Expression Analysis of IZUMO1 Gene during Testicular Development of Datong Yak (Bos Grunniens)
Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Purification of Total RNA
2.2. Primer Designing and PCR Amplification
2.3. Cloning
2.4. Quantitative Real-Time PCR
2.5. Semi Quantitative PCR
2.6. Bioinformatics Analysis
2.7. Western Blot of IZUMO1
2.8. Immuno-Staining of Testis
2.9. Data Analyses
3. Results
3.1. The Expression Profile of IZUMO1 Gene by Semi-Quantitative PCR
3.2. The Expression Level of IZUMO1 mRNA by Quantitative Real Time PCR
3.3. Characterization of IZUMO1 Gene
3.4. Western Blotting
3.5. Immunostaining Analysis
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Hu, J.; Moore, D.J.; Burns, S.P.; Monson, R.K. Longer growing seasons lead to less carbon sequestration by a subalpine forest. Glob. Chang. Biol. 2010, 16, 771–783. [Google Scholar] [CrossRef]
- Yan, P.; Xiang, L.; Guo, X.; Bao, P.J.; Jin, S.; Wu, X.-Y. The low expression of Dmrt7 is associated with spermatogenic arrest in cattle-yak. Mol. Biol. Rep. 2014, 41, 7255–7263. [Google Scholar] [CrossRef] [PubMed]
- Cai, X.; Yu, S.; Mipam, T.; Yang, F.; Zhao, W.; Liu, W.; Cao, S.; Shen, L.; Zhao, F.; Sun, L. Comparative analysis of testis transcriptomes associated with male infertility in cattleyak. Theriogenology 2017, 88, 28–42. [Google Scholar] [CrossRef] [PubMed]
- Wang, K.; Hu, Q.; Ma, H.; Wang, L.; Yang, Y.; Luo, W.; Qiu, Q. Genome-wide variation within and between wild and domestic yak. Mol. Ecol. Resour. 2014, 14, 794–801. [Google Scholar] [CrossRef] [PubMed]
- Wiener, G.; Jianlin, H.; Ruijun, L. The Yak 2nd edn FAO Regional Office for Asia and the Pacific Food and Agriculture Organization of the United Nations; The Regional Office for Asia and the Pacific Food and Agriculture Organization of the United Nations: Bangkok, Thailand, 2003. [Google Scholar]
- Inoue, N.; Hagihara, Y.; Wright, D.; Suzuki, T.; Wada, I. Oocyte-triggered dimerization of sperm IZUMO1 promotes sperm–egg fusion in mice. Nat. Commun. 2015, 6, 8858. [Google Scholar] [CrossRef] [PubMed]
- Kim, E. Molecular cloning and characterization of Izumo1 gene from bovine testis. J. Anim. Sci. Technol. 2015, 57, 16. [Google Scholar] [CrossRef]
- Grayson, P.; Civetta, A. Positive selection and the evolution of izumo genes in mammals. Int. J. Evol. Biol. 2012, 2012, 958164. [Google Scholar] [CrossRef] [PubMed]
- Young, S.A.; Aitken, J.; Baker, M.A. Phosphorylation of Izumo1 and its role in male infertility. Asian J. Androl. 2015, 17, 708. [Google Scholar] [PubMed]
- Inoue, N.; Ikawa, M.; Isotani, A.; Okabe, M. The immunoglobulin superfamily protein Izumo is required for sperm to fuse with eggs. Nature 2005, 434, 234. [Google Scholar] [CrossRef]
- Satouh, Y.; Inoue, N.; Ikawa, M.; Okabe, M. Visualization of the Moment of Mouse Sperm–Egg Fusion and dynamic Localization of IZUMO1; Oxford University Press for The Company of Biologists Limited: Cambridge, UK, 2013. [Google Scholar]
- Gerhardt, K. IZUMO1–JUNO Union Promotes Fertilization. Biol. Reprod. 2016, 95. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, K.; Wang, L.; Yang, Y.; Ni, Z.; Xie, X.; Shao, X.; Han, J.; Wan, D.; Qiu, Q. Genome-wide patterns of copy number variation in the Chinese yak genome. BMC Genom. 2016, 17, 379. [Google Scholar] [CrossRef] [PubMed]
- Goshu, H.; Wu, X.; Chu, M.; Bao, P.; Ding, X.; Yan, P. Copy Number Variations of KLF6 Modulate Gene Transcription and Growth Traits in Chinese Datong Yak (Bos Grunniens). Animals 2018, 8, 145. [Google Scholar] [CrossRef] [PubMed]
- Hou, Y.; Zhou, X.; Liu, J.; Yuan, J.; Cheng, H.; Zhou, R. Nuclear factor-Y (NF-Y) regulates transcription of mouse Dmrt7 gene by binding to tandem CCAAT boxes in its proximal promoter. Int. J. Biol. Sci. 2010, 6, 655. [Google Scholar] [CrossRef] [PubMed]
- Rubinstein, E.; Ziyyat, A.; Wolf, J.-P.; Le Naour, F.; Boucheix, C. The molecular players of sperm–egg fusion in mammals. In Seminars in Cell & Developmental Biology; Academic Press: New York, NY, USA, 2006; pp. 254–263. [Google Scholar]
- Fukuda, M.; Sakase, M.; Fukushima, M.; Harayama, H. Changes of IZUMO1 in bull spermatozoa during the maturation, acrosome reaction, and cryopreservation. Theriogenology 2016, 86, 2179–2188. [Google Scholar] [CrossRef] [PubMed]
- Kim, E.; Kim, J.S.; Lee, Y.; Song, B.S.; Sim, B.W.; Kim, S.U.; Saitoh, T.; Yazawa, H.; Nunoya, T.; Chang, K.T. Molecular cloning, characterization of porcine IZUMO1, an IgSF family member. Reprod. Domest. Anim. 2013, 48, 90–97. [Google Scholar] [CrossRef] [PubMed]
- Ellerman, D.A.; Pei, J.; Gupta, S.; Snell, W.J.; Myles, D.; Primakoff, P. Izumo is part of a multiprotein family whose members form large complexes on mammalian sperm. Mol. Reprod. Dev. 2009, 76, 1188–1199. [Google Scholar] [CrossRef]
- Xing, W.-J.; Han, B.-D.; Wu, Q.; Zhao, L.; Bao, X.-H.; Bou, S. Molecular cloning and characterization of Izumo1 gene from sheep and cashmere goat reveal alternative splicing. Mol. Biol. Rep. 2011, 38, 1995–2006. [Google Scholar] [CrossRef]
- Schultz, R.; Williams, C. Developmental biology: Sperm–egg fusion unscrambled. Nature 2005, 434, 152. [Google Scholar] [CrossRef] [PubMed]
- Inoue, N.; Hamada, D.; Kamikubo, H.; Hirata, K.; Kataoka, M.; Yamamoto, M.; Ikawa, M.; Okabe, M.; Hagihara, Y. Molecular dissection of IZUMO1, a sperm protein essential for sperm-egg fusion. Development 2013, 140, 3221–3229. [Google Scholar] [CrossRef]
- Bianchi, E.; Doe, B.; Goulding, D.; Wright, G.J. Juno is the egg Izumo receptor and is essential for mammalian fertilization. Nature 2014, 508, 483. [Google Scholar] [CrossRef]
- Sebkova, N.; Ded, L.; Vesela, K.; Dvorakova-Hortova, K. Progress of sperm IZUMO1 relocation during spontaneous acrosome reaction. Reproduction 2014, 147, 231–240. [Google Scholar] [CrossRef] [PubMed]
- Inoue, N.; Ikawa, M.; Okabe, M. The mechanism of sperm–egg interaction and the involvement of IZUMO1 in fusion. Asian J. Androl. 2011, 13, 81. [Google Scholar] [CrossRef] [PubMed]
- Aydin, H.; Sultana, A.; Li, S.; Thavalingam, A.; Lee, J.E. Molecular architecture of the human sperm IZUMO1 and egg JUNO fertilization complex. Nature 2016, 534, 562. [Google Scholar] [CrossRef] [PubMed]
- Ohto, U.; Ishida, H.; Krayukhina, E.; Uchiyama, S.; Inoue, N.; Shimizu, T. Structure of IZUMO1–JUNO reveals sperm–oocyte recognition during mammalian fertilization. Nature 2016, 534, 566. [Google Scholar] [CrossRef]









| Accession No | Gene | Primers Sequence (5′->3′) | Product Length (bp) | Annealing Temperature (°C) |
|---|---|---|---|---|
| XM_024979243.1 | IZUMO1 (For cloning) | F: TTCGAGTTGGAAGGACGTGG R: TTCCTTTGAAACCCCCGAGT | 1320 | 59.97 59.15 |
| XM_024979242.1 | IZUMO1 (For gene expression) | F: GCGTTCTAACCGCGATCCTT R: CTCGACTGCCAGAGCTGAAC | 81 | 60.80 60.74 |
| NM_001034034.2 F: AATGAAAGGGCCATCACCATC | GAPDH | F: AATGAAAGGGCCATCACCAT R: CACCACCCTGTTGCTGTAGCCA | 204 | 55.85 60.00 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kalwar, Q.; Ding, X.; Ahmad, A.A.; Chu, M.; Wu, X.; Bao, P.; Yan, P. Expression Analysis of IZUMO1 Gene during Testicular Development of Datong Yak (Bos Grunniens). Animals 2019, 9, 292. https://doi.org/10.3390/ani9060292
Kalwar Q, Ding X, Ahmad AA, Chu M, Wu X, Bao P, Yan P. Expression Analysis of IZUMO1 Gene during Testicular Development of Datong Yak (Bos Grunniens). Animals. 2019; 9(6):292. https://doi.org/10.3390/ani9060292
Chicago/Turabian StyleKalwar, Qudratullah, Xuezhi Ding, Anum Ali Ahmad, Min Chu, Xiaoyun Wu, Pengjia Bao, and Ping Yan. 2019. "Expression Analysis of IZUMO1 Gene during Testicular Development of Datong Yak (Bos Grunniens)" Animals 9, no. 6: 292. https://doi.org/10.3390/ani9060292
APA StyleKalwar, Q., Ding, X., Ahmad, A. A., Chu, M., Wu, X., Bao, P., & Yan, P. (2019). Expression Analysis of IZUMO1 Gene during Testicular Development of Datong Yak (Bos Grunniens). Animals, 9(6), 292. https://doi.org/10.3390/ani9060292
