Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Reagent
2.2. Ethics
2.3. Experimental Design
2.4. Animals
2.5. Bacteriological Analysis
2.6. Cell Isolation and Culture
2.7. Cytological Staining and Immunocytochemical Analysis
2.8. Cell Proliferation
2.9. Colony-Forming Unit (CFU) Assays
2.10. Differentiation Assay
2.11. RNA Extraction and RT–PCR Analysis
2.12. Western Blotting for Klotho Protein
2.13. Statistical Analysis
3. Results
3.1. Animals
3.2. Bacteriological Results
3.3. Isolation of Urine-Derived Cells
3.4. Cytological Staining and Immunocytochemical Analysis
3.5. Cell Proliferation Analysis
3.5.1. Healthy Dogs
3.5.2. Sick Dogs
3.6. CFU Assays
3.7. In Vitro Differentiation
3.7.1. Osteogenic Differentiation
3.7.2. Adipogenic Differentiation
3.7.3. Chondrogenic Differentiation
3.8. RNA Extraction and RT-PCR Analysis
3.9. Western Blotting for Klotho Protein
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Paris, D.B.; Stout, T.A. Equine embryos and embryonic stem cells: Defining reliable markers of pluripotency. Theriogenology 2010, 74, 516–524. [Google Scholar] [CrossRef]
- Xu, Y.; Zhang, T.; Chen, Y.; Qiang, S.; Muzhi, L.; Tian, Q.; Jianzhong, H.; Hongbin, L.; Jun, L.; Can, C. Isolation and Characterization of Multipotent Canine Urine-Derived Stem Cells. Stem Cells Int. 2020, 2020, 8894449. [Google Scholar] [CrossRef] [PubMed]
- Cremonesi, F.; Corradetti, B.; Lange-Consiglio, A. Fetal adnexa derived stem cells from domestic animal: Progress and perspectives. Theriogenology 2011, 75, 1400–1415. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; McNeill, E.; Tian, H.; Soker, S.; Andersson, K.E.; Yoo, J.J.; Atala, A. Urine derived cells are a potential source for urological tissue reconstruction. J. Urol. 2008, 180, 2226–2233. [Google Scholar] [CrossRef] [PubMed]
- Burdeyron, P.; Giraud, S.; Hauet, T.; Steichen, C. Urine-derived stem/progenitor cells: A focus on their characterization and potential. World J. Stem Cells 2020, 12, 1080–1096. [Google Scholar] [CrossRef] [PubMed]
- Dominici, M.; Le Blanc, K.; Mueller, I.; Slaper-Cortenbach, I.; Marini, F.C.; Krause, D.S.; Deans, R.J.; Keating, A.; Prockop, D.J.; Horwitz, E.M. Minimal criteria for defining multipotent mesenchymal stromal cells. The International Society for Cellular Therapy position statement. Cytotherapy 2006, 8, 315–317. [Google Scholar] [CrossRef] [PubMed]
- Ji, X.; Wang, M.; Chen, F.; Zhou, J. Urine-derived stem cells: The present and the future. Stem Cells Int. 2017, 2017, 4378947. [Google Scholar] [CrossRef]
- Chen, L.; Li, L.; Xing, F.; Peng, J.; Peng, K.; Wang, Y.; Xiang, Z. Human urine-derived stem cells: Potential for cell-based therapy of cartilage defects. Stem Cells Int. 2018, 2018, 1–14. [Google Scholar] [CrossRef] [PubMed]
- Bodin, A.; Bharadwaj, S.; Wu, S.; Gatenholm, P.; Atala, A.; Zhang, Y. Tissue-engineered conduit using urine-derived stem cells seeded bacterial cellulose polymer in urinary reconstruction and diversion. Biomaterials 2010, 31, 8889–8901. [Google Scholar] [CrossRef] [PubMed]
- Yu, P.; Opara, E.C.; Zhang, Y. Power of pee: Urine-derived stem cells in urological disorders. UroPrecision 2023, 1, 38–44. [Google Scholar] [CrossRef]
- Ouyang, B.; Sun, X.; Han, D.; Chen, S.; Yao, B.; Gao, Y.; Bian, I.; Huang, Y.; Zhang, Y.; Wan, Z.; et al. Human urine-derived stem cells alone or genetically-modified with FGF2 improve type 2 diabetic erectile dysfunction in a rat model. PLoS ONE 2014, 9, e92825. [Google Scholar] [CrossRef] [PubMed]
- Sun, B.; Luo, X.; Yang, C.; Liu, P.; Yang, Y.; Dong, X.; Yang, Z.; Xu, J.; Zhang, Y.; Li, L. Therapeutic effects of human urine-derived stem cells in a rat model of cisplatin-induced acute kidney injury in vivo and in vitro. Stem Cells Int. 2019, 2019, 8035076. [Google Scholar] [CrossRef]
- Duan, Y.R.; Chen, B.P.; Chen, F.; Yang, S.X.; Zhu, C.Y.; Ma, Y.L.; Li, Y.; Shi, J. Exosomal microRNA-16-5p from human urine-derived stem cells ameliorates diabetic nephropathy through protection of podocyte. J. Cell Mol. Med. 2019, 25, 10798–10813. [Google Scholar] [CrossRef] [PubMed]
- Dong, X.; Zhang, T.; Liu, Q.; Zhu, J.; Zhao, J.; Li, J.; Sun, B.; Ding, G.; Hu, X.; Yang, Z.; et al. Beneficial effects of urine-derived stem cells on fibrosis and apoptosis of myocardial, glomerular and bladder cells. Mol. Cell Endocrinol. 2016, 427, 21–32. [Google Scholar] [CrossRef] [PubMed]
- Zhou, C.; Wu, X.R.; Liu, H.S.; Liu, X.H.; Liu, G.H.; Zheng, X.B.; Hu, T.; Liang, Z.-X.; He, X.-W.; Wu, X.-J.; et al. Immunomodulatory effect of urine-derived stem cells on inflammatory bowel diseases via downregulating Th1/Th17 immune responses in a PGE2-dependent manner. J. Crohns Colitis. 2020, 14, 654–668. [Google Scholar] [CrossRef]
- Guan, J.; Zhang, J.; Li, H.; Zhu, Z.; Guo, S.; Niu, X.; Wang, Y.; Zhang, C. Human urine derived stem cells in combination with β-TCP can be applied for bone regeneration. PLoS ONE 2015, 10, e0125253. [Google Scholar] [CrossRef]
- Zhang, X.R.; Huang, Y.Z.; Gao, H.W.; Jiang, Y.-L.; Hu, J.-G.; Pi, J.-Q.; Chen, A.-J.; Zhang, Y.; Zhou, L.; Xieet, H.-Q. Hypoxic preconditioning of human urine-derived stem cell-laden small intestinal submucosa enhances wound healing potential. Stem Cell Res. Ther. 2020, 11, 150. [Google Scholar] [CrossRef] [PubMed]
- Kim, S.H.; Jin, J.A.; So, H.J.; Lee, S.H.; Kang, T.W.; Lee, J.U.; Choi, D.E.; Jeong, J.Y.; Chang, Y.K.; Choi, H.; et al. Urine-Derived Stem Cell-Secreted Klotho Plays a Crucial Role in the HK-2 Fibrosis Model by Inhibiting the TGF-β Signaling Pathway. Int. J. Mol. Sci. 2022, 23, 5012. [Google Scholar] [CrossRef]
- Doi, S.; Zou, Y.; Togao, O.; Pastor, J.V.; John, G.B.; Wang, L.; Shiizaki, K.; Gotschall, R.; Schiavi, S.; Yorioka, N.; et al. Klotho inhibits transforming growth factor-beta1 (TGF-beta1) signaling and suppresses renal fibrosis and cancer metastasis in mice. J. Biol. Chem. 2011, 286, 8655–8665. [Google Scholar] [CrossRef] [PubMed]
- Choi, D.E.; Hwang, Y.; Park, H.; Han, S.; Shin, J.A.; Park, H.; Jeong, J.Y.; Na, K.R.; Lee, K.W.; Chang, Y.K. Urine-Derived Stem Cell attenuated renal fibrosis via Klotho activation. Kidney Int. Rep. 2023, 8, S226. [Google Scholar]
- Benigni, A.; Morigi, M.; Remuzzi, G. Kidney regeneration. Lancet 2010, 375, 1310–1317. [Google Scholar] [CrossRef] [PubMed]
- Menn-Josephy, H.; Lee, C.S.; Nolin, A.; Christov, M.; Rybin, D.V.; Weinberg, J.M.; Henderson, J.; Bonegio, R.; Havasi, A. Renal Interstitial Fibrosis: An Imperfect Predictor of Kidney Disease Progression in Some Patient Cohorts. Am. J. Nephrol. 2016, 44, 289–299. [Google Scholar] [CrossRef]
- Grange, C.; Papadimitriou, E.; Dimuccio, V.; Pastorino, C.; Molina, J.; O’Kelly, R.; Niedernhofer, L.J.; Robbins, P.D.; Camussi, G.; Bussolati, B. Urinary Extracellular Vesicles Carrying Klotho Improve the Recovery of Renal Function in an Acute Tubular Injury Model. Mol. Ther. 2020, 28, 490–502. [Google Scholar] [CrossRef] [PubMed]
- Cahan, P.; Daley, G.Q. Origins and implications of pluripotent stem cell variability and heterogeneity. Nat. Rev. Mol. Cell Biol. 2013, 14, 357–368. [Google Scholar] [CrossRef] [PubMed]
- Korzyńska, A.; Zychowicz, M. A method of estimation of the cell doubling time on basis of the cell culture monitoring data. Biocybern. Biomed. Eng. 2008, 28, 75–82. [Google Scholar]
- Romanov, Y.A.; Svintsitskaya, V.A.; Smirnov, V.N. Searching for alternative sources of postnatal human mesenchymal stem cells: Candidate MSC-like cells from umbilical cord. Stem Cells 2003, 21, 105–110. [Google Scholar] [CrossRef] [PubMed]
- Soncini, M.; Vertua, E.; Gibelli, L.; Zorzi, F.; Denegri, M.; Albertini, A.; Wengler, G.S.; Parolini, O. Isolation and characterization of mesenchymal cells from human fetal membranes. J. Tissue Eng. Regen. Med. 2007, 1, 296–305. [Google Scholar] [CrossRef] [PubMed]
- Qin, D.; Long, T.; Deng, J.; Zhang, Y. Urine-derived stem cells for potential use in bladder repair. Stem Cell Res. Ther. 2014, 5, 69. [Google Scholar] [CrossRef] [PubMed]
- Lang, R.; Liu, G.; Shi, Y.; Bharadwaj, S.; Leng, X.; Zhou, X.; Liu, H.; Atala, A.; Zhang, Y. Self-renewal and differentiation capacity of urine-derived stem cells after urine preservation for 24 hours. PLoS ONE 2013, 8, e53980. [Google Scholar] [CrossRef]
- Gao, P.; Han, P.; Jiang, D.; Yang, S.; Cui, Q.; Li, Z. Effects of the donor age on proliferation, senescence and osteogenic capacity of human urine-derived stem cells. Cytotechnology 2017, 69, 751–763. [Google Scholar] [CrossRef] [PubMed]
- Wu, S.; Liu, Y.; Bharadwaj, S.; Atala, A.; Zhang, Y. Human urine-derived stem cells seeded in a modified 3D porous small intestinal submucosa scaffold for urethral tissue engineering. Biomaterials 2011, 32, 1317–1326. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Pareta, R.A.; Wu, R.; Shi, Y.; Zhou, X.; Liu, H.; Deng, C.; Sun, X.; Atala, A.; Opara, E.C.; et al. Affiliations expand skeletal myogenic differentiation of urine-derived stem cells and angiogenesis using microbeads loaded with growth factors. Biomaterials 2013, 34, 1311–1326. [Google Scholar] [CrossRef] [PubMed]
- Lange-Consiglio, A.; Spelta, C.; Garlappi, R.; Luini, M.V.; Cremonesi, F. Intramammary administration of platelet concentrate as an unconventional therapy in bovine mastitis: First clinical application. J. Dairy Sci. 2014, 97, 6223–6230. [Google Scholar] [CrossRef]
- Lange-Consiglio, A.; Cazzaniga, N.; Garlappi, R.; Spelta, C.; Pollera, C.; Perrini, C.; Cremonesi, F. Platelet concentrate in bovine reproduction: Effects on in vitro embryo production and after intrauterine administration in repeat breeder cows. Reprod. Biol. Endocrinol. 2015, 13, 65. [Google Scholar] [CrossRef] [PubMed]
- Marini, M.G.; Perrini, C.; Esposti, P.; Corradetti, B.; Bizzaro, D.; Riccaboni, P.; Fantinato, E.; Urbani, G.; Gelati, G.; Cremonesi, F.; et al. Effects of platelet-rich plasma in a model of bovine endometrial inflammation in vitro. Reprod. Biol. Endocrinol. 2016, 14, 58. [Google Scholar] [CrossRef] [PubMed]
- Cremonesi, F.; Bonfanti, S.; Idda, A.; Anna, L.C. Improvement of embryo recovery in Holstein cows treated by intra-ovarian platelet rich plasma before superovulation. Vet. Sci. 2020, 7, 16. [Google Scholar] [CrossRef]
- Lange-Consiglio, A.; Gaspari, G.; Riccaboni, P.; Canesi, S.; Bosi, G.; Vigo, D.; Cremonesi, F. Platelet-rich plasma and ovarian quiescence: A bovine in vitro model for regeneration of the ovary. Reprod. Fertil. Dev. 2023, 35, 433–444. [Google Scholar] [CrossRef] [PubMed]
- Lange-Consiglio, A.; Corradetti, B.; Meucci, A.; Perego, R.; Bizzaro, D.; Cremonesi, F. Characteristics of equine mesenchymal stem cells derived from amnion and bone marrow: In vitro proliferative and multilineage potential assessment. Equine Vet. J. 2013, 45, 737–744. [Google Scholar] [CrossRef]
- Guest, D.J.; Smith, M.R.; Allen, W.R. Equine embryonic stem-like cells and mesenchymal stromal cells have different survival rates and migration patterns following their injection into damaged superficial digital flexor tendon. Equine Vet. J. 2010, 42, 636–642. [Google Scholar] [CrossRef]
- Sarugaser, R.; Lickorish, D.; Baksh, D.; Hosseini, M.M.; Davies, J.E. Human umbilical cord perivascular (HUCPV) cells: A source of mesenchymal progenitors. Stem Cells 2005, 23, 220–229. [Google Scholar] [CrossRef]
- Lange-Consiglio, A.; Corradetti, B.; Bizzaro, D.; Magatti, M.; Ressel, L.; Tassan, S.; Parolini, O.; Cremonesi, F. Characterization and potential applications of progenitor-like cells isolated from horse amniotic membrane. J. Tissue Eng. Regen. Med. 2012, 6, 622–635. [Google Scholar] [CrossRef] [PubMed]
- Vidal, M.A.; Kilroy, G.E.; Lopez, M.J.; Johnson, J.R.; Moore, R.M.; Gimble, J.M. Characterization of equine adipose tissue-derived stromal cells: Adipogenic and osteogenic capacity and comparison with bone marrow-derived mesenchymal stromal cells. Vet. Surg. 2007, 36, 613–622. [Google Scholar] [CrossRef] [PubMed]
- Barteges, J.W. Chronic kidney disease in dogs and cats. Vet. Clin. Small Anim. 2012, 42, 669–692. [Google Scholar] [CrossRef] [PubMed]
- Sosnar, M. Retrospective study of renal failure in dogs and cats admitted to University of Veterinary and Pharmaceutical Sciences Brno during 1999–2020. Acta Vet. Brno 2003, 72, 593–598. [Google Scholar] [CrossRef]
- Gizzarelli, M.; Roura, X.; Scarpa, P.; D’Ippolito, P.; Foglia Manzillo, V.; Oliva, G.; Tarducci, A.; Borrelli, A.; Melis, G.; Quintavalla, F.; et al. Prevalence of Proteinuria in Owned Dogs from Italy: A Multicentric Study. Vet. Med. Int. 2019, 2019, 6073624. [Google Scholar] [CrossRef]
- Le Rutte, E.A.; van der Wilt, L.; Bulstra, C.A.; Nieboer, D.; Kontoroupis, P.; de Vlas, S.J.; Richardus, J.H. Incidence and geographical distribution of canine leishmaniosis in 2016–2017 in Spain and France. Vet. Parasitol. Reg. Stud. Rep. 2021, 2021, 100613. [Google Scholar] [CrossRef] [PubMed]
Markers | Sequence (5′ → 3′) | Product Size (bp) | Annealing Temperature |
---|---|---|---|
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) | F: GCAAAGTGGACATTGTCGCCATC R: AGCTTCCCATTCTCAGCCTTGACT | 124 bp | 64.4 °C |
CD34 molecule (CD34) | F: ACCAGAGCTACTCCCGAAAG R: TAAGGGTCTTCGCCCAGC | 139 bp | 59 °C |
Integrin β-1 (CD29) | F: TAAGAGTGCCGTGACAACCG R: TTCAGAACCTGCCCATAGCG | 154 bp | 60 °C |
CD73 enzyme (CD73) | F: ATTCGAGCAAGTGCGTCAAC R: TCGTAACCCAAGGCGTTCAT | 193 bp | 59.5 °C |
Thy-1 Antigen (CD90) | F: GCTAACAGTCTTGCAGGTGG R: AGAAGTTGGTTCGAGAGCGG | 212 bp | 59.5 °C |
Tyrosine-protein kinase Kit (CD117) | F: GGACCGAAGGAGGCACTTAC R: AACGGAACATCTCTGCTCGG | 206 bp | 60 °C |
ALCAM (CD166) | F: TGGTCACAGAGGACAACGT R: CCACGTGATGTTGCCATCTG | 167 bp | 59.5 °C |
Endoglin (CD105) | F: AGTTCTCCCGAAGCCTGGTC R: GTGCGAGTGGATGTACCAGAG | 104 bp | 61 °C |
Major histocompatibility complex I (MHC I) | F: TGGAGAGGAGCAGAGCTACAC R: CTGTCACTGCCTGCAGCCT | 225 bp | 61 °C |
SLA-DRA1 (MHC II) | F: TCTACACCTGCCAAGTG R: CCACCATGCCCTTTCTG | 178 bp | 55 °C |
Transcription factor Oct-4 (Oct4) | F: GTTCAGCCAAACGACCATCTG R: TCTCTGCCTTGCATATCTCCTG | 140 bp | 59.8 °C |
Transcription factor Nanog (Nanog) | F: AACTTCACCAATGCCTGAG R: CTGATCTTCTGCTTCTTGACTG | 234 bp | 56 °C |
Osteocalcin (BGLAP) | F: TCAACCCCGACTGCGACG R: TTGGAGCAGCTGGGATGATGG | 204 bp | 62.4 °C |
Osteopontin (OPN) | F: TTGCTAAAGCCTGACCCATCT R: CGTCGTCCACATCGTCTGT | 145 bp | 59.4 °C |
Leptin | F: AGCCTTTCGACCATCAAGCA R: CAACTTGTGTTGCGTGGGAG | 100 bp | 59.9 °C |
Adiponectin (ADIPQ) | F: TATGATGTCACCACTGGCAAATT R: TAGAGGAGCACAGAGCCAGAG | 185 bp | 59 °C |
Collagen type 2 alpha 1 (COL2A1) | F: ATCGAGATCGCCACCTACAG R: CAGGCTGGTTTCTCGGATCT | 102 bp | 59 °C |
Aggrecan (ACAN) | F: CAGGAGAAACAGGGCCTACA R: GCTCCAACTTAGGGTCCAAGA | 193 bp | 59 °C |
Sample Number | Breed | Gender | Age | Collection Method |
---|---|---|---|---|
A | German Shepherd | M | 7 years | Bladder catheterization |
B | Pitbull terrier | F | 2 years | Cystocentesis |
C | Labrador retriever | M | 1 year | Bladder catheterization |
D | Labrador retriever | M | 5 years | Spontaneous micturition |
E | Border Collie | F | 2 years | Cystocentesis |
F | Belgian Shepherd Malinois | M | 6 months | Spontaneous micturition |
G | Labrador retriever | F | 1 year | Cystocentesis |
H | Labrador retriever | F | 1 year | Bladder catheterization |
I | Mixed Breed | F | 4 years | Spontaneous micturition |
Sample Number | Breed | Gender | Age | IRIS Staging | Collection Method | Notes |
---|---|---|---|---|---|---|
1 | Mixed breed | M | 5 years and 7 months | Stage 1 | Cystocentesis | |
2 | English bulldog | FS | 1 year and 2 months | Stage 3 | Cystocentesis | |
3 | German hound | MN | 7 years and 7 months | Stage 3 | Cystocentesis | |
4 | Mixed breed | M | 15 years | Stage 2 | Cystocentesis | Suspected HC |
5 | Mixed breed | FS | 8 years and 9 months | Stage 3 | Cystocentesis | |
6 | Nova scotia duck tolling retriever | F | 1 year and 8 months | Stage 1 | Cystocentesis | |
7 | Epagenul Breton | FS | 8 years | Stage 1 | Cystocentesis | Microhematuria; amyloidosis; leishmaniosis |
8 | Mixed breed | FS | 15 years and 8 months | Stage 1 | Cystocentesis | HC Dead |
9 | Dachshund | M | 9 years | Stage 1 | Cystocentesis | Crystalluria |
10 | Mixed breed | FS | 10 years and 4 months | Stage 1 | Cystocentesis | Diabetes |
11 | Dogue de Bordeaux | FS | 9 years and 8 months | Stage 1 | Cystocentesis | UTI |
Healthy Dogs | Sick Dogs | ||||
---|---|---|---|---|---|
N° Samples | Collection Method | N° Cells | N° Samples | Collection Method | N° Cells |
3 | Spontaneous micturition | 57,000 ± 8300 | - | - | - |
3 | Bladder catheterization | 33,000 ± 2500 | - | - | - |
3 | Cystocentesis | 93,000 ± 11,327 | 11 | Cystocentesis | 122,500 ± 10,584 |
Method of Collection | N° Cells at P1 | N° Cells at P2 |
---|---|---|
Spontaneous micturition | 10,000 ± 840 | No cells |
Bladder catheterization | 10,000 ± 1023 | No cells |
Cystocentesis | 250,000 ± 12,538 | 300,000 ± 17,024 |
Density Cells/cm2 | Total Cells | CFU | 1 CFU Each | CFU | 1 CFU Each |
---|---|---|---|---|---|
Healthy Dogs | Sick Dogs | ||||
100 cells/cm2 | 950 | 20 ± 1.76 a | 47.5 | 22 ± 1.9 a | 43.18 |
250 cells/cm2 | 2375 | 30 ± 2.54 b | 79.16 | 35 ± 2.84 b | 67.86 |
500 cells/cm2 | 4750 | 60 ± 3.18 c | 79.16 | 57 ± 2.31 c | 83.33 |
1000 cells/cm2 | 9500 | 82 ± 5.82 d | 115.85 | 79 ± 3.73 d | 120.25 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lange-Consiglio, A.; Tagliasacchi, F.; Cremonesi, F.; Gusmara, C.; Pollera, C.; Scarpa, P.; Gaspari, G.; Riccaboni, P. Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD). Animals 2025, 15, 242. https://doi.org/10.3390/ani15020242
Lange-Consiglio A, Tagliasacchi F, Cremonesi F, Gusmara C, Pollera C, Scarpa P, Gaspari G, Riccaboni P. Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD). Animals. 2025; 15(2):242. https://doi.org/10.3390/ani15020242
Chicago/Turabian StyleLange-Consiglio, Anna, Filippo Tagliasacchi, Fausto Cremonesi, Claudia Gusmara, Claudia Pollera, Paola Scarpa, Giulia Gaspari, and Pietro Riccaboni. 2025. "Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD)" Animals 15, no. 2: 242. https://doi.org/10.3390/ani15020242
APA StyleLange-Consiglio, A., Tagliasacchi, F., Cremonesi, F., Gusmara, C., Pollera, C., Scarpa, P., Gaspari, G., & Riccaboni, P. (2025). Characterization of Urine-Derived Stromal/Stem Cells from Healthy Dogs and Dogs Affected by Chronic Kidney Disease (CKD). Animals, 15(2), 242. https://doi.org/10.3390/ani15020242