Porcine Bile Acids Improve Antioxidant Status and Immune Function by Increasing Hungatella Abundance with Different Protein Level Diets in Late-Laying Hens
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Sample Collection
2.3. Determination of the Organ Index
2.4. Serum Biochemical Parameters
2.5. Antioxidant Enzyme Activity Assay
2.6. Total Community DNA Extraction
2.7. 16S rRNA Gene Amplicon Sequencing
2.8. Gene Expression by Real-Time PCR
2.9. Statistical Analyses
3. Results
3.1. Organ Index
3.2. Serum Inflammatory Cytokines and Ileal-Immunity-Related Gene mRNA Expression
3.3. Antioxidant Status
3.4. Serum Intestinal Permeability Biomarkers and Ileal-Barrier-Related Gene mRNA Expression
3.5. Cecal Microbiota
3.6. Correlations Between Cecal Microbiota and Serum Indicators
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Reham, A.E.; Hamada, A.; Sara, K.; Shaimaa, S. Supplementation of a low-protein diet with tryptophan, threonine, and valine and its impact on growth performance, blood biochemical constituents, immune parameters, and carcass traits in broiler chickens. Vet. World 2020, 13, 1234–1244. [Google Scholar]
- Zhou, J.-M.; Qiu, K.; Wang, J.; Zhang, H.-J.; Qi, G.-H.; Wu, S.-G. Effect of dietary serine supplementation on performance, egg quality, serum indices, and ileal mucosal immunity in laying hens fed a low crude protein diet. Poult. Sci. 2021, 100, 101465. [Google Scholar] [CrossRef] [PubMed]
- Heo, Y.-J.; Park, J.; Kim, Y.-B.; Kwon, B.-Y.; Kim, D.-H.; Song, J.-Y.; Lee, K.-W. Effects of dietary protein levels on performance, nitrogen excretion, and odor emission of growing pullets and laying hens. Poult. Sci. 2023, 102, 102798. [Google Scholar] [CrossRef] [PubMed]
- Poprac, P.; Jomova, K.; Simunkova, M.; Kollar, V.; Rhodes, C.J.; Valko, M. Targeting free radicals in oxidative stress-related human diseases. Trends Pharmacol. Sci. 2017, 38, 592–607. [Google Scholar] [CrossRef]
- Li, J.; Zhou, D.; Li, H.; Luo, Q.; Wang, X.; Qin, J.; Xu, Y.; Lu, Q.; Tian, X. Effect of purple corn extract on performance, antioxidant activity, egg quality, egg amino acid, and fatty acid profiles of laying hen. Front. Vet. Sci. 2022, 9, 1083842. [Google Scholar] [CrossRef] [PubMed]
- Zorov, D.B.; Juhaszova, M.; Sollott, S.J. Mitochondrial reactive oxygen species (ROS) and ROS-induced ROS release. Physiol. Rev. 2014, 94, 909–950. [Google Scholar] [CrossRef]
- Wahlström, A.; Sayin, S.I.; Marschall, H.-U.; Bäckhed, F. Intestinal crosstalk between bile acids and microbiota and its impact on host metabolism. Cell Metab. 2016, 24, 41–50. [Google Scholar] [CrossRef]
- Lefebvre, P.; Cariou, B.; Lien, F.; Kuipers, F.; Staels, B. Role of bile acids and bile acid receptors in metabolic regulation. Physiol. Rev. 2009, 89, 147–191. [Google Scholar] [CrossRef]
- Lucas, L.N.; Barrett, K.; Kerby, R.L.; Zhang, Q.; Cattaneo, L.E.; Stevenson, D.; Rey, F.E.; Amador-Noguez, D. Dominant bacterial phyla from the human gut show widespread ability to transform and conjugate bile acids. mSystems 2021, 6, e0080521. [Google Scholar] [CrossRef]
- Zhu, F.; Zheng, S.; Zhao, M.; Shi, F.; Zheng, L.; Wang, H. The regulatory role of bile acid microbiota in the progression of liver cirrhosis. Front. Pharmacol. 2023, 14, 1214685. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Zhang, Y.; Yang, J.; Xu, H.; Ye, R.; Wu, J.; Cao, M.; Zhao, C.; Yang, B.; Liu, C.; et al. Effect of bile acids supplementation in fatty liver hemorrhagic syndrome, production performance, physiological and quality characteristics of laying hen eggs. Animals 2024, 14, 1910. [Google Scholar] [CrossRef] [PubMed]
- Li, Z.; Yuan, H.; Chu, H.; Yang, L. The crosstalk between gut microbiota and bile acids promotes the development of non-alcoholic fatty liver disease. Microorganisms 2023, 11, 2059. [Google Scholar] [CrossRef] [PubMed]
- Hang, S.; Paik, D.; Yao, L.; Kim, E.; Trinath, J.; Lu, J.; Ha, S.; Nelson, B.N.; Kelly, S.P.; Wu, L.; et al. Bile acid metabolites control T(H)17 and T(reg) cell differentiation. Nature 2019, 576, 143–148. [Google Scholar] [CrossRef] [PubMed]
- Campbell, C.; McKenney, P.T.; Konstantinovsky, D.; Isaeva, O.I.; Schizas, M.; Verter, J.; Mai, C.; Jin, W.B.; Guo, C.J.; Violante, S.; et al. Bacterial metabolism of bile acids promotes generation of peripheral regulatory T cells. Nature 2020, 581, 475–479. [Google Scholar] [CrossRef]
- Grüner, N.; Mattner, J. Bile acids and microbiota: Multifaceted and versatile regulators of the liver–gut axis. Int. J. Mol. Sci. 2021, 22, 1397. [Google Scholar] [CrossRef] [PubMed]
- Martínez-Moya, P.; Romero-Calvo, I.; Requena, P.; Hernández-Chirlaque, C.; Aranda, C.J.; González, R.; Zarzuelo, A.; Suárez, M.D.; Martínez-Augustin, O.; Marín, J.J.G.; et al. Dose-dependent antiinflammatory effect of ursodeoxycholic acid in experimental colitis. Int. Immunopharmacol. 2013, 15, 372–380. [Google Scholar] [CrossRef]
- Sannasiddappa, T.H.; Lund, P.A.; Clarke, S.R. In vitro antibacterial activity of unconjugated and conjugated bile salts on staphylococcus aureus. Front. Microbiol. 2017, 8, 1581. [Google Scholar] [CrossRef]
- Wu, H.; Liu, G.; He, Y.; Da, J.; Xie, B. Obeticholic acid protects against diabetic cardiomyopathy by activation of FXR/Nrf2 signaling in db/db mice. Eur. J. Pharmacol. 2019, 858, 172393. [Google Scholar] [CrossRef]
- Liu, Y.; Azad, M.A.K.; Kong, X.; Zhu, Q.; Yu, Z. Dietary bile acids supplementation modulates immune response, antioxidant capacity, glucose, and lipid metabolism in normal and intrauterine growth retardation piglets. Front. Nutr. 2022, 9, 991812. [Google Scholar] [CrossRef]
- Yin, C.; Xia, B.; Tang, S.; Cao, A.; Liu, L.; Zhong, R.; Chen, L.; Zhang, H. The effect of exogenous bile acids on antioxidant status and gut microbiota in heat-stressed broiler chickens. Front. Nutr. 2021, 8, 747136. [Google Scholar] [CrossRef] [PubMed]
- John, C.; Werner, P.; Worthmann, A.; Wegner, K.; Tödter, K.; Scheja, L.; Rohn, S.; Heeren, J.; Fischer, M. A liquid chromatography-tandem mass spectrometry-based method for the simultaneous determination of hydroxy sterols and bile acids. J. Chromatogr. A 2014, 1371, 184–195. [Google Scholar] [CrossRef]
- Yang, B.; Huang, S.; Li, S.; Feng, Z.; Zhao, G.; Ma, Q. Safety Evaluation of Porcine Bile Acids in Laying Hens: Effects on laying performance, egg quality, blood parameters, organ indexes, and intestinal development. Front. Vet. Sci. 2022, 9, 895831. [Google Scholar] [CrossRef] [PubMed]
- Yang, B.; Huang, S.; Zhao, G.; Ma, Q. Dietary supplementation of porcine bile acids improves laying performance, serum lipid metabolism and cecal microbiota in late-phase laying hens. Anim. Nutr. 2022, 11, 283–292. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.; Xin, Q.; Jiao, H.; Wang, X.; Zhao, J.; Li, H.; Zhou, Y.; Cao, A.; Wang, J.; Lin, H. Effect of exogenous bile salts supplementation on the performance and hepatic lipid metabolism of aged laying hens. J. Anim. Sci. 2023, 101, skad334. [Google Scholar] [CrossRef] [PubMed]
- Hy-Line International. Hy-Line Brown Management Guide; Hy-Line International: Dallas, TX, USA, 2018. [Google Scholar]
- AOAC. Official Methods of Analysis of AOAC International, 18th ed.; AOAC International: Gaithersburgg, MD, USA, 2005; Available online: https://www.aoac.org/ (accessed on 20 August 2024).
- Poosuwan, K.; Bunchasak, C.; Kaewtapee, C. Long-term feeding effects of dietary protein levels on egg production, immunocompetence and plasma amino acids of laying hens in subtropical condition. J. Anim. Physiol. Anim. Nutr. 2010, 94, 186–195. [Google Scholar] [CrossRef] [PubMed]
- Kim, D.H.; Lee, Y.K.; Lee, S.D.; Lee, K.W. Impact of relative humidity on the laying performance, egg quality, and physiological stress responses of laying hens exposed to high ambient temperature. J. Therm. Biol. 2022, 103, 103167. [Google Scholar] [CrossRef]
- Liu, C.; Chu, D.; Kalantar-Zadeh, K.; George, J.; Young, H.A.; Liu, G. Cytokines: From clinical significance to quantification. Adv. Sci. 2021, 8, e2004433. [Google Scholar] [CrossRef] [PubMed]
- Biagioli, M.; Carino, A.; Cipriani, S.; Francisci, D.; Marchianò, S.; Scarpelli, P.; Sorcini, D.; Zampella, A.; Fiorucci, S. The bile acid receptor GPBAR1 regulates the M1/M2 phenotype of intestinal macrophages and activation of GPBAR1 rescues mice from murine colitis. J. Immunol. 2017, 199, 718–733. [Google Scholar] [CrossRef] [PubMed]
- Chen, M.L.; Takeda, K.; Sundrud, M.S. Emerging roles of bile acids in mucosal immunity and inflammation. Mucosal Immunol. 2019, 12, 851–861. [Google Scholar] [CrossRef]
- Schwarz, A.; Kinscherf, R.; Bonaterra, G.A. Role of the stress- and inflammation-induced cytokine GDF-15 in cardiovascular diseases: From basic research to clinical relevance. Rev. Cardiovasc. Med. 2023, 24, 81. [Google Scholar] [CrossRef] [PubMed]
- Pirinccioglu, A.G.; Gökalp, D.; Pirinccioglu, M.; Kizil, G.; Kizil, M. Malondialdehyde (MDA) and protein carbonyl (PCO) levels as biomarkers of oxidative stress in subjects with familial hypercholesterolemia. Clin. Biochem. 2010, 43, 1220–1224. [Google Scholar] [CrossRef]
- Attia, Y.A.; Al-Harthi, M.A.; Abo El-Maaty, H.M. The effects of different Oil sources on performance, digestive enzymes, carcass traits, biochemical, immunological, antioxidant, and morphometric responses of broiler chicks. Front. Vet. Sci. 2020, 7, 181. [Google Scholar] [CrossRef] [PubMed]
- Schenk, M.; Mueller, C. The mucosal immune system at the gastrointestinal barrier. Best Pract. Res. Clin. Gastroenterol. 2008, 22, 391–409. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Liu, G.; Chen, Z.; Zheng, A.; Cai, H.; Chang, W.; Li, C.; Chen, J.; Wu, Z. Effects of glucose oxidase on growth performance, immune function and intestinal barrier of ducks infected with Escherichia coli O88. Poult. Sci. 2020, 99, 6549–6558. [Google Scholar] [CrossRef] [PubMed]
- Wang, W.; Zhao, J.; Gui, W.; Sun, D.; Dai, H.; Xiao, L.; Chu, H.; Du, F.; Zhu, Q.; Schnabl, B.; et al. Tauroursodeoxycholic acid inhibits intestinal inflammation and barrier disruption in mice with non-alcoholic fatty liver disease. Br. J. Pharmacol. 2018, 175, 469–484. [Google Scholar] [CrossRef] [PubMed]
- Ma, Y.; Shan, K.; Huang, Z.; Zhao, D.; Zhang, M.; Ke, W.; Li, C. Bile acid derivatives effectively prevented high-fat diet-induced colonic barrier dysfunction. Mol. Nutr. Food Res. 2023, 67, e2200649. [Google Scholar] [CrossRef]
- Kim, C.H.; Park, J.; Kim, M. Gut microbiota-derived short-chain fatty acids, T cells, and inflammation. Immune Netw. 2014, 14, 277–288. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; Wang, W.; Zhou, R.; Ng, S.C.; Li, J.; Huang, M.; Zhou, F.; Wang, X.; Shen, B.; Kamm, M.A.; et al. Characteristics of fecal and mucosa-associated microbiota in Chinese patients with inflammatory bowel disease. Medicine 2014, 93, e51. [Google Scholar] [CrossRef] [PubMed]
- Rawat, P.S.; Li, Y.; Zhang, W.; Meng, X.; Liu, W. Hungatella hathewayi, an efficient glycosaminoglycan-degrading firmicutes from human gut and its chondroitin ABC exolyase with high activity and broad substrate specificity. Appl. Environ. Microbiol. 2022, 88, e0154622. [Google Scholar] [CrossRef]
- Rawat, P.S.; Seyed Hameed, A.S.; Meng, X.; Liu, W. Utilization of glycosaminoglycans by the human gut microbiota: Participating bacteria and their enzymatic machineries. Gut Microbes. 2022, 14, 2068367. [Google Scholar] [CrossRef]
- Costa, L.M.; Mendes, M.M.; Oliveira, A.C.; Magalhães, K.G.; Shivappa, N.; Hebert, J.R.; da Costa, T.H.M.; Botelho, P.B. Dietary inflammatory index and its relationship with gut microbiota in individuals with intestinal constipation: A cross-sectional study. Eur. J. Nutr. 2022, 61, 341–355. [Google Scholar] [CrossRef] [PubMed]
- Cani, P.D.; de Vos, W.M. Next-generation beneficial microbes: The case of akkermansia muciniphila. Front. Microbiol. 2017, 8, 1765. [Google Scholar] [CrossRef] [PubMed]
- Seregin, S.S.; Golovchenko, N.; Schaf, B.; Chen, J.; Pudlo, N.A.; Mitchell, J.; Baxter, N.T.; Zhao, L.; Schloss, P.D.; Martens, E.C.; et al. NLRP6 Protects Il10(-/-) mice from colitis by limiting colonization of akkermansia muciniphila. Cell Rep. 2017, 19, 733–745. [Google Scholar] [CrossRef] [PubMed]
- Larsen, J.M. The immune response to prevotella bacteria in chronic inflammatory disease. Immunology 2017, 151, 363–374. [Google Scholar] [CrossRef] [PubMed]
- Eom, J.A.; Jeong, J.J.; Han, S.H.; Kwon, G.H.; Lee, K.J.; Gupta, H.; Sharma, S.P.; Won, S.M.; Oh, K.K.; Yoon, S.J.; et al. Gut-microbiota prompt activation of natural killer cell on alcoholic liver disease. Gut Microbes. 2023, 15, 2281014. [Google Scholar] [CrossRef]







| Item | Normal Protein | Low Protein |
|---|---|---|
| ingredients | ||
| Corn | 65.75 | 67.30 |
| Soybean meal | 22.00 | 18.37 |
| Bran | - | 1.90 |
| Liquid methionine | 0.16 | 0.16 |
| Stone powder | 9.60 | 9.60 |
| CaHPO4 | 0.80 | 0.80 |
| Choline | 0.14 | 0.14 |
| Premix 1 | 1.50 | 1.50 |
| L-lysine·HCl, 78.6% | - | 0.10 |
| DL-methionine, 99% | 0.05 | 0.08 |
| L-threonine, 99% | - | 0.05 |
| Total | 100 | 100 |
| Calculated nutrient content | ||
| ME, KJ/kg | 2650 | 2650 |
| Lys | 0.77 | 0.74 |
| Met | 0.36 | 0.36 |
| Thr | 0.57 | 0.55 |
| Assayed nutrient content | ||
| Crude protein | 16.42 | 15.35 |
| Calcium | 3.59 | 4.01 |
| Total phosphorus | 0.44 | 0.40 |
| Crude ash | 14.00 | 15.08 |
| Gene ID # | Gene | Primer Sequences (5′→3′) | Product Length, bp |
|---|---|---|---|
| XM_046925214.1 | ZO-1 | F: GAAGAGAGCACAGAACGCAG | 123 |
| R: CACTTGTGGCAAGCTGAAGT | |||
| NM_001013611.2 | Claudin-1 | F: TCTGGTGTTAACGGGTGTGA | 117 |
| R: GTCTTTGGTGGCGTGATCTT | |||
| NM_205128.1 | Occludin | F: CGTTCTTCACCCACTCCTCC | 107 |
| R: CCAGAAGACGCGCAGTAAGA | |||
| NM_001039258.3 | CDH1 | F: AGCCAAGGGCCTGGATTATG | 157 |
| R: GATAGGGGGCACGAAGACAG | |||
| NM-001318434.1 | Mucin-2 | F: AGTGGCCATGGTTTCTTGTC | 80 |
| R: TGCCAGCCTTTTTATGCTCT | |||
| NM_204628.1 | IL-6 | F: CCCTCACGGTCTTCTCCATA | 100 |
| R: CTCCTCGCCAATCTGAAGTC | |||
| NM_204267.1 | TNFα | F: ACTGGGCGGTCATAGAACAG | 120 |
| R: AGATGGGAAGGGAATGAACC | |||
| NM_001318456.1 | TGFβ | F:GCTCTTTGGCCCAATACTCA | 88 |
| R:CTGTACAACAGCACCCAGGA | |||
| NM_001004414.4 | IL-10 | F: GCTCTGAGCACAGTCGTTTG | 154 |
| R: CAGATGGGGACGTGGTTACG | |||
| NM_204524.2 | IL-1β | F: CTGCCTGCAGAAGAAGCCT | 135 |
| R: CGCAGCAGTTTGGTCATGG | |||
| NM_205518.1 | β-actin | F: GTCCACCGCAAATGCTTCTAA | 78 |
| R: TGCGCATTTATGGGTTTTGTT |
| Item | Heart % | Liver % | Spleen % | Pancreas % | ||
|---|---|---|---|---|---|---|
| BA | LP | |||||
| CON | − | − | 0.40 | 1.71 | 0.11 | 0.17 |
| CON + BA | + | − | 0.39 | 1.76 | 0.12 | 0.16 |
| LP | − | + | 0.39 | 1.69 | 0.10 | 0.16 |
| LP + BA | + | + | 0.35 | 1.61 | 0.11 | 0.16 |
| SEM | 0.008 | 0.025 | 0.003 | 0.003 | ||
| BA factor | ||||||
| −BA | 0.39 | 1.70 | 0.10 | 0.17 | ||
| +BA | 0.37 | 1.68 | 0.11 | 0.16 | ||
| LP factor | ||||||
| CON | 0.39 | 1.73 | 0.11 | 0.16 | ||
| LP | 0.37 | 1.65 | 0.10 | 0.16 | ||
| p-value | ||||||
| BA | 0.104 | 0.670 | 0.201 | 0.252 | ||
| LP | 0.122 | 0.101 | 0.053 | 0.564 | ||
| Interaction | 0.420 | 0.190 | 0.412 | 0.184 | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2025 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xing, R.; Du, P.; Wang, Z.; Fan, Z.; Wang, L.; Huang, Y.; Chen, W.; Si, X. Porcine Bile Acids Improve Antioxidant Status and Immune Function by Increasing Hungatella Abundance with Different Protein Level Diets in Late-Laying Hens. Animals 2025, 15, 500. https://doi.org/10.3390/ani15040500
Xing R, Du P, Wang Z, Fan Z, Wang L, Huang Y, Chen W, Si X. Porcine Bile Acids Improve Antioxidant Status and Immune Function by Increasing Hungatella Abundance with Different Protein Level Diets in Late-Laying Hens. Animals. 2025; 15(4):500. https://doi.org/10.3390/ani15040500
Chicago/Turabian StyleXing, Ronghui, Pengfei Du, Ziyang Wang, Zongze Fan, Longfei Wang, Yanqun Huang, Wen Chen, and Xuemeng Si. 2025. "Porcine Bile Acids Improve Antioxidant Status and Immune Function by Increasing Hungatella Abundance with Different Protein Level Diets in Late-Laying Hens" Animals 15, no. 4: 500. https://doi.org/10.3390/ani15040500
APA StyleXing, R., Du, P., Wang, Z., Fan, Z., Wang, L., Huang, Y., Chen, W., & Si, X. (2025). Porcine Bile Acids Improve Antioxidant Status and Immune Function by Increasing Hungatella Abundance with Different Protein Level Diets in Late-Laying Hens. Animals, 15(4), 500. https://doi.org/10.3390/ani15040500
