Next Article in Journal
Behavioral and Physiological Responses of Therapy Dogs to Animal-Assisted Treatment in an Inpatient Stroke Rehabilitation Program
Next Article in Special Issue
Functional Study of Four Histone Genes Involved in the Spermatogenesis of Cynoglossus semilaevis
Previous Article in Journal
Lin28b-let-7 Modulates mRNA Expression of GnRH1 Through Multiple Signaling Pathways Related to Glycolysis in GT1-7 Cells
Previous Article in Special Issue
Sex-Dimorphic Differential Expression Profiles in the Brain of the Adult Chinese Soft-Shelled Turtle, Pelodiscus sinensis
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization and Expression of unc-13d in the Sex Reversal of Monopterus albus

1
Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, Wuhan 430223, China
2
State Key Laboratory of Mariculture Biobreeding and Sustainable Goods, Yellow Sea Fisheries Research Institute, Chinese Academy of Fishery Sciences, Qingdao 266071, China
*
Authors to whom correspondence should be addressed.
Animals 2025, 15(2), 122; https://doi.org/10.3390/ani15020122
Submission received: 18 October 2024 / Revised: 20 December 2024 / Accepted: 2 January 2025 / Published: 7 January 2025
(This article belongs to the Special Issue Sex Determination and Differentiation in Aquatic Animals)

Simple Summary

The aim of this research was to characterize the structure, expression, and function of unc-13d in the process of sex reversal in Monopterus albus. The expression profile of unc-13d suggested that unc-13d plays an important role in sex reversal. Additionally, the DNA methylation of the promoter of unc-13d exhibited negative correlation with gene expression, especially at site 114. Furthermore, we found that dmrt1 antagonistically regulates foxl2 expression through unc-13d.

Abstract

Monopterus albus is a protogynous hermaphroditic fish that changes from female to male, but the underlying sex change mechanism remains as-yet unknown. In this study, we firstly cloned and characterized the sequence and protein structure of unc-13d of M. albus. We found that the genomic structure of unc-13d was different from other species. Expression was detected in the developing gonad by applying qRT-PCR and in situ hybridization. We found that the expression of unc-13d in the ovotestis was higher than in the ovary and testes. A strong signal of unc-13d was detected in oocytes and granulosa cells in the ovary and spermatogonia and primary spermatocytes in the testes. We found that the promoter methylation of unc-13d was negatively correlated with gene expression in developing gonads, especially at site 114. A dual-luciferase assay was designed and revealed that dmrt1 regulates promoter activity opposite to foxl2. In summary, during sex reversal, DNA methylation affects the binding of the transcription factor dmrt1 and foxl2 in the promoter region through methylation and demethylation interactions to regulate the expression of unc-13d during gonadal development.

1. Introduction

Sex determination is a complex process involving many different pathways and sex-related genes [1]. Sex determination mechanisms are generally categorized as genetic sex determination (GSD), which is common across the animal kingdom, and environmental sex determination (ESD), which has been found in diverse taxa, especially in teleost fish [2,3,4], and can be influenced by different environmental factors, such as temperature, hormones, pH, social conditions, and salinity [5]. Recent studies have confirmed that DNA methylation is an important epigenetic mechanism in sex transition [6,7,8]. For example, the epigenetic modification of ZW was found in Cynoglossus semilaevis when treated with high temperature [6], and increased methylation levels in the promoter of gonadal aromatase (cyp19a) were also observed in the ovaries of Dicentrarchus labrax at high temperatures [9].
Monopterus albus is widespread throughout East and Southeast Asia and is a highly favored food and commercially important fish in this region [10,11,12]. Interestingly, M. albus is a protogynous hermaphroditic fish that undergoes a sequential sex change from female to male after its first spawning [13,14,15,16,17]. This sex reversal process has attracted the attention of researchers around the world. Owing to its distinctive developmental sex traits and small genome, M. albus is expected to gradually become a new model species for research transformation and biological development [18,19,20,21]. Research on the regulation of sex in M. albus and its sex reversal mechanisms is increasing, and there have been a few studies analyzing the methylation-related factors that cause sex reversal in M. albus [22,23,24,25,26]. However, the precise role of DNA methylation in sex reversal in M. albus has not been fully clarified before now. Previously, we identified unc-13d as a candidate gene due to its low accessibility status, hypermethylation, and up-regulation of expression through DNA methylation upon the analysis of the gonads of female, male, and intersex specimens [26]. In this study, we cloned and characterized unc-13d of M. albus, analyzed its expression and localization in different gonadal stages, and further confirmed that its expression might be regulated by the binding of dmrt1 in its promoter region, which might be regulated through methylation. The precise binding site of the transcription factor in the promoter region of unc-13d was also characterized using a dual-luciferase assay. This provides evidence supporting the role of unc-13d methylation in sex differentiation in M. albus.

2. Materials and Methods

2.1. Animal Specimen Collection and Sample Preparation

The M. albus specimens used in this study were acquired from the Breeding Center of Yangtze River Fisheries Research Institute, Chinese Academy of Fishery Sciences, China. Prior to sampling, twenty M. albus specimens were deprived of food for 24 h and anesthetized with MS-222 (500 mg/L, 5 min). Three sets of gonads were extracted from the M. albus groups, specifically female, intersex, and male, including at least three samples per group. The gonadal samples obtained from three M. albus specimens (aged one year) were separated into two parts: the first part was kept in 4% paraformaldehyde (pH = 7.5) for preparing tissue sections, and the second one was preserved in liquid nitrogen and then transferred to a −80 °C refrigerator for RNA and DNA extraction. Total DNA and RNA were extracted according to the manufacturer’s instructions, and the concentration was determined using an Agilent 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). Their integrity was confirmed through agarose gel electrophoresis.

2.2. Sequence Analysis and Construction of a Phylogenetic Tree

The open reading frames were predicted on the NCBI (http://www.ncbi.nlm.nih.gov/gorf/orfifig.cgi, accessed on 1 October 2024), and the domains were predicted using the InterPro database and SMART database [27] (http://www.ebi.ac.uk/interpro/; https://smart.embl-heidelberg.de/, accessed on 1 October 2024). The physicochemical properties of the M. albus UNC-13D protein were predicted using ProtParam [28] (https://www.expasy.org/resources/protparam, accessed on 1 October 2024). The secondary structure was analyzed using the online tool PSIPRED (http://bioinf.cs.ucl.ac.uk/psipred/, accessed on 1 October 2024), and the tertiary structure of unc-13d was predicted using the online tool SWISS-MODEL [29] (https://swissmodel.expasy.org/, accessed on 1 October 2024). The phylogenetic analysis was carried out using MEGA 7.0 software with the neighbor-joining (NJ) method [30]. Conserved amino acid sequences were predicted using the online tools WebLogo3 [31] and MEME [32] (http://weblogo.threeplusone.com/, accessed on 1 October 2024; https://meme-suite.org/meme/tools/meme, accessed on 1 October 2024). Genomicus [33] (https://www.genomicus.bio.ens.psl.eu/genomicus-108.01/cgi-bin/search.pl, accessed on 1 October 2024) databases were used to obtain the genomic arrangement and collinearity analysis of unc-13d in Homo sapiens, Muroidea, Lepisosteus oculatus, Mastacembelus armatus, and M. albus.

2.3. Real-Time Quantitative PCR

The expression of unc-13d at three gonad developmental stages was determined and analyzed by quantitative real-time fluorescence PCR (qRT-PCR). Total RNA was extracted from the gonadal samples using TRIzol (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions. EF-1α was selected as the internal reference gene [34]. The primers used for the detection of unc-13d are given in Table 1. The qRT-PCR reactions were performed on a QuantStudio 5 real-time quantitative PCR system (Applied Biosystems, Carlsbad, CA, USA), as described previously [26]. The qPCR amplification was performed independently in three replicates of three samples per tissue. Relative expression was calculated by the selected 2−ΔΔCT method [35]; data were analyzed by One-Way ANOVA and Duncan’s method of multiple comparisons using SPSS 22.0 (IBM, New York, NY, USA), and the significance was set at p < 0.05.

2.4. In Situ Hybridization

In order to assess the expression of unc-13d in gonadal cells, primers were designed using Primer Premier 5.0 design software [36]. The T7 promoter sequence was added to the 5′ end of the primers (Table 1). An 815 bp cDNA fragment of unc-13d was amplified, and the PCR products were purified and recovered using a Gel Recovery Kit (TIANamp) according to the manufacturer’s instructions. RNA integrity and concentration were detected using 1% agarose gel and a Nano Photometer NP80 (Implen, München, Germany), and the probes were prepared with a MEGAshortscript T7 High Yield Transcription Kit (Invitrogen, AM1354). In situ hybridization was performed as follows: Sections were deparaffinized, hydrated, and treated with proteinase K, and then hybridized using a sense or antisense DIG-labeled RNA probe at 70 °C for 12 h. Hybridization signals were then detected with anti-DIG (Roche, 11093274910) conjugated with POD. DAB (Beyotime, Nantong, China, P0202) was used as the substrate for POD.

2.5. Methylation State Change of unc-13d Promoter During Sex Reversal

To determine the methylation status of the promoter of unc-13d in different gonadal stages, a 1500 bp promoter was obtained from the genomic database and a 602 bp methylation island was predicted. The genomic DNA of at least 15 samples in one group was extracted. At least 2 μg of mixed DNA was treated using the DNA methylation kit (Zymo, CA, USA) according to the manufacturer’s instructions. Primers were designed using MethPrimer [37] (http://www.urogene.org/methprimer/, accessed on 1 October 2024). The treated DNA was used as a template for PCR amplification. The PCR system consisted of 0.125 µL TaKaRa Ex Taq HS (Takara, Dalian, China), 2.5 µL 10 × Ex Taq Buffer, 2 µL dNTP Mixture, 100 ng treated genomic DNA, 0.5 µL of each primer (10 μmol/L), and double-distilled water to reach a final volume of 25 μL. The reaction conditions were as follows: 98 °C for 10 min; 33 cycles of 98 °C for 10 s; 55 °C for 30 s; 72 °C for 1 min; and 4 °C for storage. PCR products were extracted, purified, and then cloned into the PMD-18T vector (Takara, Dalian, China). Each set of methylated sequences was sequenced for 15–20 positive clones, and methylation analysis was performed using the DNA analysis platform [38] (http://services.ibc.uni-stuttgart.de/BDPC/BISMA/, accessed on 1 October 2024) to compare the ratio of methylated to unmethylated CpG at each site in each tissue. The differences in mean methylation levels between groups were determined using independent samples t-tests. The differences in the proportion of methylated and unmethylated CpG at each locus were tested by the Chi-square test followed by Fisher’s exact test. A p-value of less than 0.05 was considered significant.

2.6. Plasmid Construction

The putative promoter region of unc-13d was obtained from the genomic database and the sex-related transcription factor binding sites were detected using JASPAR online software [39]. Three deletion fragments (2057, 1596, and 1008 bp) of the promoter were amplified from the genomic DNA, and the PCR products were purified and cloned in the PGL3-basic vector using KpnI and XhoI restriction endonucleases [40,41,42]. The fixed-point mutagenesis of the dmrt1 and foxl2 binding sites was performed using a Fast Site-Directed Mutagenesis Kit (TIANGEN, Beijing, China), according to the manufacturer’s instruction.

2.7. Cell Culture and Dual-Luciferase Assay

HEK293T cells were obtained from the Center of Animal Science and Animal Medicine, Shandong Agricultural University, cultured in 24-well plates, and incubated with DMEM complete medium (10% double antibodies, 10% fetal bovine serum, and DMEM high sugar medium) at 37 °C in a 5% CO2 incubator to reach a cell density of 50%. The DMEM (Termo Fisher Scientifc, Waltham, MA, USA) was replaced with opti-MEM medium (Termo Fisher Scientifc, Waltham, MA, USA) and transfected with a 50:50:1 ratio of recombinant constructs to PGL3-promoter vector to sea kidney luciferase vector using LipofectamineTM 3000 (Invitrogen, Carlsbad, CA, USA), according to the manufacturer’s instructions, and then incubated at 37 °C for 6 h. Subsequently, the opti-MEM medium was removed and the cells were incubated for 48 h in DMEM. The cells were collected, the luciferase activity was measured using a dual-luciferase kit (Promega, Madison, WI, USA), and the fluorescence intensity was measured using a BHP9504 microplate chemiluminescence immunoassay reader (Hamamatsu, Shizuoka City, Japan) with a determination interval of 2 s and a determination time of 2 s.

3. Results

3.1. Sequence Analysis of unc-13d

With the help of RACE techniques, the full-length cDNA (4455 bp) of the unc-13d of M. albus (Genbank No: XP020481010), including 5′UTR (626 bp) and 3′UTR (257 bp), was obtained for the first time. The predicted open reading frame (ORF) was 3315 bp, encoding 1105 aa (Figure 1A). The molecular formula of UNC-13D was C5620H8904N1550O1693S38, and the relative molecular mass was 126.348 kDa. The instability coefficient was 45.29—greater than 40—the lipid coefficient was 87.24, and the total average hydrophilicity was −0.501, suggesting that it is an unstable hydrophilic protein. The secondary structure of the protein contains 52.08% α-helix, 9.96% β-turn, and 37.95% irregular curl. The predicted tertiary structure of the UNC-13D protein is presented in Figure 1B. Its Global Model Quality Estimate (GMQE) score is 0.54 (between 0 and 1), indicating that the predicted tertiary structure model is highly accurate, and the estimated QMEAN score is −3.56 (between 0 and −4), suggesting that the predicted model structure has good consistency. A combination of Smart database analysis and the online tool CD-Search showed that the tertiary structure of the protein contains three low-complexity regions (LCRs) (Figure 1A): the C2A-Munc13-like conserved domain (C2 domain first repeat in Munc13 in the amino acid region from position 89 to 269 (Figure 1A); the C2B-Munc13-like conserved domain (C2 domain second repeat in Munc13 in the amino acid region from position 920 to 1063 (Figure 1A); and the DUF 1041 superfamily conserved domain in the amino acid region from position 481 to 874 (Figure 1A).
On the obtained NJ tree, homologs of mammals, birds, and reptiles were grouped separately, homologs of cartilaginous fishes were clustered on a separate branch, and the unc-13d of M. albus was grouped with the homolog of the half-smooth tongue sole (Cynoglossus semilaevis). Such phylogenetic topology is generally consistent with the known evolutionary pattern of the species (Figure 2A). Using Genomicus, a conserved co-linear gene block of unc13-d, including WBP-2, TRLM65, MRPL38, and fdxr in the upstream region and Itgb4, sap30bp, cdr21, and mrpl58 in the downstream region, was found in different vertebrate species and even in mammals (Figure 2B). This conserved co-linearity of unc-13d and its neighboring gene blocks suggests the conservation of the function of unc-13d among vertebrates.

3.2. unc-13d Expression Associated with DNA Methylation During Gonadal Development

The expression of unc-13d was significantly higher in the ovotestes than in the ovaries and testes (Figure 3A, p < 0.05). No signal was detected in the control group (Figure 3(Ba,b)). A strong signal of unc-13d was detected in the cytoplasm and granulosa cells of oocytes (Figure 3(Bc,d)). In the ovotestes and testes, unc-13d expression was mainly detected in the spermatogonia and primary spermatocytes (Figure 3(Be–h)). To test the mechanism of the different expression of unc-13d during sex reversal, the methylation island of the unc-13d promoter was analyzed through MethPrimer software and a primer was designed. The methylation status of each locus at different gonadal developmental stages was examined. The results showed that the level of methylation of gonadal development decreased from 89.62 in the ovaries to 76.77 in the testes (Figure 4A). The results of each locus exhibited that sites 15, 82, 108, and 114 had significant differences in methylation levels during sex reversal. However, only at site 114 was methylation level was negatively associated with gene expression (Figure 4B).

3.3. Dmrt1 Regulates Promoter Activity Opposite to FoxL2

By analyzing potential binding sites for transcription factors in the promoter region, several sex-related transcription factor binding sites were found using the JASPAR online software (Figure 5A). The pre-2057 bp of the transcription start site (TSS) was selected as a candidate promoter region. For the accurate localization of the binding sites, a PGL3 dual-luciferase reporter assay with a series of deletions of the unc-13d promoter region was constructed. The results showed that luciferase activity was significantly higher (p < 0.05) in the three deletion constructs than in the basic group (Figure 5A). The luciferase activities indicated that key regulatory elements are distributed within the first 1008 bp of the transcription start site, including dmrt1 and the foxl2 binding site (Figure 5A).
To further explore the specific role of the sex-linked transcription factors dmrt1 and foxl2 in the unc-13d promoter, we constructed site-specific mutants using the PGL3-Mn3 plasmid as a template (Figure 5B). Two mutants, Mut-dmrt1 and Mut-foxl2, were obtained (Figure 5B). Luciferase activities were significantly reduced after pcDNA3.0-dmrt1 was used together with pGL3-Mn3 (p < 0.05, Figure 5C), indicating that dmrt1 inhibited the activation of the unc-13d promoter. Additionally, we found that the foxl2 binding site mutation caused a significant down-regulation of the luciferase activity in the Mut-foxl2  +  pcDNA3.0-foxl2 group (p  <  0.05) (p  >  0.05, Figure 5C). These findings suggested that dmrt1 inhibited the activation of the unc-13d promoter, while foxl2 increased its activation.

4. Discussion

DNA methylation play crucial roles in sex determination in animals [6,7,8,9]. As a protogynous hermaphroditic fish, M. albus can transform its gender after its first spawning [13,14], and epigenetic modifications are considered to be among the potential mechanisms for this sex transformation process [25,26].
Unc-13d has been found to be a candidate gene for the sexual transformation of M. albus due to its hypermethylated promoter and low accessibility status, as well as its up-regulation in our previous methylome study [26]. unc-13 has been revealed to be involved in vesicle transport, vesicle guidance, anchoring, and release processes [43,44,45]. unc-13d was first identified in hematopoietic cells [43], and was believed to function as a regulator of the secretory organelle cytosolic emesis initially [46,47]. unc-13b, one homolog of unc13, has been characterized as a potential marker for male fertility in pig and boars [48,49]. However, the physiological roles of unc-13d in the sex differentiation process remain unclear. In this study, the full-length cDNA sequence of unc-13d of M. albus with 4455 bp was obtained. The structural domain analysis indicated that the unc-13d of M. albus contains three conserved regions: C2A, C2B, and DUF1041. On the obtained phylogenetic evolutionary tree, the characterized unc-13d was recovered to a group with homologs from half-smooth tongue sole; homologs from Cartilaginous fish and those of mammals, reptiles, and birds formed separate clades, which is generally consistent with the general pattern of animal evolution. These findings suggest that the evolution of unc-13d is conservative across different groups. The collinearity analysis of unc-13d and its neighboring genes (Figure 2B) revealed that the co-linear block of unc-13d is highly conserved between Lepisosteus oculatus and Mastacembelus armatus, and even among mammals, with some exceptions in the gene orientation of some neighboring genes. All these findings suggest that the characterized unc-13d is conserved among vertebrates.
Using qRT-PCR, unc-13d expression was found to be significantly higher in the ovotestes than in the ovary and testes. The expression localization analysis highlighted that unc-13d was predominantly expressed in oocyte cytoplasm and granulosa cells in the ovary, as well as the spermatogonia and primary spermatocytes in the ovotestes and testes.
Methylation levels were considerably lower at site 114 in the ovotestes compared to the ovaries and testes, and a negative correlation between unc-13d expression and its promoter methylation was found. In the promoter region, pre-2057 bp was identified as a candidate region for transcription factor binding. To accurately locate the promoter binding site, activation of the promoter was detected in different regions of the promoter. Dmrt1 is a crucial player in male sexual development across mammals, birds, amphibians, and scleractinians [50], and foxl2 is recognized as a highly conserved gene across vertebrates, with involvement in almost all stages of ovarian development. The function of foxl2 in ovarian development has been determined in several species [42,51,52,53,54,55,56]. Site-specific mutants were constructed to pinpoint the exact binding site for the expression of unc-13d during transcription-factor-mediated sex reversal, utilizing the PGL3 plasmid as a template. The findings demonstrate a marked reduction in the relative fluorescence intensity of dmrt1 subsequent to the mutation of the dmrt1 binding site, thereby providing evidence of dmrt1’s ability to engage with the UNC-13D promoter and catalyze the expression of unc-13d. To summarize, DNA methylesterases influence the dmrt1 transcription factor’s binding to the promoter region via methylation interactions, leading to alterations in unc-13d function during sexual transformation.

5. Conclusions

M. albus is a hermaphroditic fish that changes from female to male, but its underlying sex reversal mechanism remains unknown. The present study characterized the structure, expression, and function of unc-13d in the process of sex reversal in M. albus. We found that the genomic structure of unc-13d was different from other species. The highest expression was detected in the ovotestes and a strong signal was detected in oocytes and granulosa cells in the ovaries and spermatogonia and primary spermatocytes in the testes, suggesting that unc-13d plays an important role in sex reversal. Additionally, the DNA methylation of the promoter of unc-13d exhibited a negative correlation with gene expression, especially at site 114. Finally, we found that dmrt1 and foxl2 antagonistically regulate unc-13d expression. Taken together, we infer that during sex reversal, DNA methylation affects the binding of the transcription factors dmrt1 and foxl2 in the promoter region through methylation and demethylation interactions to regulate the expression of unc-13d during gonadal development.

Author Contributions

Conceptualization, Q.H.; methodology, Q.H. and Z.L.; formal analysis, Q.H. and Z.L.; investigation, Z.L., Q.H., F.M., X.X. and J.F.; resources, H.T. and Q.H.; data curation, Z.L.; writing—original draft preparation, Z.L., F.M., J.F. and Q.H.; writing—review and editing, Q.H. and H.T.; visualization, Q.H.; supervision, Q.H.; project administration, Q.H.; funding acquisition, Q.H. All authors have read and agreed to the published version of the manuscript.

Funding

This study was supported by Taishan Scholars Program; Key R&D Program of Hubei Province (2023BBB172); Central Public-Interest Scientific Institution Basal Research Fund, Chinese Academy of Fishery Sciences (CASF) (Grant number: Nos. 2023TD36; YFI20240501).

Institutional Review Board Statement

This research has fully complied with research ethics. All animal experiments and methods were performed in accordance with the relevant approved guidelines and regulations, as well as under the approval of the Ethics Committee of Yangtze River Fisheries Research Institute (No. 2013001).

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available in the article.

Conflicts of Interest

The authors declare that they have no competing interests.

References

  1. Koopman, P. Gonad development: Signals for sex. Curr. Biol. 2001, 11, R481–R483. [Google Scholar] [CrossRef] [PubMed][Green Version]
  2. Manolakou, P.; Lavranos, G.; Angelopoulou, R. Molecular patterns of sex determination in the animal kingdom: A comparative study of the biology of reproduction. Reprod. Biol. Endocrinol. 2006, 4, 59. [Google Scholar] [CrossRef] [PubMed][Green Version]
  3. Nelson, J.S. Fishes of the World, 4th ed.; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2006. [Google Scholar]
  4. Desjardins, J.K.; Fernald, R.D. Fish sex: Why so diverse? Curr. Opin. Neurobiol. 2009, 19, 648–653. [Google Scholar] [CrossRef]
  5. Trukhina, A.V.; Lukina, N.A.; Wackerow-Kouzova, N.D.; Smirnov, A.F. The variety of vertebrate mechanisms of sex determination. BioMed Res. Int. 2013, 2013, 587460. [Google Scholar] [CrossRef] [PubMed]
  6. Shao, C.; Li, Q.; Chen, S.; Zhang, P.; Lian, J.; Hu, Q.; Sun, B.; Jin, L.; Liu, S.; Wang, Z.; et al. Epigenetic modification and inheritance in sexual reversal of fish. Genome Res. 2014, 24, 604–615. [Google Scholar] [CrossRef]
  7. Wang, X.X.; Ma, X.; Wei, G.B.; Ma, W.R.; Zhang, Z.; Chen, X.P.; Gao, L.; Liu, Z.B.; Yuan, Y.; Yi, L.Z.; et al. The role of DNA methylation reprogramming during sex determination and transition in zebrafish. Genom. Proteom. Bioinform. 2021, 19, 48–63. [Google Scholar] [CrossRef]
  8. Sun, D.; Li, Q.; Yu, H. DNA methylation differences between male and female gonads of the oyster reveal the role of epigenetics in sex determination. Gene 2022, 820, 146260. [Google Scholar] [CrossRef]
  9. Navarro-Martín, L.; Viñas, J.; Ribas, L.; Díaz, N.; Gutiérrez, A.; Di Croce, L.; Piferrer, F. DNA methylation of the gonadal aromatase (cyp19a) promoter is involved in temperature-dependent sex ratio shifts in the European sea bass. PLoS Genet. 2011, 7, e1002447. [Google Scholar] [CrossRef]
  10. Yang, D.; Chen, F.; Ruan, G. Aquaculture of the paddy Eel, Monopterus albus. In Aquaculture in China: Success Stories and Modern Trends; John Wiley & Sons, Inc.: Hoboken, NJ, USA, 2018; pp. 283–296. [Google Scholar]
  11. Khanh, N.; Ngan, H. Current practices of rice fifield eel Monopterus albus (zuiew, 1973) culture in Viet Nam. Aquac. Asia Mag. 2010, 15, 26–29. [Google Scholar]
  12. Nhan, H.T.; Tai, N.T.; Liem, P.T.; Ut, V.N.; Ako, H. Effects of different stocking densities on growth performance of Asian swamp eel Monopterus albus, water quality and plant growth of watercress Nasturtium officinale in an aquaponic recirculating system. Aquaculture 2019, 503, 96–104. [Google Scholar] [CrossRef]
  13. Liu, C.K. Rudimentary hermaphroditism in the symbranchoid eel, Monopterus javanensis. Sinensia 1944, 15, 1–8. [Google Scholar]
  14. Liem, K.F. Sex reversal as a natural process in the synbranchiform fish Monopterus albus. Copeia 1963, 2, 303–312. [Google Scholar] [CrossRef]
  15. Chan, S.T.H.; Phillips, J.G. The structure of the gonad during natural sex reversal in Monopterus albus (Pisces: Teleostei). J. Zool. 1967, 151, 129–141. [Google Scholar] [CrossRef]
  16. Xiao, Y. Study on the reproductive biology of Monopterus albus (Zuiew) II female development of Monopterus albus. ACTA Sci. Nat. Universtis Norm. Hunanensis 1995, 18, 45–51. [Google Scholar]
  17. Xiao, Y.M.; Liu, Y. Study on the histology in sex changing from intersex to male of Monopterus albus. Fish China 1995, 19, 297–304. [Google Scholar]
  18. He, Z.; Deng, F.; Xiong, S.; Cai, Y.; He, Z.; Wang, X.; Li, S.; Yang, D.; Yan, T. Expression and regulation of Smad2 by gonadotropins in the protogynous hermaphroditic ricefield eel (Monopterus albus). Fish Physiol. Biochem. 2020, 46, 1155–1165. [Google Scholar] [CrossRef]
  19. Zhao, X.; Luo, M.; Li, Z.; Zhong, P.; Cheng, Y.; Lai, F.; Wang, X.; Min, J.; Bai, M.; Yang, Y.; et al. Chromosome-scale assembly of the Monopterus genome. Gigascience 2018, 7, giy046. [Google Scholar] [CrossRef]
  20. Cheng, H.; Guo, Y.; Yu, Q.; Zhou, R. The rice field eel as a model system for vertebrate sexual development. Cytogenet. Genome Res. 2003, 101, 274–277. [Google Scholar] [CrossRef]
  21. Cheng, H.; He, Y.; Zhou, R. Swamp eel (Monopterus albus). Trends Genet. 2021, 37, 1137–1138. [Google Scholar] [CrossRef]
  22. Hu, Q.; Xiao, Q.; Tian, H.; Li, D.; Li, Z. Crucial role of dead end gene for primordial germ cell survival in rice field eel (Monopterus albus). Theriogenology 2021, 176, 188–193. [Google Scholar] [CrossRef]
  23. Chen, H.; Liu, H.; Li, R.; Lin, X.; Luo, H.; Ji, S.; Hu, W.; Luo, D. Blood cell identification and hematological analysis during natural sex reversal in rice field eel (Monopterus albus). Aquaculture 2021, 538, 736543. [Google Scholar] [CrossRef]
  24. Yan, T.; Lu, H.; Sun, C.; Peng, Y.; Meng, F.; Gan, R.; Cui, X.; Wu, C.; Zhang, S.; Yang, Y.; et al. Nr5a homologues in the ricefield eel Monopterus albus: Alternative splicing, tissue-specific expression, and differential roles on the activation of cyp19a1a promoter in vitro. Gen. Comp. Endocrinol. 2021, 312, 113871. [Google Scholar] [CrossRef] [PubMed]
  25. Wang, X.; Lai, F.; Xiong, J.; Zhu, W.; Yuan, B.; Cheng, H.; Zhou, R. DNA methylation modification is associated with gonadal differentiation in Monopterus albus. Cell Biosci. 2020, 10, 129. [Google Scholar] [CrossRef] [PubMed]
  26. Hu, Q.; Lian, Z.; Xia, X.; Tian, H.; Li, Z. Integrated chromatin accessibility and DNA methylation analysis to reveal the critical epigenetic modification and regulatory mechanism in gonadal differentiation of the sequentially hermaphroditic fish, Monopterus albus. Biol. Sex Differ. 2022, 13, 73. [Google Scholar] [CrossRef]
  27. Letunic, I.; Copley, R.R.; Pils, B.; Pinkert, S.; Schultz, J.; Bork, P. SMART 5: Domains in the context of genomes and networks. Nucleic Acids Res. 2006, 34, 257–260. [Google Scholar] [CrossRef]
  28. Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein identification and analysis tools on the expasy server. In The Proteomics Protocols Handbook; Walker, J.M., Ed.; Humana Press: Totowa, NJ, USA, 2005; pp. 571–607. [Google Scholar]
  29. Waterhouse, A.; Bertoni, M.; Bienert, S.; Studer, G.; Tauriello, G.; Gumienny, R.; Heer, F.T.; de Beer, T.A.P.; Rempfer, C.; Bordoli, L.; et al. SWISS-MODEL: Homology modelling of protein structures and complexes. Nucleic Acids Res. 2018, 46, W296–W303. [Google Scholar] [CrossRef]
  30. Kumar, S.; Stecher, G.; Tamura, K. MEGA7: Molecular evolutionary genetics analysis version 7.0 for bigger datasets. Mol. Biol. Evol. 2016, 33, 1870–1874. [Google Scholar] [CrossRef]
  31. Sharma, V.; Murphy, D.P.; Provan, G.; Baranov, P.V. CodonLogo: A sequence logo-based viewer for codon patterns. Bioinformatics 2012, 28, 1935–1936. [Google Scholar] [CrossRef]
  32. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, 202–208. [Google Scholar] [CrossRef]
  33. Louis, A.; Muffato, M.; Roest Crollius, H. Genomicus: Five genome browsers for comparative genomics in eukaryota. Nucleic Acids Res. 2013, 41, D700–D705. [Google Scholar] [CrossRef]
  34. Liu, Y.; Wu, S.; Jiang, N.; Liu, W.; Zhou, Y.; Zeng, L.; Zhong, Q.W.; Li, Z.; Fan, Y. Characterization of reference genes for qRT-PCR normalization in rice-field eel (Monopterus albus) to assess differences in embryonic developmental stages, the early development of immune organs, and cells infected with rhabdovirus. Fish Shellfish Immunol. 2022, 120, 92–101. [Google Scholar] [CrossRef]
  35. Schmittgen, T.D.; Livak, K.J. Analyzing real-time PCR data by the comparative C(T) method. Nat. Protoc. 2008, 3, 1101–1108. [Google Scholar] [CrossRef] [PubMed]
  36. Lalitha, S. Primer premier 5. Biotech Softw. Internet Rep. 2000, 1, 270–272. [Google Scholar] [CrossRef]
  37. Li, L.C.; Dahiya, R. MethPrimer: Designing primers for methylation PCRs. Bioinformatics 2002, 18, 1427–1431. [Google Scholar] [CrossRef] [PubMed]
  38. Rohde, C.; Zhang, Y.; Reinhardt, R.; Jeltsch, A. BISMA—Fast and accurate bisulfite sequencing data analysis of individual clones from unique and repetitive sequences. BMC Bioinform. 2010, 11, 230. [Google Scholar] [CrossRef]
  39. Castro-Mondragon, J.A.; Riudavets-Puig, R.; Rauluseviciute, I.; Lemma, R.B.; Turchi, L.; Blanc-Mathieu, R.; Lucas, J.; Boddie, P.; Khan, A.; Pérez, N.M.; et al. JASPAR 2022: The 9th release of the open-access database of transcription factor binding profiles. Nucleic Acids Res. 2022, 50, D165–D173. [Google Scholar] [CrossRef]
  40. Mustapha, U.F.; Assan, D.; Huang, Y.Q.; Li, G.L.; Jiang, D.N. High polymorphism in the dmrt2a gene is incompletely sex-linked in spotted 395 scat, Scatophagus argus. Animals 2022, 12, 613. [Google Scholar] [CrossRef]
  41. Smith, C.A.; Roeszler, K.N.; Ohnesorg, T.; Cummins, D.M.; Farlie, P.G.; Doran, T.J.; Sinclair, A.H. The avian Z-linked gene DMRT1 is required for male sex determination in the chicken. Nature 2009, 461, 267–271. [Google Scholar] [CrossRef]
  42. Boulanger, L.; Pannetier, M.; Gall, L.; Allais-Bonnet, A.; Elzaiat, M.; Le Bourhis, D.; Daniel, N.; Richard, C.; Cotinot, C.; Ghyselinck, N.B.; et al. FOXL2 is a female sex-determining gene in the goat. Curr. Biol. 2014, 24, 404–408. [Google Scholar] [CrossRef]
  43. Koch, H.; Hofmann, K.; Brose, N. Definition of Munc13-homology-domains and characterization of a novel ubiquitously expressed Munc13 isoform. Biochem. J. 2000, 349 Pt 1, 247–253. [Google Scholar] [CrossRef]
  44. Brose, N.; Hofmann, K.; Hata, Y.; Südhof, T.C. Mammalian homologues of Caenorhabditis elegans unc-13 gene define novel family of C2-domain proteins. J. Biol. Chem. 1995, 270, 25273–25280. [Google Scholar] [CrossRef] [PubMed]
  45. Kang, L.; He, Z.; Xu, P.; Fan, J.; Betz, A.; Brose, N.; Xu, T. Munc13-1 is required for the sustained release of insulin from pancreatic beta cells. Cell Metab. 2006, 3, 463–468. [Google Scholar] [CrossRef] [PubMed]
  46. Neeft, M.; Wieffer, M.; de Jong, A.S.; Negroiu, G.; Metz, C.H.; van Loon, A.; Griffith, J.; Krijgsveld, J.; Wulffraat, N.; Koch, H.; et al. Munc13-4 is an effector of rab27a and controls secretion of lysosomes in hematopoietic cells. Mol. Biol. Cell. 2005, 16, 731–741. [Google Scholar] [CrossRef] [PubMed]
  47. Feldmann, J.; Callebaut, I.; Raposo, G.; Certain, S.; Bacq, D.; Dumont, C.; Lambert, N.; Ouachée-Chardin, M.; Chedeville, G.; Tamary, H.; et al. Munc13-4 is essential for cytolytic granules fusion and is mutated in a form of familial hemophagocytic lymphohistiocytosis (FHL3). Cell 2003, 115, 461–473. [Google Scholar] [CrossRef]
  48. Pang, W.K.; Amjad, S.; Ryu, D.Y.; Adegoke, E.O.; Rahman, M.S.; Park, Y.J.; Pang, M.G. Establishment of a male fertility prediction model with sperm RNA markers in pigs as a translational animal model. J. Anim. Sci. Biotechnol. 2022, 13, 84. [Google Scholar] [CrossRef]
  49. Pang, W.K.; Park, Y.J.; Pang, M.G. Development of a biomolecular approach to identify sperm functions and fertility using sperm RNAs. Front. Cell Dev. Biol. 2023, 11, 1308167. [Google Scholar] [CrossRef]
  50. Webster, K.A.; Schach, U.; Ordaz, A.; Steinfeld, J.S.; Draper, B.W.; Siegfried, K.R. Dmrt1 is necessary for male sexual development in zebrafish. Dev. Biol. 2017, 422, 33–46. [Google Scholar] [CrossRef]
  51. Cocquet, J.; Pailhoux, E.; Jaubert, F.; Servel, N.; Xia, X.; Pannetier, M.; De Baere, E.; Messiaen, L.; Cotinot, C.; Fellous, M.; et al. Evolution and expression of FOXL2. Med. Genet. 2002, 39, 916–921. [Google Scholar] [CrossRef]
  52. Wang, D.D.; Zhang, G.R.; Wei, K.J.; Ji, W.; Gardner, J.P.; Yang, R.B.; Chen, K.C. Molecular identification and expression of the Foxl2 gene during gonadal sex differentiation in northern snakehead Channa argus. Fish Physiol. Biochem. 2015, 41, 1419–1433. [Google Scholar] [CrossRef]
  53. Sridevi, P.; Senthilkumaran, B. Cloning and differential expression of FOXL2 during ovarian development and recrudescence of the catfish, Clarias gariepinus. Gen. Comp. Endocrinol. 2011, 174, 259–268. [Google Scholar] [CrossRef]
  54. Wang, D.; Kobayashi, T.; Zhou, L.; Nagahama, Y. Molecular cloning and gene expression of Foxl2 in the Nile tilapia, Oreochromis niloticus. Biochem. Biophys. Res. Commun. 2004, 320, 83–89. [Google Scholar] [CrossRef] [PubMed]
  55. Schmidt, D.; Ovitt, C.E.; Anlag, K.; Fehsenfeld, S.; Gredsted, L.; Treier, A.C.; Treier, M. The murine winged-helix transcription factor Foxl2 is required for granulosa cell differentiation and ovary maintenance. Development 2004, 131, 933–942. [Google Scholar] [CrossRef] [PubMed]
  56. Uhlenhaut, N.H.; Jakob, S.; Anlag, K.; Eisenberger, T.; Sekido, R.; Kress, J.; Treier, A.C.; Klugmann, C.; Klasen, C.; Holter, N.I.; et al. Somatic sex reprogramming of adult ovaries to testes by foxl2 ablation. Cell 2009, 139, 1130–1142. [Google Scholar] [CrossRef] [PubMed]
Figure 1. Nucleotide sequence of Monopterus albus unc-13d cDNA and its protein 3D structure. (A) Nucleotide sequence and deduced amino acid sequence of UNC13D. a: The green region is the C2A-Munc13-like conserved domain. b: Green squares are C2B-Munc13-like conserved domains. c: Red region is the DUF 1041 super family conserved domain. The orange regions are the three low-complexity domains. (B) UNC13D protein model. (a) Model of UNC13D protein cartoon ribbons; (b) UNC13D protein stick model; (c) UNC13D protein sphere model.
Figure 1. Nucleotide sequence of Monopterus albus unc-13d cDNA and its protein 3D structure. (A) Nucleotide sequence and deduced amino acid sequence of UNC13D. a: The green region is the C2A-Munc13-like conserved domain. b: Green squares are C2B-Munc13-like conserved domains. c: Red region is the DUF 1041 super family conserved domain. The orange regions are the three low-complexity domains. (B) UNC13D protein model. (a) Model of UNC13D protein cartoon ribbons; (b) UNC13D protein stick model; (c) UNC13D protein sphere model.
Animals 15 00122 g001
Figure 2. Phylogenetic tree of the amino acid sequence and gene structure of UNC13D. (A) Phylogenetic tree of the amino acid sequence of UNC13D; (B) gene structure of unc-13d among species.
Figure 2. Phylogenetic tree of the amino acid sequence and gene structure of UNC13D. (A) Phylogenetic tree of the amino acid sequence of UNC13D; (B) gene structure of unc-13d among species.
Animals 15 00122 g002
Figure 3. Expression and localization of unc-3d during gonad development in the ovaries, ovotestes, and testes of the Monopterus albus. (A) Detection of unc-3d expression in ovaries, ovotestes, and testes by qRT-PCR. (B) Detection of unc-3d RNA expression in ovaries, ovotestes, and testes by in situ hybridization. FM: Follicular membrane; Nu: Nucleolus; Oo II: phase II oocytes; Oo III: phase III oocytes; PSG: primary spermatogonia; SG: spermatogonia; YM: yolk mass; Yp: yolk platelet; GC: granulosa cells; (a,b): control without probe; (c,d): ovary; (e,f): ovotestis; (g,h): male; (b,d,f,h) show the large magnification of frame areas in (a,c,e,g), respectively. The asterisk (*) indicates a significant difference between the two groups.
Figure 3. Expression and localization of unc-3d during gonad development in the ovaries, ovotestes, and testes of the Monopterus albus. (A) Detection of unc-3d expression in ovaries, ovotestes, and testes by qRT-PCR. (B) Detection of unc-3d RNA expression in ovaries, ovotestes, and testes by in situ hybridization. FM: Follicular membrane; Nu: Nucleolus; Oo II: phase II oocytes; Oo III: phase III oocytes; PSG: primary spermatogonia; SG: spermatogonia; YM: yolk mass; Yp: yolk platelet; GC: granulosa cells; (a,b): control without probe; (c,d): ovary; (e,f): ovotestis; (g,h): male; (b,d,f,h) show the large magnification of frame areas in (a,c,e,g), respectively. The asterisk (*) indicates a significant difference between the two groups.
Animals 15 00122 g003
Figure 4. Changes of unc-13d promoter methylation levels during sex reversal. (A) Methylation level changes during sex reversal process. The red, blue, and white boxes indicate methylated, unmethylated, and unknown positions, respectively. Results are presented as mean ± SE. (B) The percentage of DNA methylated at the CpG site. An asterisk (*) indicates a significant difference between the two groups, while two asterisks (**) indicate a highly significant difference.
Figure 4. Changes of unc-13d promoter methylation levels during sex reversal. (A) Methylation level changes during sex reversal process. The red, blue, and white boxes indicate methylated, unmethylated, and unknown positions, respectively. Results are presented as mean ± SE. (B) The percentage of DNA methylated at the CpG site. An asterisk (*) indicates a significant difference between the two groups, while two asterisks (**) indicate a highly significant difference.
Animals 15 00122 g004
Figure 5. Luciferase detection of transcription factor binding sites and activation. (A) Schematic diagram of dmrt1 and foxl2 binding sites. (A) Schematic diagram of deletion fragments in the promoter region of unc-13d in Monopterus albus. (B) Schematic diagram of the DNA sequences of the mutant and wild type. The dmrt1 and foxl2 mutation sites are shown in yellow and blue, respectively. (C) Luciferase assay reveals unc-13d promoter activity in 293T cell. The mean ± SEM was from three independent experiments; * p < 0.05 shows significant difference. Groups with different letters are significantly different (p < 0.05).
Figure 5. Luciferase detection of transcription factor binding sites and activation. (A) Schematic diagram of dmrt1 and foxl2 binding sites. (A) Schematic diagram of deletion fragments in the promoter region of unc-13d in Monopterus albus. (B) Schematic diagram of the DNA sequences of the mutant and wild type. The dmrt1 and foxl2 mutation sites are shown in yellow and blue, respectively. (C) Luciferase assay reveals unc-13d promoter activity in 293T cell. The mean ± SEM was from three independent experiments; * p < 0.05 shows significant difference. Groups with different letters are significantly different (p < 0.05).
Animals 15 00122 g005
Table 1. Primers used in this study.
Table 1. Primers used in this study.
PrimerPrimer Sequences (5′-3′)UtilizationProducts Size
Unc13d-5′TATTGTTGTTTAATGGCGATG5′RACE amplification/
Unc13d-3′ACCGCAAATACCACCACA3′RACE amplification/
Unc13d-S1TTGACGAGGAAATTGCGAGACIn situ hybridization815 bp
Unc13d-S-T7GATCACTAATACGACTCACTATA
GTTGACGAGGAAATTGCGAGAC
In situ hybridization815 bp
Unc13d-A-T7GATCACTAATACGACTCACTATA
GCCAGCACTCAGCGTCCCAT
In situ hybridization815 bp
Unc13d-A1CCAGCACTCAGCGTCCCATIn situ hybridization815 bp
Unc13d-STTGACGAGGAAATTGCGAGACqRT-PCR148 bp
Unc13d-ATTGTTGACGGTTTACCCATCTTATqRT-PCR148 bp
EF-1α-FCGCTGCTGTTTCCTTCGTCCInternal reference102 bp
EF-1α-RTTGCGTTCAATCTTCCATCCInternal reference102 bp
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Lian, Z.; Meng, F.; Xia, X.; Fang, J.; Tian, H.; Hu, Q. Molecular Characterization and Expression of unc-13d in the Sex Reversal of Monopterus albus. Animals 2025, 15, 122. https://doi.org/10.3390/ani15020122

AMA Style

Lian Z, Meng F, Xia X, Fang J, Tian H, Hu Q. Molecular Characterization and Expression of unc-13d in the Sex Reversal of Monopterus albus. Animals. 2025; 15(2):122. https://doi.org/10.3390/ani15020122

Chicago/Turabian Style

Lian, Zitong, Fang Meng, Xueping Xia, Junchao Fang, Haifeng Tian, and Qiaomu Hu. 2025. "Molecular Characterization and Expression of unc-13d in the Sex Reversal of Monopterus albus" Animals 15, no. 2: 122. https://doi.org/10.3390/ani15020122

APA Style

Lian, Z., Meng, F., Xia, X., Fang, J., Tian, H., & Hu, Q. (2025). Molecular Characterization and Expression of unc-13d in the Sex Reversal of Monopterus albus. Animals, 15(2), 122. https://doi.org/10.3390/ani15020122

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop