct modulatory impacts that different strains of the same bacterial species can have on host fish. The superior efficacy of the host-derived 6-3-1 strain underlined the potential benefits of host-specific probiotics. However, the study also indicated the necessity for further research involving a broader range of probiotic strains and host species. Such comprehensive studies are essential to conclusively ascertain the advantages of host-derived probiotics over those from other sources. In conclusion, this investigation not only advances our understanding of probiotic applications in aquaculture but also underscores the importance of tailored probiotic strategies for enhancing fish health and productivity, thereby contributing valuable insights to the field of fish and shellfish immunology.

Author Contributions

C.H. and S.S.: conceptualization, data curation, formal analysis, and investigation; C.C.: funding acquisition, investigation, and methodology; Y.Z. and J.W.: project administration and software; W.B.: visualization and supervision; D.Z.: funding acquisition; W.G.: supervision; Y.C., S.W. and C.H.: resources, software, visualization, original draft, and review and editing. All authors have read and agreed to the published version of the manuscript.

Funding

This research was supported by the Hainan Provincial Natural Science Foundation of China (Grant No. 324CXTD423) and the National Natural Science Foundation of China (Grant No. 31860739).

Institutional Review Board Statement

The experimental protocols for this study were reviewed and approved by the Animal Care and Utilization Committee of Hainan University (protocol code: HNUAUCC-2020-00011 and date of approval: 3 January 2019). All procedures involving animal experiments and sample collection were conducted strictly in accordance with relevant guidelines.

Informed Consent Statement

Not applicable.

Data Availability Statement

For additional information or clarification, readers are encouraged to contact the authors directly.

Conflicts of Interest

The authors declare no conflicts of interest.

Abbreviations

IBWinitial body weightALTalanine aminotransferase
FBWfinal body weightASTaspartate aminotransferase
FIfeed intakeCATcatalase
FERfeed efficiency rateT-AOCtotal antioxidant capacity
FCRfeed conversion rateGSH-Pxglutathione peroxidase
WGRweight gain rateMDAmalondialdehyde
ucp2mitochondrial uncoupling protein 2il-1βinterleukin-1 beta
acc1acetyl coenzyme a carboxylase 1bcl-2b-cell lymphoma 2
atgladipose triglyceride lipasetlr22toll-like receptor 22
aco1acyl-CoA oxidase1V. harveyiVibrio harveyi
fasfatty acid synthaseO. niloticusOreochromis niloticus
g6pdglucose 6-phosphate dehydrogenaseB. subtilisBacillus subtilis
dgat2diacylgycerol acyltransferase 2
c/ebpαCCAAT/enhancer binding protein α
tgfβtransforming growth factor beta
myd88myeloid differentiation primary response 88
p65nuclear factor kappa b subunit p65
tnfαtumor necrosis factor alpha
baxbcl2 associated x, apoptosis regulator
caspase3apoptosis-related cysteine peptidase
caspase9apoptosis-related cysteine peptidase
cpt1carnitine palmitoyltransferase1
lpllipoprotein lipase
pparαperoxisome proliferator-activated receptor alpha
srebp-1csterol regulatory element binding protein-1

References

  1. Pauly, D.; Zeller, D. Comments on FAOs state of world fisheries and aquaculture (SOFIA 2016). Mar. Policy 2017, 77, 176–181. [Google Scholar] [CrossRef]
  2. Zhang, W.; Belton, B.; Edwards, P.; Henriksson, P.J.; Little, D.C.; Newton, R.; Troell, M. Aquaculture will continue to depend more on land than sea. Nature 2022, 603, E2–E4. [Google Scholar] [CrossRef] [PubMed]
  3. Naylor, R.L.; Hardy, R.W.; Buschmann, A.H.; Bush, S.R.; Cao, L.; Klinger, D.H.; Little, D.C.; Lubchenco, J.; Shumway, S.E.; Troell, M. A 20-year retrospective review of global aquaculture. Nature 2021, 591, 551–563. [Google Scholar] [CrossRef] [PubMed]
  4. Loh, J.Y.; Chan, H.K.; Yam, H.C.; In, L.L.A.; Lim, C.S.Y. An overview of the immunomodulatory effects exerted by probiotics and prebiotics in grouper fish. Aquac. Int. 2019, 28, 729–750. [Google Scholar] [CrossRef]
  5. Liu, Y.; Lv, H.; Xu, L.; Zhang, K.; Mei, Y.; Chen, J.; Wang, M.; Guan, Y.; Pang, H.; Wang, Y. The effect of dietary lactic acid bacteria on intestinal microbiota and immune responses of crucian carp (Carassius auratus) under water temperature decrease. Front. Microbiol. 2022, 13, 847167. [Google Scholar] [CrossRef] [PubMed]
  6. Rohani, M.F.; Islam, S.M.; Hossain, M.K.; Ferdous, Z.; Siddik, M.A.; Nuruzzaman, M.; Padeniya, U.; Brown, C.; Shahjahan, M. Probiotics, prebiotics and synbiotics improved the functionality of aquafeed: Upgrading growth, reproduction, immunity and disease resistance in fish. Fish Shellfish Immunol. 2022, 120, 569–589. [Google Scholar] [CrossRef] [PubMed]
  7. Mohd Faudzi, N.; Yong, A.S.K.; Shapawi, R.; Senoo, S.; Biswas, A.; Takii, K. Soy protein concentrate as an alternative in replacement of fish meal in the feeds of hybrid grouper, brown-marbled grouper (Epinephelus fuscoguttatus) × giant grouper (E. lanceolatus) juvenile. Aquac. Res. 2018, 49, 431–441. [Google Scholar] [CrossRef]
  8. Bunlipatanon, P.; U-taynapun, K. Growth performance and disease resistance against Vibrio vulnificus infection of novel hybrid grouper (Epinephelus lanceolatus × Epinephelus fuscoguttatus). Aquac. Res. 2017, 48, 1711–1723. [Google Scholar] [CrossRef]
  9. Sun, Y.; Guo, C.Y.; Wang, D.D.; Li, X.F.; Xiao, L.; Zhang, X.; You, X.; Shi, Q.; Hu, G.J.; Fang, C.; et al. Transcriptome analysis reveals the molecular mechanisms underlying growth superiority in a novel grouper hybrid (Epinephelus fuscogutatusfemale symbol × E. lanceolatusmale symbol). BMC Genet. 2016, 17, 24. [Google Scholar] [CrossRef]
  10. Hai, N.V. The use of probiotics in aquaculture. J. Appl. Microbiol. 2015, 119, 917–935. [Google Scholar] [CrossRef]
  11. Van Doan, H.; Hoseinifar, S.H.; Khanongnuch, C.; Kanpiengjai, A.; Unban, K.; Van Kim, V.; Srichaiyo, S. Host-associated probiotics boosted mucosal and serum immunity, disease resistance and growth performance of Nile tilapia (Oreochromis niloticus). Aquaculture 2018, 491, 94–100. [Google Scholar] [CrossRef]
  12. Kavitha, M.; Raja, M.; Perumal, P. Evaluation of probiotic potential of Bacillus spp. isolated from the digestive tract of freshwater fish Labeo calbasu (Hamilton, 1822). Aquac. Rep. 2018, 11, 59–69. [Google Scholar] [CrossRef]
  13. Kuebutornye, F.K.A.; Abarike, E.D.; Lu, Y. A review on the application of Bacillus as probiotics in aquaculture. Fish Shellfish Immunol. 2019, 87, 820–828. [Google Scholar] [CrossRef] [PubMed]
  14. Loh, J.Y.; Lim, Y.Y.; Harmin, S.A.; Ting, A.S.Y. In vitro assessment on intestinal microflora from commonly farmed fishes for control of the fish pathogen Edwardsiella tarda. Turk. J. Vet. Anim. Sci. 2014, 38, 257–263. [Google Scholar] [CrossRef]
  15. Harikrishnan, R.; Kim, J.-S.; Kim, M.-C.; Balasundaram, C.; Heo, M.-S. Lactuca indica extract as feed additive enhances immunological parameters and disease resistance in Epinephelus bruneus to Streptococcus iniae. Aquaculture 2011, 318, 43–47. [Google Scholar] [CrossRef]
  16. Dawood, M.A.O.; Koshio, S.; Abdel-Daim, M.M.; Van Doan, H. Probiotic application for sustainable aquaculture. Rev. Aquac. 2019, 11, 907–924. [Google Scholar] [CrossRef]
  17. Hasan, M.T.; Je Jang, W.; Lee, J.M.; Lee, B.-J.; Hur, S.W.; Gu Lim, S.; Kim, K.W.; Han, H.-S.; Kong, I.-S. Effects of Immunostimulants, Prebiotics, Probiotics, Synbiotics, and Potentially Immunoreactive Feed Additives on Olive Flounder (Paralichthys olivaceus): A Review. Rev. Fish. Sci. Aquac. 2019, 27, 417–437. [Google Scholar] [CrossRef]
  18. Wang, J.; Wang, Y.; Zhang, E.; Zhou, M.; Lin, J.; Yang, Q. Intranasal administration with recombinant Bacillus subtilis induces strong mucosal immune responses against pseudorabies. Microb. Cell Factories 2019, 18, 1–11. [Google Scholar] [CrossRef] [PubMed]
  19. Docando, F.; Nuñez-Ortiz, N.; Gonçalves, G.; Serra, C.R.; Gomez-Casado, E.; Martín, D.; Abós, B.; Oliva-Teles, A.; Tafalla, C.; Díaz-Rosales, P. Bacillus subtilis Expressing the Infectious Pancreatic Necrosis Virus VP2 Protein Retains Its Immunostimulatory Properties and Induces a Specific Antibody Response. Front. Immunol. 2022, 13, 888311. [Google Scholar] [CrossRef]
  20. Zhang, W.; Tong, Q.; You, J.; Lv, X.; Liu, Z.; Ni, L. The application of Bacillus subtilis for adhesion inhibition of Pseudomonas and preservation of fresh fish. Foods 2021, 10, 3093. [Google Scholar] [CrossRef]
  21. Li, C.; Li, Y.; Li, S.; Chen, S.; Liu, G.; Deng, X.; Chang, W.; Cai, H. Bacillus subtilis Protects the Ducks from Oxidative Stress Induced by Escherichia coli: Efficacy and Molecular Mechanism. Antioxidants 2022, 11, 1951. [Google Scholar] [CrossRef] [PubMed]
  22. Xu, L.; Yuan, J.; Chen, X.; Zhang, S.; Xie, M.; Chen, C.; Wu, Z. Screening of intestinal probiotics and the effects of feeding probiotics on the digestive enzyme activity, immune, intestinal flora and WSSV resistance of Procambarus clarkii. Aquaculture 2021, 540, 736748. [Google Scholar] [CrossRef]
  23. Butt, U.D.; Lin, N.; Akhter, N.; Siddiqui, T.; Li, S.; Wu, B. Overview of the latest developments in the role of probiotics, prebiotics and synbiotics in shrimp aquaculture. Fish Shellfish Immunol. 2021, 114, 263–281. [Google Scholar] [CrossRef] [PubMed]
  24. El-Saadony, M.T.; Alagawany, M.; Patra, A.K.; Kar, I.; Tiwari, R.; Dawood, M.A.O.; Dhama, K.; Abdel-Latif, H.M.R. The functionality of probiotics in aquaculture: An overview. Fish Shellfish Immunol. 2021, 117, 36–52. [Google Scholar] [CrossRef] [PubMed]
  25. van Baarlen, P.; Troost, F.; van der Meer, C.; Hooiveld, G.; Boekschoten, M.; Brummer, R.J.; Kleerebezem, M. Human mucosal in vivo transcriptome responses to three lactobacilli indicate how probiotics may modulate human cellular pathways. Proc. Natl. Acad. Sci. USA 2011, 108, 4562–4569. [Google Scholar] [CrossRef] [PubMed]
  26. Jørgensen, M.R.; Kragelund, C.; Jensen, P.Ø.; Keller, M.K.; Twetman, S. Probiotic Lactobacillus reuteri has antifungal effects on oral Candida species in vitro. J. Oral Microbiol. 2017, 9, 1274582. [Google Scholar] [CrossRef] [PubMed]
  27. Ramakrishna, B. Probiotic-induced changes in the intestinal epithelium: Implications in gastrointestinal disease. Trop. Gastroenterol. 2009, 30, 76–85. [Google Scholar] [PubMed]
  28. Drago, L.; Nicola, L.; Iemoli, E.; Banfi, G.; De Vecchi, E. Strain-dependent release of cytokines modulated by Lactobacillus salivarius human isolates in an in vitro model. BMC Res. Notes 2010, 3, 44. [Google Scholar] [CrossRef] [PubMed]
  29. Susanti, D.; Volland, A.; Tawari, N.; Baxter, N.; Gangaiah, D.; Plata, G.; Nagireddy, A.; Hawkins, T.; Mane, S.P.; Kumar, A. Multi-Omics characterization of host-derived Bacillus spp. probiotics for improved growth performance in poultry. Front. Microbiol. 2021, 12, 747845. [Google Scholar] [CrossRef]
  30. Tian, L.J.; Zhu, W.W.; Cai, Y.; Zhang, D.D.; Jiang, L.; Zhang, Q.; Guan, B.Y.; Wang, S.F. Screening and potential probiotic effects of Bacillus from shrimp paste. J. Hainan Univ. 2021, 39, 570228. (In Chinese) [Google Scholar] [CrossRef]
  31. Liao, J.; Cai, Y.; Wang, X.; Shang, C.; Zhang, Q.; Shi, H.; Wang, S.; Zhang, D.; Zhou, Y. Effects of a Potential Host Gut-Derived Probiotic, Bacillus subtilis 6-3-1, on the Growth, Non-specific Immune Response and Disease Resistance of Hybrid Grouper (Epinephelus fuscoguttatus♀ × Epinephelus lanceolatus♂). Probiotics Antimicrob. Proteins 2021, 13, 1119–1137. [Google Scholar] [CrossRef]
  32. Liu, H.; Wang, S.; Cai, Y.; Guo, X.; Cao, Z.; Zhang, Y.; Liu, S.; Yuan, W.; Zhu, W.; Zheng, Y.; et al. Dietary administration of Bacillus subtilis HAINUP40 enhances growth, digestive enzyme activities, innate immune responses and disease resistance of tilapia, Oreochromis niloticus. Fish Shellfish Immunol. 2017, 60, 326–333. [Google Scholar] [CrossRef]
  33. Xu, X.; Liu, K.; Wang, S.; Guo, W.; Xie, Z.; Zhou, Y. Identification of pathogenicity, investigation of virulent gene distribution and development of a virulent strain-specific detection PCR method for Vibrio harveyi isolated from Hainan Province and Guangdong Province, China. Aquaculture 2017, 468, 226–234. [Google Scholar] [CrossRef]
  34. Abdelhamid, A.F.; Ayoub, H.F.; Abd El-Gawad, E.A.; Abdelghany, M.F.; Abdel-Tawwab, M. Potential effects of dietary seaweeds mixture on the growth performance, antioxidant status, immunity response, and resistance of striped catfish (Pangasianodon hypophthalmus) against Aeromonas hydrophila infection. Fish Shellfish Immunol. 2021, 119, 76–83. [Google Scholar] [CrossRef] [PubMed]
  35. Farsani, M.N.; Hoseinifar, S.H.; Rashidian, G.; Farsani, H.G.; Ashouri, G.; Van Doan, H. Dietary effects of Coriandrum sativum extract on growth performance, physiological and innate immune responses and resistance of rainbow trout (Oncorhynchus mykiss) against Yersinia ruckeri. Fish Shellfish Immunol. 2019, 91, 233–240. [Google Scholar] [CrossRef]
  36. Ahmadifar, E.; Pourmohammadi Fallah, H.; Yousefi, M.; Dawood, M.A.; Hoseinifar, S.H.; Adineh, H.; Yilmaz, S.; Paolucci, M.; Doan, H.V. The gene regulatory roles of herbal extracts on the growth, immune system, and reproduction of fish. Animals 2021, 11, 2167. [Google Scholar] [CrossRef]
  37. Ghafarifarsani, H.; Hoseinifar, S.H.; Javahery, S.; Van Doan, H. Effects of dietary vitamin C, thyme essential oil, and quercetin on the immunological and antioxidant status of common carp (Cyprinus carpio). Aquaculture 2022, 553, 738053. [Google Scholar] [CrossRef]
  38. Abdel-Latif, H.M.; Shukry, M.; Noreldin, A.E.; Ahmed, H.A.; El-Bahrawy, A.; Ghetas, H.A.; Khalifa, E. Milk thistle (Silybum marianum) extract improves growth, immunity, serum biochemical indices, antioxidant state, hepatic histoarchitecture, and intestinal histomorphometry of striped catfish, Pangasianodon hypophthalmus. Aquaculture 2023, 562, 738761. [Google Scholar] [CrossRef]
  39. Abdel-Latif, H.M.; Yilmaz, E.; Dawood, M.A.; Ringø, E.; Ahmadifar, E.; Yilmaz, S. Shrimp vibriosis and possible control measures using probiotics, postbiotics, prebiotics, and synbiotics: A review. Aquaculture 2022, 551, 737951. [Google Scholar] [CrossRef]
  40. Yilmaz, S.; Yilmaz, E.; Dawood, M.A.; Ringø, E.; Ahmadifar, E.; Abdel-Latif, H.M. Probiotics, prebiotics, and synbiotics used to control vibriosis in fish: A review. Aquaculture 2022, 547, 737514. [Google Scholar] [CrossRef]
  41. Kim, S.; Shin, Y.-C.; Kim, T.-Y.; Kim, Y.; Lee, Y.-S.; Lee, S.-H.; Kim, M.-N.; O, E.; Kim, K.S.; Kweon, M.-N. Mucin degrader Akkermansia muciniphila accelerates intestinal stem cell-mediated epithelial development. Gut Microbes 2021, 13, 1892441. [Google Scholar] [CrossRef]
  42. Jin, W.; Jiang, L.; Hu, S.; Zhu, A. Effects of Lactobacillus plantarum and Bacillus subtilis on growth, immunity and intestinal flora of largemouth bass (Micropterus salmoides). Aquaculture 2024, 583, 740581. [Google Scholar] [CrossRef]
  43. Ji, Z.; Zhu, C.; Zhu, X.; Ban, S.; Yu, L.; Tian, J.; Dong, L.; Wen, H.; Lu, X.; Jiang, M. Dietary host-associated Bacillus subtilis supplementation improves intestinal microbiota, health and disease resistance in Chinese perch (Siniperca chuatsi). Anim. Nutr. 2023, 13, 197–205. [Google Scholar] [CrossRef]
  44. Wang, Y.; Wang, Q.; Xing, K.; Jiang, P.; Wang, J. Dietary cinnamaldehyde and Bacillus subtilis improve growth performance, digestive enzyme activity, and antioxidant capability and shape intestinal microbiota in tongue sole, Cynoglossus semilaevis. Aquaculture 2021, 531, 735798. [Google Scholar] [CrossRef]
  45. Ai, Q.; Xu, H.; Mai, K.; Xu, W.; Wang, J.; Zhang, W. Effects of dietary supplementation of Bacillus subtilis and fructooligosaccharide on growth performance, survival, non-specific immune response and disease resistance of juvenile large yellow croaker, Larimichthys crocea. Aquaculture 2011, 317, 155–161. [Google Scholar] [CrossRef]
  46. Shi, F.; Zi, Y.; Lu, Z.; Li, F.; Yang, M.; Zhan, F.; Li, Y.; Li, J.; Zhao, L.; Lin, L. Bacillus subtilis H2 modulates immune response, fat metabolism and bacterial flora in the gut of grass carp (Ctenopharyngodon idellus). Fish Shellfish Immunol. 2020, 106, 8–20. [Google Scholar] [CrossRef] [PubMed]
  47. Liao, Z.; Liu, Y.; Wei, H.; He, X.; Wang, Z.; Zhuang, Z.; Zhao, W.; Masagounder, K.; He, J.; Niu, J. Effects of dietary supplementation of Bacillus subtilis DSM 32315 on growth, immune response and acute ammonia stress tolerance of Nile tilapia (Oreochromis niloticus) fed with high or low protein diets. Anim. Nutr. 2023, 15, 375–385. [Google Scholar] [CrossRef]
  48. Amoah, K.; Tan, B.; Zhang, S.; Chi, S.; Yang, Q.; Liu, H.; Yang, Y.; Zhang, H.; Dong, X. Host gut-derived Bacillus probiotics supplementation improves growth performance, serum and liver immunity, gut health, and resistive capacity against Vibrio harveyi infection in hybrid grouper (♀ Epinephelus fuscoguttatus×♂ E. lanceolatus). Anim. Nutr. 2023, 14, 163–184. [Google Scholar] [CrossRef] [PubMed]
  49. Thy, H.T.T.; Tri, N.N.; Quy, O.M.; Fotedar, R.; Kannika, K.; Unajak, S.; Areechon, N. Effects of the dietary supplementation of mixed probiotic spores of Bacillus amyloliquefaciens 54A, and Bacillus pumilus 47B on growth, innate immunity and stress responses of striped catfish (Pangasianodon hypophthalmus). Fish Shellfish Immunol. 2017, 60, 391–399. [Google Scholar]
  50. Adams, S.; Ham, K.; Greeley, M.; LeHew, R.; Hinton, D.; Saylor, C. Downstream gradients in bioindicator responses: Point source contaminant effects on fish health. Can. J. Fish. Aquat. Sci. 1996, 53, 2177–2187. [Google Scholar] [CrossRef]
  51. Gao, Y.-J.; Yang, H.-J.; Liu, Y.-J.; Chen, S.-J.; Guo, D.-Q.; Yu, Y.-Y.; Tian, L.-X. Effects of graded levels of threonine on growth performance, biochemical parameters and intestine morphology of juvenile grass carp Ctenopharyngodon idella. Aquaculture 2014, 424–425, 113–119. [Google Scholar] [CrossRef]
  52. Gabriel, U.; George, A. Plasma enzymes in Clarias gariepinus exposed to chronic levels of round up (glyphosate). Environ. Ecol. 2005, 23, 271–276. [Google Scholar]
  53. Sagada, G.; Gray, N.; Wang, L.; Xu, B.; Zheng, L.; Zhong, Z.; Ullah, S.; Tegomo, A.F.; Shao, Q. Effect of dietary inactivated Lactobacillus plantarum on growth performance, antioxidative capacity, and intestinal integrity of black sea bream (Acanthopagrus schlegelii) fingerlings. Aquaculture 2021, 535, 736370. [Google Scholar] [CrossRef]
  54. Chillemi, G.; De Santis, S.; Falconi, M.; Mancini, G.; Migliorati, V.; Battistoni, A.; Pacello, F.; Desideri, A.; D’Angelo, P. Carbon monoxide binding to the heme group at the dimeric interface modulates structure and copper accessibility in the Cu, Zn superoxide dismutase from Haemophilus ducreyi: In silico and in vitro evidences. J. Biomol. Struct. Dyn. 2012, 30, 269–279. [Google Scholar] [CrossRef] [PubMed]
  55. Ahmad, P. Oxidative Damage to Plants: Antioxidant Networks and Signaling; Academic Press: Cambridge, MA, USA, 2014. [Google Scholar]
  56. Brigelius-Flohe, R.; Maiorino, M. Glutathione peroxidases. Biochim. Biophys. Acta 2013, 1830, 3289–3303. [Google Scholar] [CrossRef] [PubMed]
  57. Zhang, Y.; Wang, J.; Gong, X.; Chen, L.; Zhang, B.; Wang, Q.; Han, B.; Zhang, N.; Xue, F.; Vedal, S. Ambient PM2. 5 exposures and systemic biomarkers of lipid peroxidation and total antioxidant capacity in early pregnancy. Environ. Pollut. 2020, 266, 115301. [Google Scholar] [CrossRef]
  58. Zhou, S.; Song, D.; Zhou, X.; Mao, X.; Zhou, X.; Wang, S.; Wei, J.; Huang, Y.; Wang, W.; Xiao, S.-M. Characterization of Bacillus subtilis from gastrointestinal tract of hybrid Hulong grouper (Epinephelus fuscoguttatus × E. lanceolatus) and its effects as probiotic additives. Fish Shellfish Immunol. 2019, 84, 1115–1124. [Google Scholar] [CrossRef] [PubMed]
  59. Wang, J.; Liao, B.; Wang, C.; Zhong, O.; Lei, X.; Yang, Y. Effects of Antioxidant Supplementation on Metabolic Disorders in Obese Patients from Randomized Clinical Controls: A Meta-Analysis and Systematic Review. Oxidative Med. Cell. Longev. 2022, 2022, 7255413. [Google Scholar] [CrossRef]
  60. Liu, B.; Zhang, J.; Sun, P.; Yi, R.; Han, X.; Zhao, X. Raw bowl tea (Tuocha) polyphenol prevention of nonalcoholic fatty liver disease by regulating intestinal function in mice. Biomolecules 2019, 9, 435. [Google Scholar] [CrossRef]
  61. Hu, J.-P.; Zheng, T.-T.; Zeng, B.-F.; Wu, M.-L.; Shi, R.; Zhang, Y.; Chen, L.-J.; Cheng, W.-J.; Liang, P. Effects of Lactobacillus plantarum FZU3013-fermented Laminaria japonica on lipid metabolism and gut microbiota in hyperlipidaemic rats. Front. Nutr. 2021, 8, 786571. [Google Scholar] [CrossRef]
  62. Qian, Y.; Li, X.-F.; Zhang, D.-D.; Cai, D.-S.; Tian, H.-Y.; Liu, W.-B. Effects of dietary pantothenic acid on growth, intestinal function, anti-oxidative status and fatty acids synthesis of juvenile blunt snout bream Megalobrama amblycephala. PLoS ONE 2015, 10, e0119518. [Google Scholar] [CrossRef]
  63. Madduma Hewage, S.; Au-Yeung, K.K.; Prashar, S.; Wijerathne, C.U.; O, K.; Siow, Y.L. Lingonberry Improves Hepatic Lipid Metabolism by Targeting Notch1 Signaling. Antioxidants 2022, 11, 472. [Google Scholar] [CrossRef] [PubMed]
  64. Lu, K.-L.; Xu, W.-N.; Wang, L.-N.; Zhang, D.-D.; Zhang, C.-N.; Liu, W.-B. Hepatic β-oxidation and regulation of carnitine palmitoyltransferase (CPT) I in blunt snout bream Megalobrama amblycephala fed a high fat diet. PLoS ONE 2014, 9, e93135. [Google Scholar] [CrossRef] [PubMed]
  65. Zhang, W.; Bu, S.Y.; Mashek, M.T.; InSug, O.; Sibai, Z.; Khan, S.A.; Ilkayeva, O.; Newgard, C.B.; Mashek, D.G.; Unterman, T.G. Integrated regulation of hepatic lipid and glucose metabolism by adipose triacylglycerol lipase and FoxO proteins. Cell Rep. 2016, 15, 349–359. [Google Scholar] [CrossRef]
  66. Wang, A.; Meng, D.; Hao, Q.; Xia, R.; Zhang, Q.; Ran, C.; Yang, Y.; Li, D.; Liu, W.; Zhang, Z. Effect of supplementation of solid-state fermentation product of Bacillus subtilis HGcc-1 to high-fat diet on growth, hepatic lipid metabolism, epidermal mucus, gut and liver health and gut microbiota of zebrafish. Aquaculture 2022, 560, 738542. [Google Scholar] [CrossRef]
  67. Saera-Vila, A.; Calduch-Giner, J.A.; Gómez-Requeni, P.; Médale, F.; Kaushik, S.; Pérez-Sánchez, J. Molecular characterization of gilthead sea bream (Sparus aurata) lipoprotein lipase. Transcriptional regulation by season and nutritional condition in skeletal muscle and fat storage tissues. Comp. Biochem. Physiol. Part. B Biochem. Mol. Biol. 2005, 142, 224–232. [Google Scholar] [CrossRef]
  68. Guo, Q.; Zhang, L.; Yin, Y.; Gong, S.; Yang, Y.; Chen, S.; Han, M.; Duan, Y. Taurine Attenuates Oxidized Fish Oil-Induced Oxidative Stress and Lipid Metabolism Disorder in Mice. Antioxidants 2022, 11, 1391. [Google Scholar] [CrossRef]
  69. Zou, C.; Fang, Y.; Lin, N.; Liu, H. Polysaccharide extract from pomelo fruitlet ameliorates diet-induced nonalcoholic fatty liver disease in hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀). Fish Shellfish Immunol. 2021, 119, 114–127. [Google Scholar] [CrossRef] [PubMed]
  70. Zou, C.; Du, L.; Wu, J.; Gan, S.; Li, Q.; Babu, V.S.; Wu, Y.; Lin, L. Saikosaponin d alleviates high-fat-diet induced hepatic steatosis in hybrid grouper (Epinephelus lanceolatus♂ × Epinephelus fuscoguttatus♀) by targeting AMPK/PPARα pathway. Aquaculture 2022, 553, 738088. [Google Scholar] [CrossRef]
  71. Barisón, M.J.; Pereira, I.T.; Waloski Robert, A.; Dallagiovanna, B. Reorganization of Metabolism during Cardiomyogenesis Implies Time-Specific Signaling Pathway Regulation. Int. J. Mol. Sci. 2021, 22, 1330. [Google Scholar] [CrossRef]
  72. Berrocal, A.; Lammers, N.C.; Garcia, H.G.; Eisen, M.B. Kinetic sculpting of the seven stripes of the Drosophila even-skipped gene. eLife 2020, 9, e61635. [Google Scholar] [CrossRef] [PubMed]
  73. Hoermann, R.; Pekker, M.J.; Midgley, J.E.; Larisch, R.; Dietrich, J.W. Principles of endocrine regulation: Reconciling tensions between robustness in performance and adaptation to change. Front. Endocrinol. 2022, 13, 825107. [Google Scholar] [CrossRef] [PubMed]
  74. Qiu, S.; Liu, T.; Piao, C.; Wang, Y.; Wang, K.; Zhou, Y.; Cai, L.; Zheng, S.; Lan, F.; Du, J. AMPKα2 knockout enhances tumour inflammation through exacerbated liver injury and energy deprivation-associated AMPKα1 activation. J. Cell. Mol. Med. 2019, 23, 1687–1697. [Google Scholar] [CrossRef] [PubMed]
  75. Deng, Y.; Zhang, Y.; Chen, H.; Xu, L.; Wang, Q.; Feng, J. Gut–liver immune response and gut microbiota profiling reveal the pathogenic mechanisms of vibrio harveyi in pearl gentian grouper (Epinephelus lanceolatus♂ × E. fuscoguttatus♀). Front. Immunol. 2020, 11, 607754. [Google Scholar] [CrossRef]
  76. Guicciardi, M.; Gores, G. Apoptosis: A mechanism of acute and chronic liver injury. Gut 2005, 54, 1024–1033. [Google Scholar] [CrossRef]
Animals 14 01062 g001
Figure 1. Effects of three B. subtilis strains on liver function enzyme activities of hybrid grouper after six-week feeding trial. (A) aspartate aminotransferase (AST), (B) alanine aminotransferase (ALT). Control: control group; BS: BS strain supplemented group; 6-3-1: 6-3-1 strain supplemented group; HAINUP40: HAINUP40 strain supplemented group. The values are presented as mean ± SEM (n = 9). Columns marked with different letters (a, b, c) indicate statistically significant differences between groups, as determined by ANOVA and Tukey’s test (p < 0.05).
Figure 1. Effects of three B. subtilis strains on liver function enzyme activities of hybrid grouper after six-week feeding trial. (A) aspartate aminotransferase (AST), (B) alanine aminotransferase (ALT). Control: control group; BS: BS strain supplemented group; 6-3-1: 6-3-1 strain supplemented group; HAINUP40: HAINUP40 strain supplemented group. The values are presented as mean ± SEM (n = 9). Columns marked with different letters (a, b, c) indicate statistically significant differences between groups, as determined by ANOVA and Tukey’s test (p < 0.05).
Animals 14 01062 g001
Animals 14 01062 g002aAnimals 14 01062 g002b
Figure 2. Effects of three B. subtilis strains on the antioxidant capacities of hybrid grouper. (A) catalase (CAT), (B) glutathione peroxidase (GSH-PX), (C) total antioxidant capacity (T-AOC), and (D) malondial dehyde (MDA). Control: control group; BS: BS strain supplemented group; 6-3-1: 6-3-1 strain supplemented group; HAINUP40: HAINUP40 strain supplemented group. The values are presented as mean ± SEM (n = 9). Columns marked with different letters (a, b, c) indicate statistically significant differences between groups, as determined by ANOVA and Tukey’s test (p < 0.05).
Figure 2. Effects of three B. subtilis strains on the antioxidant capacities of hybrid grouper. (A) catalase (CAT), (B) glutathione peroxidase (GSH-PX), (C) total antioxidant capacity (T-AOC), and (D) malondial dehyde (MDA). Control: control group; BS: BS strain supplemented group; 6-3-1: 6-3-1 strain supplemented group; HAINUP40: HAINUP40 strain supplemented group. The values are presented as mean ± SEM (n = 9). Columns marked with different letters (a, b, c) indicate statistically significant differences between groups, as determined by ANOVA and Tukey’s test (p < 0.05).
Animals 14 01062 g002aAnimals 14 01062 g002b
Animals 14 01062 g003aAnimals 14 01062 g003bAnimals 14 01062 g003c
Figure 3. Effects of three B. subtilis strains on immunity-related gene expression in hybrid grouper liver. (A) il-1β: interleukin-1 beta, (B) tnfα: tumor necrosis factor alpha, (C) tlr22: toll-like receptor 22, (D) myd88: myeloid differentiation primary response 88, (E) p65: nuclear factor kappa b subunit p65, (F) bcl-2: b-cell lymphoma 2, (G) bax: bcl2 associated x, apoptosis regulator, (H) caspase3: apoptosis-related cysteine peptidase, (I) caspase9: apoptosis-related cysteine peptidase. The notation “ns” indicates no significant differences, whereas “*” marks significant differences. The values are presented as mean ± SEM (n = 9). Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. The experimental groups include the control group (CON), BS strain supplemented group (BS), 6-3-1 strain supplemented group (6-3-1), and HAINUP40 strain supplemented group (HAINUP40).
Figure 3. Effects of three B. subtilis strains on immunity-related gene expression in hybrid grouper liver. (A) il-1β: interleukin-1 beta, (B) tnfα: tumor necrosis factor alpha, (C) tlr22: toll-like receptor 22, (D) myd88: myeloid differentiation primary response 88, (E) p65: nuclear factor kappa b subunit p65, (F) bcl-2: b-cell lymphoma 2, (G) bax: bcl2 associated x, apoptosis regulator, (H) caspase3: apoptosis-related cysteine peptidase, (I) caspase9: apoptosis-related cysteine peptidase. The notation “ns” indicates no significant differences, whereas “*” marks significant differences. The values are presented as mean ± SEM (n = 9). Statistical significance is denoted as * p < 0.05, ** p < 0.01, and *** p < 0.001. The experimental groups include the control group (CON), BS strain supplemented group (BS), 6-3-1 strain supplemented group (6-3-1), and HAINUP40 strain supplemented group (HAINUP40).
Animals 14 01062 g003aAnimals 14 01062 g003bAnimals 14 01062 g003c
Animals 14 01062 g004aAnimals 14 01062 g004bAnimals 14 01062 g004c
Figure 4. Effects of three B. subtilis strains on the expression of lipid metabolism-related genes in hybrid grouper liver. (A) cpt1: carnitine palmitoyltransferase1; (B) lpl: lipoprotein lipase; (C) pparα: peroxisome proliferator-activated receptor alpha; (D) srebp-1c: sterol regulatory element binding protein-1; (E) atgl: adipose triglyceride lipase; (F) aco1: acyl-CoA oxidase1; (G) fas: fatty acid synthase; (H) g6pd: glucose 6-phosphate dehydrogenase; (I) dgat2: diacylgycerol acyltransferase 2. The values are presented as mean ± SEM (n = 9); “ns” represents nonsignificant differences and “*” represents significant differences. * p < 0.05, ** p <0.01, *** p <0.001. Control: control group; BS: BS strain supplemented group; 6-3-1: 6-3-1 strain supplemented group; HAINUP40: HAINUP40 strain supplemented group.
Figure 4. Effects of three B. subtilis strains on the expression of lipid metabolism-related genes in hybrid grouper liver. (A) cpt1: carnitine palmitoyltransferase1; (B) lpl: lipoprotein lipase; (C) pparα: peroxisome proliferator-activated receptor alpha; (D) srebp-1c: sterol regulatory element binding protein-1; (E) atgl: adipose triglyceride lipase; (F) aco1: acyl-CoA oxidase1; (G) fas: fatty acid synthase; (H) g6pd: glucose 6-phosphate dehydrogenase; (I) dgat2: diacylgycerol acyltransferase 2. The values are presented as mean ± SEM (n = 9); “ns” represents nonsignificant differences and “*” represents significant differences. * p < 0.05, ** p <0.01, *** p <0.001. Control: control group; BS: BS strain supplemented group; 6-3-1: 6-3-1 strain supplemented group; HAINUP40: HAINUP40 strain supplemented group.
Animals 14 01062 g004aAnimals 14 01062 g004bAnimals 14 01062 g004c
Animals 14 01062 g005
Figure 5. The survival rate of each group after adding different probiotic groups following the challenge experiment. After the challenge was completed, the survival status of the experimental group was monitored daily and its survival percentage calculated; “*” represents significant differences. * p < 0.05, ** p <0.01. "ns" indicates no significant difference between groups.
Figure 5. The survival rate of each group after adding different probiotic groups following the challenge experiment. After the challenge was completed, the survival status of the experimental group was monitored daily and its survival percentage calculated; “*” represents significant differences. * p < 0.05, ** p <0.01. "ns" indicates no significant difference between groups.
Animals 14 01062 g005
Table 1. Ingredients and approximate composition of basic diet.
Table 1. Ingredients and approximate composition of basic diet.
Ingredients%
Red fishmeal40.00
Casein11.54
Gelatine2.85
Wheat flour20.00
Fish oil4.66
Soy lecithin2.00
Calcium monophosphate1.00
Vitamin premix a0.22
Mineral premix b0.56
Antioxidants0.06
Choline chloride0.50
Vitamin C0.09
Cellulose microcrystalline16.52
Proximate composition (in dry matter)
Crude protein48.86
Crude lipid10.75
Moisture9.58
a vitamin B1: 18.50 g; vitamin B2: 18.67 g; vitamin B6: 32.43 g; vitamin B12: 0.17 g; vitamin K: 3.43 g; vitamin E: 65.95 g; retinyl acetate: 6.77 g; vitamin D: 34.33 g; nicotinic acid: 68.33 g; D-calcium pantothenate: 39.87 g; biotin: 18.53; folic acid: 3.97 g; inositol: 101.04 g; cellulose: 598.62 g; the remaining ingredient was corn starch. b AlCl3·6H2O: 1 g; CoCl2·6H2O: 0.1 g; CaCO3: 350 g; CuCl2·2H2O: 1 g; FeSO4·7H2O: 2 g; KH2PO4: 200 g; MgSO4·7H2O: 10 g; MnSO4·7H2O: 2 g; NaH2PO4·H2O: 200 g; NaCl: 12 g; KF: 1 g; NaMoO4·2H2O: 0.5 g; NaSeO3: 0.4 g; KI: 0.1 g; zeolite powder: 219.9 g.
Table 2. Sequences of primers for qPCR.
Table 2. Sequences of primers for qPCR.
GenePrimer NamePrimer Sequence 5′–3′
atglatgl-FATTGAGCACCTTCCACCCA
atgl-RCCGAATCCATCCCACATCTT
aco-1aco1-FCGGCATGGACTTCCTGTATG
aco1-RCCTGGTGTGCGTGTTGTGTT
fasfas-FCGGGTGTCTACATTGGGGTG
fas-RGAATAGCGTGGAAGGCGTTT
dgat2dgat2-FCATCTTCTGCTTTGGTGCTTTC
dgat2-RGCATTTCCCGTCCCGTTA
g6pdg6pd-FGCTTCACATCCTTGTATCTGCTC
g6pd-RGCGTTCCTTTCATTCTCCG
pparαpparα-FCATCGACAATGACGCCCTC
pparα-RGCCGCTATCCCGTAAACAAC
srebp-1csrebp1c-FAGCTGTTTACACACTCCACTCG
srebp1c-RACTGTGGAAGCTACAGGGCA
cpt1cpt1-FTCCTTACCGTTGGTCCCTCT
cpt1-RCTTTCCATCTGCTGCTCTATCTC
lpllpl-FTTCAACAGCACCTCCAAAACC
lpl-RGTGAGCCAGTCCACCACGAT
il-1βil-1β-FCGACATGGTGCGGTTTC
il-1β-RTCTGTAGCGGCTGGTGG
tnfαtnfα-FGTGGCCTACACGACTGCACC
tnfα-RTACAAAGGGCCACAGTGAGA
tlt22tlr22-FCGAGCCAGGTAAACCCATCA
tlr22-RCTCATCAAACAGGCGGAAGC
myd88myd88-FCGAGCCAGGTAAACCCATCA
myd88-RCTCATCAAACAGGCGGAAGC
p65p65-FGGGTGTGTATGGATGGGG
p65-RTGGCTGGGTGGGTCTTAG
bcl-2bcl-2-FTTAGGTCGCAGTGAGT
bcl-2-RCATAGATGGGGAAGAG
baxbax-FGCCAGCAGCACATCACTTCC
bax-RAGCCACCGTAGTTCAAGCAGTT
caspase3caspase3-FCGCAAAGAGTAGCGACGGA
caspase3-RCGATGCTGGGGAAATTCAGAC
caspase9caspase9-FTTTTCCTGGTTATGTTTCGTGG
caspase9-RTTGCTTGTAGAGCCCTTTTGC
β-actinβ-actin-FTACGAGCTGCCTGACGGACA
β-actin-RGGCTGTGATCTCCTTCTGC
Table 3. Effects of three B. subtilis strains on growth parameters of hybrid grouper after six-week feeding trial.
Table 3. Effects of three B. subtilis strains on growth parameters of hybrid grouper after six-week feeding trial.
ParameterControlBS6-3-1HAINUP40p-Value
IBW, g540.80 ± 23.17531.67 ± 37.51531.33 ± 20.50525.33 ± 28.070.198
FBW, g1344.00 ± 39.40 a1323.33 ± 24.34 a1422.00 ± 14.11 b1435.33 ± 21.55 b<0.001
FI, %755.91 ± 28.64 a592.84 ± 8.88 b547.04 ± 8.19 b553.56 ± 21.57 b<0.001
FER, %106.23 ± 1.08 a133.54 ± 3.60 b162.83 ± 1.81 c164.53 ± 5.75 c<0.001
FCR, %94.00 ± 1.0 a75.00 ± 2.0 b58.00 ± 1.0 c61.00 ± 2.0 c<0.001
WGR, %148.59 ± 8.29 a148.92 ± 4.85 a167.66 ± 2.69 b173.24 ± 1.40 b<0.001
IBW: initial body weight; FBW: final body weight; FI: feed intake; FER: feed efficiency ratio; FCR: feed conversion rates; WGR: weight gain rate. The mean ± SEM is used to present the data. Values that have different superscripts within the same row exhibit significant differences (p < 0.05).
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Han, C.; Song, S.; Cui, C.; Cai, Y.; Zhou, Y.; Wang, J.; Bei, W.; Zhang, D.; Guo, W.; Wang, S. Strain-Specific Benefits of Bacillus Probiotics in Hybrid Grouper: Growth Enhancement, Metabolic Health, Immune Modulation, and Vibrio harveyi Resistance. Animals 2024, 14, 1062. https://doi.org/10.3390/ani14071062

AMA Style

Han C, Song S, Cui C, Cai Y, Zhou Y, Wang J, Bei W, Zhang D, Guo W, Wang S. Strain-Specific Benefits of Bacillus Probiotics in Hybrid Grouper: Growth Enhancement, Metabolic Health, Immune Modulation, and Vibrio harveyi Resistance. Animals. 2024; 14(7):1062. https://doi.org/10.3390/ani14071062

Chicago/Turabian Style

Han, Congjie, Shizhen Song, Congcong Cui, Yan Cai, Yongcan Zhou, Jiawen Wang, Weilie Bei, Dongdong Zhang, Weiliang Guo, and Shifeng Wang. 2024. "Strain-Specific Benefits of Bacillus Probiotics in Hybrid Grouper: Growth Enhancement, Metabolic Health, Immune Modulation, and Vibrio harveyi Resistance" Animals 14, no. 7: 1062. https://doi.org/10.3390/ani14071062

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop