Treatment of Donor Cells with Oxidative Phosphorylation Inhibitor CPI Enhances Porcine Cloned Embryo Development
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Porcine Fetal Fibroblast Culture and Passaging
2.2. CPI Treatment of Donor Cells
2.3. Reverse Transcription and qPCR
2.4. TMRE Assay of Mitochondrial Membrane Potential (MMP)
2.5. Measurement of Lactic Acid Content
2.6. Somatic Cell Nuclear Transfer
2.7. Transcriptome Sequencing Analysis
2.8. Statistical Analysis
3. Results
3.1. CPI Treatment Downregulated Oxidative Phosphorylation Gene Expression but Upregulated Glycolytic Enzyme Gene Expression in PFFs
3.2. CPI Treatment of PFFs Resulted in Downregulation of MMP and Upregulation of Lactate Content
3.3. CPI Treatment of Donor Cells PFFs Significantly Enhanced the Developmental Competence of Cloned Embryos
3.4. Transcriptomic Analysis of PFFs Treated with CPI
3.5. Interaction Analysis of Oxidative Phosphorylation-Related Pathway Networks
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Yadav, P.S.; Kumar, D.; Saini, M.; Sharma, R.K.; Dua, S.; Selokar, N.L.; Bansal, S.; Punetha, M.; Gupta, A.; Kumar, R.; et al. Evaluation of postnatal growth, hematology, telomere length and semen attributes of multiple clones and re-clone of superior buffalo breeding bulls. Theriogenology 2024, 213, 24–33. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.; Xiao, L.; Tan, B.; Luo, L.; Li, Z.; Hong, L.; Yang, J.; Cai, G.; Zheng, E.; Wu, Z.; et al. Comparative evaluation of production performances of cloned pigs derived from superior duroc boars. Anim. Reprod. Sci. 2022, 244, 107049. [Google Scholar] [CrossRef]
- Shi, J.; Tan, B.; Luo, L.; Li, Z.; Hong, L.; Yang, J.; Cai, G.; Zheng, E.; Wu, Z.; Gu, T. Assessment of the growth and reproductive performance of cloned pietrain boars. Animals 2020, 10, 2053. [Google Scholar] [CrossRef] [PubMed]
- Loi, P.; Ptak, G.; Barboni, B.; Fulka, J.J.; Cappai, P.; Clinton, M. Genetic rescue of an endangered mammal by cross-species nuclear transfer using post-mortem somatic cells. Nat. Biotechnol. 2001, 19, 962–964. [Google Scholar] [CrossRef] [PubMed]
- Gomez, M.C.; Pope, C.E.; Giraldo, A.; Lyons, L.A.; Harris, R.F.; King, A.L.; Cole, A.; Godke, R.A.; Dresser, B.L. Birth of african wildcat cloned kittens born from domestic cats. Cloning Stem Cells 2004, 6, 247–258. [Google Scholar] [CrossRef] [PubMed]
- Huang, L.; Hua, Z.; Xiao, H.; Cheng, Y.; Xu, K.; Gao, Q.; Xia, Y.; Liu, Y.; Zhang, X.; Zheng, X.; et al. Crispr/cas9-mediated ApoE−/− and LDLR−/− double gene knockout in pigs elevates serum ldl-c and tc levels. Oncotarget 2017, 8, 37751–37760. [Google Scholar] [CrossRef] [PubMed]
- Huang, J.; Guo, X.; Fan, N.; Song, J.; Zhao, B.; Ouyang, Z.; Liu, Z.; Zhao, Y.; Yan, Q.; Yi, X.; et al. Rag1/2 knockout pigs with severe combined immunodeficiency. J. Immunol. 2014, 193, 1496–1503. [Google Scholar] [CrossRef] [PubMed]
- Langin, M.; Reichart, B.; Steen, S.; Sjoberg, T.; Paskevicius, A.; Liao, Q.; Qin, G.; Mokelke, M.; Mayr, T.; Radan, J.; et al. Cold non-ischemic heart preservation with continuous perfusion prevents early graft failure in orthotopic pig-to-baboon xenotransplantation. Xenotransplantation 2021, 28, e12636. [Google Scholar] [CrossRef] [PubMed]
- Rosales, I.A.; Kinoshita, K.; Maenaka, A.; Anne, L.H.I.; Selig, M.K.; Laguerre, C.M.; Collins, A.B.; Ayares, D.; Cooper, D.; Colvin, R.B. De novo membranous nephropathy in a pig-to-baboon kidney xenograft: A new xenograft glomerulopathy. Am. J. Transplant. 2024, 24, 30–36. [Google Scholar] [CrossRef]
- Zeng, F.; Liao, S.; Kuang, Z.; Zhu, Q.; Wei, H.; Shi, J.; Zheng, E.; Xu, Z.; Huang, S.; Hong, L.; et al. Genetically engineered pigs as efficient salivary gland bioreactors for production of therapeutically valuable human nerve growth factor. Cells 2022, 11, 2378. [Google Scholar] [CrossRef]
- Wang, M.; Sun, Z.; Yu, T.; Ding, F.; Li, L.; Wang, X.; Fu, M.; Wang, H.; Huang, J.; Li, N.; et al. Large-scale production of recombinant human lactoferrin from high-expression, marker-free transgenic cloned cows. Sci. Rep. 2017, 7, 10733. [Google Scholar] [CrossRef] [PubMed]
- Tabar, V.; Tomishima, M.; Panagiotakos, G.; Wakayama, S.; Menon, J.; Chan, B.; Mizutani, E.; Al-Shamy, G.; Ohta, H.; Wakayama, T.; et al. Therapeutic cloning in individual parkinsonian mice. Nat. Med. 2008, 14, 379–381. [Google Scholar] [CrossRef] [PubMed]
- Sui, L.; Danzl, N.; Campbell, S.R.; Viola, R.; Williams, D.; Xing, Y.; Wang, Y.; Phillips, N.; Poffenberger, G.; Johannesson, B.; et al. Beta-cell replacement in mice using human type 1 diabetes nuclear transfer embryonic stem cells. Diabetes 2018, 67, 26–35. [Google Scholar] [CrossRef]
- Wang, X.; Shi, J.; Cai, G.; Zheng, E.; Liu, D.; Wu, Z.; Li, Z. Overexpression of mbd3 improves reprogramming of cloned pig embryos. Cell. Reprogramm. 2019, 21, 221–228. [Google Scholar] [CrossRef] [PubMed]
- Zhao, H.; Xie, S.; Zhang, N.; Ao, Z.; Wu, X.; Yang, L.; Shi, J.; Mai, R.; Zheng, E.; Cai, G.; et al. Source and follicular fluid treatment during the in vitro maturation of recipient oocytes affects the development of cloned pig embryo. Cell. Reprogramm. 2020, 22, 71–81. [Google Scholar] [CrossRef] [PubMed]
- Dong, Y.; Wu, X.; Peng, X.; Yang, L.; Tan, B.; Zhao, H.; Zheng, E.; Hong, L.; Cai, G.; Wu, Z.; et al. Knockdown of yy1 inhibits xist expression and enhances cloned pig embryo development. Int. J. Mol. Sci. 2022, 23, 14572. [Google Scholar] [CrossRef] [PubMed]
- Costa, G.R.; Souza, R.E.; Zago, F.C.; Aguiar, L.H.; Rodriguez-Villamil, P.; Ongaratto, F.L.; Ambrosio, C.E.; Miglino, M.A.; Rodrigues, J.L.; Forell, F.; et al. Effects of fusion-activation interval and embryo aggregation on in vitro and in vivo development of bovine cloned embryos. Res. Vet. Sci. 2019, 123, 91–98. [Google Scholar] [CrossRef] [PubMed]
- Meng, F.; Stamms, K.; Bennewitz, R.; Green, A.; Oback, F.; Turner, P.; Wei, J.; Oback, B. Targeted histone demethylation improves somatic cell reprogramming into cloned blastocysts but not postimplantation bovine conceptidagger. Biol. Reprod. 2020, 103, 114–125. [Google Scholar] [CrossRef]
- Qu, P.; Qing, S.; Liu, R.; Qin, H.; Wang, W.; Qiao, F.; Ge, H.; Liu, J.; Zhang, Y.; Cui, W.; et al. Effects of embryo-derived exosomes on the development of bovine cloned embryos. PLoS ONE 2017, 12, e174535. [Google Scholar] [CrossRef]
- Callesen, H.; Liu, Y.; Pedersen, H.S.; Li, R.; Schmidt, M. Increasing efficiency in production of cloned piglets. Cell. Reprogramm. 2014, 16, 407–410. [Google Scholar] [CrossRef]
- Wells, D.N.; Laible, G.; Tucker, F.C.; Miller, A.L.; Oliver, J.E.; Xiang, T.; Forsyth, J.T.; Berg, M.C.; Cockrem, K.; L‘Huillier, P.J.; et al. Coordination between donor cell type and cell cycle stage improves nuclear cloning efficiency in cattle. Theriogenology 2003, 59, 45–59. [Google Scholar] [CrossRef] [PubMed]
- Christofk, H.R.; Vander, H.M.; Harris, M.H.; Ramanathan, A.; Gerszten, R.E.; Wei, R.; Fleming, M.D.; Schreiber, S.L.; Cantley, L.C. The m2 splice isoform of pyruvate kinase is important for cancer metabolism and tumour growth. Nature 2008, 452, 230–233. [Google Scholar] [CrossRef]
- El-Sanea, A.M.; Abdoon, A.; Kandil, O.M.; El-Toukhy, N.E.; El-Maaty, A.; Ahmed, H.H. Effect of oxygen tension and antioxidants on the developmental competence of buffalo oocytes cultured in vitro. Vet. World 2021, 14, 78–84. [Google Scholar] [CrossRef] [PubMed]
- Rybouchkin, A.; Kato, Y.; Tsunoda, Y. Role of histone acetylation in reprogramming of somatic nuclei following nuclear transfer. Biol. Reprod. 2006, 74, 1083–1089. [Google Scholar] [CrossRef]
- Karagiannis, P.; Takahashi, K.; Saito, M.; Yoshida, Y.; Okita, K.; Watanabe, A.; Inoue, H.; Yamashita, J.K.; Todani, M.; Nakagawa, M.; et al. Induced pluripotent stem cells and their use in human models of disease and development. Physiol. Rev. 2019, 99, 79–114. [Google Scholar] [CrossRef] [PubMed]
- Prigione, A.; Rohwer, N.; Hoffmann, S.; Mlody, B.; Drews, K.; Bukowiecki, R.; Blumlein, K.; Wanker, E.E.; Ralser, M.; Cramer, T.; et al. Hif1alpha modulates cell fate reprogramming through early glycolytic shift and upregulation of pdk1-3 and pkm2. Stem. Cells. 2014, 32, 364–376. [Google Scholar] [CrossRef] [PubMed]
- Prigione, A.; Lichtner, B.; Kuhl, H.; Struys, E.A.; Wamelink, M.; Lehrach, H.; Ralser, M.; Timmermann, B.; Adjaye, J. Human induced pluripotent stem cells harbor homoplasmic and heteroplasmic mitochondrial DNA mutations while maintaining human embryonic stem cell-like metabolic reprogramming. Stem Cells 2011, 29, 1338–1348. [Google Scholar] [CrossRef]
- Shakya, A.; Cooksey, R.; Cox, J.E.; Wang, V.; Mcclain, D.A.; Tantin, D. Oct1 loss of function induces a coordinate metabolic shift that opposes tumorigenicity. Nat. Cell Biol. 2009, 11, 320–327. [Google Scholar] [CrossRef] [PubMed]
- Zhu, S.; Li, W.; Zhou, H.; Wei, W.; Ambasudhan, R.; Lin, T.; Kim, J.; Zhang, K.; Ding, S. Reprogramming of human primary somatic cells by oct4 and chemical compounds. Cell Stem Cell 2010, 7, 651–655. [Google Scholar] [CrossRef] [PubMed]
- Luo, C.; Wang, Z.; Wang, J.; Yun, F.; Lu, F.; Fu, J.; Liu, Q.; Shi, D. Individual variation in buffalo somatic cell cloning efficiency is related to glycolytic metabolism. Sci. China Life Sci. 2022, 65, 2076–2092. [Google Scholar] [CrossRef]
- Cecil, R.F.; Chen, P.R.; Benne, J.A.; Hord, T.K.; Spate, L.D.; Samuel, M.S.; Prather, R.S. Chemical simulation of hypoxia in donor cells improves development of somatic cell nuclear transfer-derived embryos and increases abundance of transcripts related to glycolysis. Mol. Reprod. Dev. 2020, 87, 763–772. [Google Scholar] [CrossRef] [PubMed]
- Mordhorst, B.R.; Murphy, S.L.; Ross, R.M.; Benne, J.A.; Samuel, M.S.; Cecil, R.F.; Redel, B.K.; Spate, L.D.; Murphy, C.N.; Wells, K.D.; et al. Pharmacologic treatment of donor cells induced to have a arburg effect-like metabolism does not alter embryonic development in vitro or survival during early gestation when used in somatic cell nuclear transfer in pigs. Mol. Reprod. Dev. 2018, 85, 290–302. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative pcr and the 2(-delta delta c(t)) method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Guan, F.; Yu, B.; Qi, G.X.; Luo, J. A study on the effect of sodium azide on myocardial cell viability. J. China Med. Univ. 2006, 345–347. [Google Scholar]
- Wu, L.; Zhao, J.; Cao, K.; Liu, X.; Cai, H.; Wang, J.; Li, W.; Chen, Z. Oxidative phosphorylation activation is an important characteristic of dox resistance in hepatocellular carcinoma cells. Cell Commun. Signal. 2018, 16, 6. [Google Scholar] [CrossRef]
- Sturmey, R.G.; Leese, H.J. Energy metabolism in pig oocytes and early embryos. Reproduction 2003, 126, 197–204. [Google Scholar] [CrossRef]
- Pardee, T.S.; Lee, K.; Luddy, J.; Maturo, C.; Rodriguez, R.; Isom, S.; Miller, L.D.; Stadelman, K.M.; Levitan, D.; Hurd, D.; et al. A phase I study of the first-in-class antimitochondrial metabolism agent, cpi-613, in patients with advanced hematologic malignancies. Clin. Cancer Res. 2014, 20, 5255–5264. [Google Scholar] [CrossRef] [PubMed]
- Reddy, V.B.; Boteju, L.; Boteju, A.; Shen, L.; Kassahun, K.; Reddy, N.; Sheldon, A.; Luther, S.; Hu, K. In vitro and in vivo metabolism of a novel antimitochondrial cancer metabolism agent, cpi-613, in rat and human. Drug. Metab. Dispos. 2022, 50, 361–373. [Google Scholar] [CrossRef]
- Mordhorst, B.R.; Kerns, K.C.; Schauflinger, M.; Zigo, M.; Murphy, S.L.; Ross, R.M.; Wells, K.D.; Green, J.A.; Sutovsky, P.; Prather, R.S. Pharmacologic treatment with cpi-613 and ps48 decreases mitochondrial membrane potential and increases quantity of autolysosomes in porcine fibroblasts. Sci. Rep. 2019, 9, 9417. [Google Scholar] [CrossRef]
- Zhao, Z.; Mei, Y.; Wang, Z.; He, W. The effect of oxidative phosphorylation on cancer drug resistance. Cancers 2022, 15, 62. [Google Scholar] [CrossRef]
- Mordhorst, B.R.; Murphy, S.L.; Schauflinger, M.; Rojas, S.S.; Ji, T.; Behura, S.K.; Wells, K.D.; Green, J.A.; Prather, R.S. Porcine fetal-derived fibroblasts alter gene expression and mitochondria to compensate for hypoxic stress during culture. Cell. Reprogramm. 2018, 20, 225–235. [Google Scholar] [CrossRef]
- Cui, G.; Zhou, J.; Sun, J.; Kou, X.; Su, Z.; Xu, Y.; Liu, T.; Sun, L.; Li, W.; Wu, X.; et al. Wd repeat domain 82 (wdr82) facilitates mouse ipscs generation by interfering mitochondrial oxidative phosphorylation and glycolysis. Cell. Mol. Life Sci. 2023, 80, 218. [Google Scholar] [CrossRef] [PubMed]
- Nishioku, T.; Anzai, R.; Hiramatsu, S.; Terazono, A.; Nakao, M.; Moriyama, M. Lactate dehydrogenase a inhibition prevents rankl-induced osteoclastogenesis by reducing enhanced glycolysis. J. Pharmacol. Sci. 2023, 153, 197–207. [Google Scholar] [CrossRef] [PubMed]
- Yonashiro, R.; Eguchi, K.; Wake, M.; Takeda, N.; Nakayama, K. Pyruvate dehydrogenase pdh-e1beta controls tumor progression by altering the metabolic status of cancer cells. Cancer Res. 2018, 78, 1592–1603. [Google Scholar] [CrossRef] [PubMed]
- Matoba, S.; Kang, J.G.; Patino, W.D.; Wragg, A.; Boehm, M.; Gavrilova, O.; Hurley, P.J.; Bunz, F.; Hwang, P.M. P53 regulates mitochondrial respiration. Science 2006, 312, 1650–1653. [Google Scholar] [CrossRef] [PubMed]
- Rho, H.; Terry, A.R.; Chronis, C.; Hay, N. Hexokinase 2-mediated gene expression via histone lactylation is required for hepatic stellate cell activation and liver fibrosis. Cell Metab. 2023, 35, 1406–1423. [Google Scholar] [CrossRef] [PubMed]
- Nolfi-Donegan, D.; Braganza, A.; Shiva, S. Mitochondrial electron transport chain: Oxidative phosphorylation, oxidant production, and methods of measurement. Redox Biol. 2020, 37, 101674. [Google Scholar] [CrossRef] [PubMed]
- Zorov, D.B.; Andrianova, N.V.; Babenko, V.A.; Bakeeva, L.E.; Zorov, S.D.; Zorova, L.D.; Pevsner, I.B.; Popkov, V.A.; Plotnikov, E.Y.; Silachev, D.N. Nonphosphorylating oxidation in mitochondria and related processes. Biochemistry 2020, 85, 1570–1577. [Google Scholar] [CrossRef] [PubMed]
- Mo, Y.; Wang, Y.; Zhang, L.; Yang, L.; Zhou, M.; Li, X.; Li, Y.; Li, G.; Zeng, Z.; Xiong, W.; et al. The role of wnt signaling pathway in tumor metabolic reprogramming. J. Cancer 2019, 10, 3789–3797. [Google Scholar] [CrossRef]
- Marsin, A.S.; Bertrand, L.; Rider, M.H.; Deprez, J.; Beauloye, C.; Vincent, M.F.; Van den Berghe, G.; Carling, D.; Hue, L. Phosphorylation and activation of heart pfk-2 by ampk has a role in the stimulation of glycolysis during ischaemia. Curr. Biol. 2000, 10, 1247–1255. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, R.; Zhang, L.; Li, J.; Lou, K.; Shi, B. The lipid metabolism gene fto influences breast cancer cell energy metabolism via the pi3k/akt signaling pathway. Oncol. Lett. 2017, 13, 4685–4690. [Google Scholar] [CrossRef] [PubMed]
- Redel, B.K.; Spate, L.D.; Lee, K.; Mao, J.; Whitworth, K.M.; Prather, R.S. Glycine supplementation in vitro enhances porcine preimplantation embryo cell number and decreases apoptosis but does not lead to live births. Mol. Reprod. Dev. 2016, 83, 246–258.53. [Google Scholar] [CrossRef] [PubMed]
- Li, J.; Hou, W.; Zhao, Q.; Han, W.; Cui, H.; Xiao, S.; Zhu, L.; Qu, J.; Liu, X.; Cong, W.; et al. Lactate regulates major zygotic genome activation by h3k18 lactylation in mammals. Natl. Sci. Rev. 2024, 11, nwad295. [Google Scholar] [CrossRef] [PubMed]
- Shi, W.; Cassmann, T.J.; Bhagwate, A.V.; Hitosugi, T.; Ip, W. Lactic acid induces transcriptional repression of macrophage inflammatory response via histone acetylation. Cell Rep. 2024, 43, 113746. [Google Scholar] [CrossRef]
- Wang, H.; Cui, W.; Meng, C.; Zhang, J.; Li, Y.; Qian, Y.; Xing, G.; Zhao, D.; Cao, S. Mc1568 enhances histone acetylation during oocyte meiosis and improves development of somatic cell nuclear transfer embryos in pig. Cell. Reprogramm. 2018, 20, 55–65. [Google Scholar] [CrossRef]
Gene | Primer Sequences (5′–3′) | GenBank ID |
---|---|---|
β-actin (reference gene) | F: CCTTGGATCTTGGCGGTTCT R: CACTGCCATGCATGATGCTC | NM_001206359 |
PGK1 | F: CCTTGGATCTTGGCGGTTCT R: CACTGCCATGCATGATGCTC | NM_001099932 |
PDK1 | F: CGTGCTGGGAATCAGCAAAC R: GCTCGAAGTCCGTCTCCTTC | NM_001159608 |
LDHA | F: ATCCTGTGGACGGAAGCATT R: AGGTGATAACAGTGGGTGCG | NM_001172363 |
COX1 | F: GGAGGTCTAACGGGCATTGT R: ACCCGGAGAATAGGGGGAAT | NP_008636 |
COX2 | F: CCAAGACGCCACTTCACCCATC | NP_008637.1 |
R: TGGGCATCCATTGTGCTAGTGTG | ||
COX3 | F: AAGACGCCACTTCACCCATC R: TCTTGGGCATCCATTGTGCT | NP_008640 |
ATP6 | F: CCGCACAATCTCGATCCAAC R: AGTTGTGTGGTGGGTGTGAA | NP_008639 |
ATP8 | F: GCCACAACTAGATCATCCACATG | NP_008638.1 |
R: GATTCTGGGCTTGCTGGGTATG |
Cycle Step | Repetition Number | Temperature | Times |
---|---|---|---|
premutability | 1 | 95 °C | 30 s |
cyclic response | 40 | 10 s | |
30 s | |||
Dissolution curves | 1 | 15 s | |
60 s | |||
15 s |
Groups | Cleavage Rate (n) | Four-Cell Stage Rate (n) | Blastocyst Rate (n) | Number of Blastocyst Cells Mean |
---|---|---|---|---|
NC | 67.00 ± 1.91% (67/100) | 37.00 ± 1.91% (37/100) | 38.00 ± 2.0% (38/100) | 34.13 ± 13.38 |
CPI | 69.33 ± 1.15% (52/75) | 38.67 ± 1.15% (40/75) | 49.33 ± 3.52% (43/75) * | 43.19 ± 18.52 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Cao, J.; Dong, Y.; Li, Z.; Wang, S.; Wu, Z.; Zheng, E.; Li, Z. Treatment of Donor Cells with Oxidative Phosphorylation Inhibitor CPI Enhances Porcine Cloned Embryo Development. Animals 2024, 14, 1362. https://doi.org/10.3390/ani14091362
Cao J, Dong Y, Li Z, Wang S, Wu Z, Zheng E, Li Z. Treatment of Donor Cells with Oxidative Phosphorylation Inhibitor CPI Enhances Porcine Cloned Embryo Development. Animals. 2024; 14(9):1362. https://doi.org/10.3390/ani14091362
Chicago/Turabian StyleCao, Jinping, Yazheng Dong, Zheng Li, Shunbo Wang, Zhenfang Wu, Enqin Zheng, and Zicong Li. 2024. "Treatment of Donor Cells with Oxidative Phosphorylation Inhibitor CPI Enhances Porcine Cloned Embryo Development" Animals 14, no. 9: 1362. https://doi.org/10.3390/ani14091362