The Effects of Short-Chain Fatty Acids in Gut Immune and Oxidative Responses of European Sea Bass (Dicentrarchus labrax): An Ex Vivo Approach
Abstract
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Bacteria Culture
2.2. Fish Rearing Conditions
2.3. Ex Vivo Trial
2.4. Viability Assay
2.5. Gene Expression
2.6. Statistical Analysis
3. Results
3.1. Viability
3.2. Immune-Related Genes
3.3. Antioxidant-Related Genes
3.4. Energy Metabolism and Free Fatty Acid Receptor-Related Genes
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- El-Sharkawy, E.A.; El-Razek, I.M.A.; Amer, A.A.; Soliman, A.A.; Shukry, M.; Gewaily, M.S.; Téllez-Isaías, G.; Kari, Z.A.; Dawood, M.A.O. Effects of sodium butyrate on the growth performance, digestive enzyme activity, intestinal health, and immune responses of Thinlip Grey Mullet (Liza ramada) juveniles. Aquac. Rep. 2023, 30, 101530. [Google Scholar] [CrossRef]
- Ng, W.-K.; Koh, C.-B. The utilization and mode of action of organic acids in the feeds of cultured aquatic animals. Rev. Aquac. 2016, 9, 342–368. [Google Scholar] [CrossRef]
- Hoseinifar, S.H.; Sun, Y.; Caipang, C.M. Short-chain fatty acids as feed supplements for sustainable aquaculture: An updated view. Aquac. Res. 2016, 48, 1380–1391. [Google Scholar] [CrossRef]
- Lückstädt, C. The use of acidifiers in fish nutrition. CABI Rev. 2008, 8. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Koshio, S.; Esteban, M.Á. Beneficial roles of feed additives as immunostimulants in aquaculture: A review. Rev. Aquac. 2018, 10, 950–974. [Google Scholar] [CrossRef]
- Zhou, W.-H.; Limbu, S.M.; Luo, Y.; Li, R.-X.; Ren, J.; Qiao, F.; Zhang, M.-L.; Du, Z.-Y. Dietary acetate promotes growth and nutrients deposition in Nile tilapia (Oreochromis niloticus) through increasing acetyl-CoA-triggered energy production. Aquaculture 2023, 575, 739750. [Google Scholar] [CrossRef]
- Salinas, I. The Mucosal Immune System of Teleost Fish. Biology 2015, 4, 525–539. [Google Scholar] [CrossRef]
- Knoop, K.A.; Newberry, R.D. Goblet cells: Multifaceted players in immunity at mucosal surfaces. Mucosal Immunol. 2018, 11, 1551–1557. [Google Scholar] [CrossRef] [PubMed]
- Peñaranda, D.S.; Bäuerl, C.; Tomás-Vidal, A.; Jover-Cerdá, M.; Estruch, G.; Pérez Martínez, G.; Martínez Llorens, S. Intestinal Explant Cultures from Gilthead Seabream (Sparus aurata, L.) Allowed the Determination of Mucosal Sensitivity to Bacterial Pathogens and the Impact of a Plant Protein Diet. Int. J. Mol. Sci. 2020, 21, 7584. [Google Scholar] [CrossRef]
- Ng, W.-K.; Koh, C.-B.; Sudesh, K.; Siti-Zahrah, A. Effects of dietary organic acids on growth, nutrient digestibility and gut microflora of red hybrid tilapia, Oreochromis sp., and subsequent survival during a challenge test with Streptococcus agalactiae. Aquac. Res. 2009, 40, 1490–1500. [Google Scholar] [CrossRef]
- Xun, P.; Zhou, C.; Huang, X.; Huang, Z.; Yu, W.; Yang, Y.; Li, T.; Huang, J.; Wu, Y.; Lin, H. Effects of Dietary Sodium Acetate on Growth Performance, Fillet Quality, Plasma Biochemistry, and Immune Function of Juvenile Golden Pompano (Trachinotus ovatus). Aquac. Nutr. 2022, 2022, 9074549. [Google Scholar] [CrossRef]
- Li, M.; Hu, F.-C.; Qiao, F.; Du, Z.-Y.; Zhang, M.-L. Sodium acetate alleviated high-carbohydrate induced intestinal inflammation by suppressing MAPK and NF-κB signaling pathways in Nile tilapia (Oreochromis niloticus). Fish Shellfish Immunol. 2020, 98, 758–765. [Google Scholar] [CrossRef] [PubMed]
- Wassef, E.A.; Saleh, N.E.; Abdel-Meguid, N.E.; Barakat, K.M.; Abdel-Mohsen, H.H.; El-bermawy, N.M. Sodium propionate as a dietary acidifier for European seabass (Dicentrarchus labrax) fry: Immune competence, gut microbiome, and intestinal histology benefits. Aquac. Int. 2019, 28, 95–111. [Google Scholar] [CrossRef]
- Safari, R.; Hoseinifar, S.H.; Kavandi, M. Modulation of antioxidant defense and immune response in zebra fish (Danio rerio) using dietary sodium propionate. Fish Physiol. Biochem. 2016, 42, 1733–1739. [Google Scholar] [CrossRef] [PubMed]
- Hou, D.; Li, M.; Li, P.; Chen, B.; Huang, W.; Guo, H.; Cao, J.; Zhao, H. Effects of sodium butyrate on growth performance, antioxidant status, inflammatory response and resistance to hypoxic stress in juvenile largemouth bass (Micropterus salmoides). Front. Immunol. 2023, 14, 1265963. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Yang, Y.; Zhang, J.; Gatlin, D.M.; Ringø, E.; Zhou, Z. Effects of dietary microencapsulated sodium butyrate on growth, intestinal mucosal morphology, immune response and adhesive bacteria in juvenile common carp (Cyprinus carpio) pre-fed with or without oxidised oil. Br. J. Nutr. 2014, 112, 15–29. [Google Scholar] [CrossRef] [PubMed]
- den Besten, G.; van Eunen, K.; Groen, A.K.; Venema, K.; Reijngoud, D.-J.; Bakker, B.M. The role of short-chain fatty acids in the interplay between diet, gut microbiota, and host energy metabolism. J. Lipid Res. 2013, 54, 2325–2340. [Google Scholar] [CrossRef]
- Zhang, H.; Ding, Q.; Wang, A.; Liu, Y.; Teame, T.; Ran, C.; Yang, Y.; He, S.; Zhou, W.; Olsen, R.E.; et al. Effects of dietary sodium acetate on food intake, weight gain, intestinal digestive enzyme activities, energy metabolism and gut microbiota in cultured fish: Zebrafish as a model. Aquaculture 2020, 523, 735188. [Google Scholar] [CrossRef]
- Dawood, M.A.O.; Eweedah, N.M.; Elbialy, Z.I.; Abdelhamid, A.I. Dietary sodium butyrate ameliorated the blood stress biomarkers, heat shock proteins, and immune response of Nile tilapia (Oreochromis niloticus) exposed to heat stress. J. Therm. Biol. 2020, 88, 102500. [Google Scholar] [CrossRef]
- Miyamoto, J.; Hasegawa, S.; Kasubuchi, M.; Ichimura, A.; Nakajima, A.; Kimura, I. Nutritional Signaling via Free Fatty Acid Receptors. Int. J. Mol. Sci. 2016, 17, 450. [Google Scholar] [CrossRef]
- Silva, B.; do Nascimento Vieira, F.; Mouriño, J.L.; Ferreira, G.; Seiffert, W. Salts of organic acids selection by multiple characteristics for marine shrimp nutrition. Aquaculture 2013, 384–387, 104–110. [Google Scholar] [CrossRef]
- Servili, A.; Bufalino, M.R.; Nishikawa, R.; de Melo, I.S.; Muñoz-Cueto, J.A.; Lee, L.E. Establishment of long term cultures of neural stem cells from adult sea bass, Dicentrarchus labrax. Comp. Biochem. Physiol. Part A Mol. Integr. Physiol. 2009, 152, 245–254. [Google Scholar] [CrossRef]
- Bello, S.A.; García-Arrarás, J.E. Intestine Explants in Organ Culture: A Tool to Broaden the Regenerative Studies in Echinoderms. J. Mar. Sci. Eng. 2022, 10, 244. [Google Scholar] [CrossRef]
- LeClair, E.E. The Last Half Century of Fish Explant and Organ Culture. Zebrafish 2021, 18, 1–19. [Google Scholar] [CrossRef]
- Coccia, E.; Imperatore, R.; Orso, G.; Melck, D.; Varricchio, E.; Volpe, M.G.; Paolucci, M. Explants of Oncorhynchus mykiss intestine to detect bioactive molecules uptake and metabolic effects: Applications in aquaculture. Aquaculture 2019, 506, 193–204. [Google Scholar] [CrossRef]
- Lewis, D.I. Animal experimentation: Implementation and application of the 3Rs. Emerg. Top. Life Sci. 2019, 3, 675–679. [Google Scholar] [CrossRef]
- Sneddon, L.U.; Halsey, L.G.; Bury, N.R. Considering aspects of the 3Rs principles within experimental animal biology. J. Exp. Biol. 2017, 220, 3007–3016. [Google Scholar] [CrossRef]
- Erickson-DiRenzo, E.; Sivasankar, M.P.; Thibeault, S.L. Utility of cell viability assays for use with ex vivo vocal fold epithelial tissue. Laryngoscope 2015, 125, E180–E185. [Google Scholar] [CrossRef]
- Ferreira, I.A.; Peixoto, D.; Losada, A.P.; Quiroga, M.I.; do Vale, A.; Costas, B. Early innate immune responses in European sea bass (Dicentrarchus labrax L.) following Tenacibaculum maritimum infection. Front. Immunol. 2023, 14, 1254677. [Google Scholar] [CrossRef]
- Petit, J.; Wiegertjes, G.F. Conservation of members of the free fatty acid receptor gene family in common carp. Dev. Comp. Immunol. 2022, 126, 104240. [Google Scholar] [CrossRef]
- Ceccotti, C.; Al-Sulaivany, B.S.A.; Al-Habbib, O.A.M.; Saroglia, M.; Rimoldi, S.; Terova, G. Protective Effect of Dietary Taurine from ROS Production in European Seabass under Conditions of Forced Swimming. Animals 2019, 9, 607. [Google Scholar] [CrossRef]
- Mirghaed, A.T.; Yarahmadi, P.; Soltani, M.; Paknejad, H.; Hoseini, S.M. Dietary sodium butyrate (Butirex® C4) supplementation modulates intestinal transcriptomic responses and augments disease resistance of rainbow trout (Oncorhynchus mykiss). Fish Shellfish Immunol. 2019, 92, 621–628. [Google Scholar] [CrossRef]
- Lauridsen, C. From oxidative stress to inflammation: Redox balance and immune system. Poult. Sci. 2019, 98, 4240–4246. [Google Scholar] [CrossRef]
- Kunst, C.; Schmid, S.; Michalski, M.; Tümen, D.; Buttenschön, J.; Müller, M.; Gülow, K. The Influence of Gut Microbiota on Oxidative Stress and the Immune System. Biomedicines 2023, 11, 1388. [Google Scholar] [CrossRef]
- Chowdhury, S.; Saikia, S. Oxidative Stress in Fish: A Review. J. Sci. Res. 2020, 12, 145–160. [Google Scholar] [CrossRef]
- Liu, P.; Wang, Y.; Yang, G.; Zhang, Q.; Meng, L.; Xin, Y.; Jiang, X. The role of short-chain fatty acids in intestinal barrier function, inflammation, oxidative stress, and colonic carcinogenesis. Pharmacol. Res. 2021, 165, 105420. [Google Scholar] [CrossRef]
- Li, S.; Heng, X.; Guo, L.; Lessing, D.J.; Chu, W. SCFAs improve disease resistance via modulate gut microbiota, enhance immune response and increase antioxidative capacity in the host. Fish Shellfish Immunol. 2022, 120, 560–568. [Google Scholar] [CrossRef]
- Abdel-Latif, H.M.R.; Hendam, B.M.; Shukry, M.; El-Shafai, N.M.; El-Mehasseb, I.M.; Dawood, M.A.O.; Abdel-Tawwab, M. Effects of sodium butyrate nanoparticles on the hemato-immunological indices, hepatic antioxidant capacity, and gene expression responses in Oreochromis niloticus. Fish Shellfish Immunol. 2021, 119, 516–523. [Google Scholar] [CrossRef]
- Mehrgan, M.S.; Shekarabi, S.P.H.; Azari, A.; Yilmaz, S.; Lückstädt, C.; Rajabi Islami, H. Synergistic effects of sodium butyrate and sodium propionate on the growth performance, blood biochemistry, immunity, and immune-related gene expression of goldfish (Carassius auratus). Aquac. Int. 2022, 30, 3179–3193. [Google Scholar] [CrossRef]
- Sanjabi, S.; Zenewicz, L.A.; Kamanaka, M.; Flavell, R.A. Anti-inflammatory and pro-inflammatory roles of TGF-β, IL-10, and IL-22 in immunity and autoimmunity. Curr. Opin. Pharmacol. 2009, 9, 447–453. [Google Scholar] [CrossRef]
- Cicchese, J.M.; Evans, S.; Hult, C.; Joslyn, L.R.; Wessler, T.; Millar, J.A.; Marino, S.; Cilfone, N.A.; Mattila, J.T.; Linderman, J.J.; et al. Dynamic balance of pro- and anti-inflammatory signals controls disease and limits pathology. Immunol. Rev. 2018, 285, 147–167. [Google Scholar] [CrossRef]
- Zhao, H.; Peng, K.; Wang, G.; Mo, W.; Huang, Y.; Cao, J. Metabolic changes, antioxidant status, immune response and resistance to ammonia stress in juvenile yellow catfish (Pelteobagrus fulvidraco) fed diet supplemented with sodium butyrate. Aquaculture 2021, 536, 736441. [Google Scholar] [CrossRef]
- Zhu, Y.; Qiu, X.; Ding, Q.; Duan, M.; Wang, C. Combined effects of dietary phytase and organic acid on growth and phosphorus utilization of juvenile yellow catfish Pelteobagrus fulvidraco. Aquaculture 2014, 430, 1–8. [Google Scholar] [CrossRef]
- Ahmadifar, E.; Dawood, M.A.O.; Moghadam, M.S.; Sheikhzadeh, N.; Hoseinifar, S.H.; Musthafa, M.S. Modulation of immune parameters and antioxidant defense in zebrafish (Danio rerio) using dietary apple cider vinegar. Aquaculture 2019, 513, 734412. [Google Scholar] [CrossRef]
- Safari, R.; Hoseinifar, S.H.; Dadar, M.; Nejadmoghaddam, S.; Doan, H.V. Effect of Dietary Sodium Acetate on Skin Mucus Immune Parameters and Expression of Gene Related to Growth, Immunity and Antioxidant System in Common Carp Intestine. Ann. Anim. Sci. 2020, 20, 1441–1452. [Google Scholar] [CrossRef]
- Huang, W.; Guo, H.-L.; Deng, X.; Zhu, T.-T.; Xiong, J.-F.; Xu, Y.-H.; Xu, Y. Short-chain fatty acids inhibit oxidative stress and inflammation in mesangial cells induced by high glucose and lipopolysaccharide. Exp. Clin. Endocrinol. Diabetes 2017, 125, 98–105. [Google Scholar] [CrossRef]
- Muralitharan, R.; Marques, F.Z. Diet-related gut microbial metabolites and sensing in hypertension. J. Hum. Hypertens. 2021, 35, 162–169. [Google Scholar] [CrossRef]
- González-Bosch, C.; Boorman, E.; Zunszain, P.A.; Mann, G.E. Short-chain fatty acids as modulators of redox signaling in health and disease. Redox Biol. 2021, 47, 102165. [Google Scholar] [CrossRef]
- Ma, Y.; Nenkov, M.; Chen, Y.; Press, A.T.; Kaemmerer, E.; Gassler, N. Fatty acid metabolism and acyl-CoA synthetases in the liver-gut axis. World J. Hepatol. 2021, 13, 1512–1533. [Google Scholar] [CrossRef]
Gene | Gene Abbreviation | Primer Sequences (5′→3′) | Primer Efficiency | Anel. Temperature | Accession Number |
---|---|---|---|---|---|
Pro-inflammatory | |||||
Tumor necrosis factor-α | TNFα | F: AGCCACAGGATCTGGAGCTA R: GTCCGCTTCTGTAGCTGTCC | 2.1 | 60 °C | DQ200910 |
Interleukin 8 | Il-8 | F: GTCTGAGAAGCCTGGGAGTG R: GCAATGGGAGTTAGCAGGAA | 2.0 | 60 °C | AM490063 |
Anti-inflammatory | |||||
Transforming growth factor-β | TGF-β | F: GACCTGGGATGGAAGTGGAT R: CAGCTGCTCCACCTTGTGTTG | 2.0 | 60 °C | AM421619.1 |
Interleukin 10 | Il-10 | F: ACCCCGTTCGCTTGCCA R: ATCTGGTGACATCACTC | 2.0 | 60 °C | AM268529 |
Apoptotic | |||||
Caspase 3 | Casp3 | F: CTGATTTGGATCCAGGCATT R: CGGTCGTAGTGTTCCTCCAT | 2.1 | 60 °C | DQ345773 |
Transcription factor | |||||
Nuclear factor kappa β | NF-kβ | F: GCTGCGAGAAGAGAGGAAGA R: GGTGAACTTTAACCGGACGA | 1.9 | 60 °C | DLAgn_00239840 [29] |
SCFA receptor | |||||
G-protein coupled receptor | Grp40L | F:TTCTGTCCAAACTGCAGCAC R: TCTTACAGCGGAGGAGGAGA | 2.0 | 60 °C | [30] |
Oxidative stress | |||||
Catalase | Cat | F: ATGGTGTGGGACTTCTGGAG R: AGTGGAACTTGCAGTAGAAACG | 1.9 | 60 °C | FJ860003.1 |
Superoxide dismutase | Sod | F: CATGTTGGAGACCTGGGAGA R: TGAGCATCTTGTCCGTGATGT | 2.0 | 60 °C | FJ860004.1 |
Glutathione peroxidase | Gpx | F:AGTTCGTGCAGTTAATCCGGA R: GCTTAGCTGTCAGGTCGTAAAAC | 2.0 | 60 °C | [31] |
Energy metabolism | |||||
Citrate synthase | Cs | F: TAGGCAGTGGCATCCAAAGG R: AAGTTGACAGTCTTGATTGGAGC | 2.0 | 60 °C | KF857304.1 |
Housekeeping | |||||
Elongation factor 1α | Ef1α | F: GCTTCGAGGAAATCACCAAG R: CAACCTTCCATCCCTTGAAC | 2.0 | 60 °C | AJ866727 |
Ribosomal protein S40 | 40s | F: TGATTGTGACAGACCCTCGTG R: CACAGAGCAATGGTGGGGAT | 1.9 | 60 °C | HE978789.1 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fontinha, F.; Martins, N.; Campos, G.; Peres, H.; Oliva-Teles, A. The Effects of Short-Chain Fatty Acids in Gut Immune and Oxidative Responses of European Sea Bass (Dicentrarchus labrax): An Ex Vivo Approach. Animals 2024, 14, 1360. https://doi.org/10.3390/ani14091360
Fontinha F, Martins N, Campos G, Peres H, Oliva-Teles A. The Effects of Short-Chain Fatty Acids in Gut Immune and Oxidative Responses of European Sea Bass (Dicentrarchus labrax): An Ex Vivo Approach. Animals. 2024; 14(9):1360. https://doi.org/10.3390/ani14091360
Chicago/Turabian StyleFontinha, Filipa, Nicole Martins, Gabriel Campos, Helena Peres, and Aires Oliva-Teles. 2024. "The Effects of Short-Chain Fatty Acids in Gut Immune and Oxidative Responses of European Sea Bass (Dicentrarchus labrax): An Ex Vivo Approach" Animals 14, no. 9: 1360. https://doi.org/10.3390/ani14091360
APA StyleFontinha, F., Martins, N., Campos, G., Peres, H., & Oliva-Teles, A. (2024). The Effects of Short-Chain Fatty Acids in Gut Immune and Oxidative Responses of European Sea Bass (Dicentrarchus labrax): An Ex Vivo Approach. Animals, 14(9), 1360. https://doi.org/10.3390/ani14091360