Two Insertion/Deletion Variants within SPAG17 Gene Are Associated with Goat Body Measurement Traits
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Sample Preparation and Data Collection
2.3. Primers Designing and Genotyping
2.4. Statistical Analysis of Results
2.5. The Linkage Disequilibrium and Combined Genotypes Analysis
3. Results
3.1. Identification of Indel Variations and Genotyping
3.2. Genetic Parameters Analysis
3.3. Association Analysis of Genotypes and Body Measurement Traits
3.4. The Linkage Disequilibrium and Combined Genotypes Analysis
4. Discussion
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Lee, L. Mechanisms of mammalian ciliary motility: Insights from primary ciliary dyskinesia genetics. Gene 2011, 473, 57–66. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Sapiro, R.; Kapfhamer, D.; Bucan, M.; Bray, J.; Chennathukuzhi, V.; McNamara, P.; Curtis, A.; Zhang, M.; Blanchette-Mackie, E.J.; et al. A sperm-associated WD repeat protein orthologous to Chlamydomonas PF20 associates with Spag6, the mammalian orthologue of Chlamydomonas PF16. Mol. Cell. Biol. 2002, 22, 7993–8004. [Google Scholar] [CrossRef]
- Kazarian, E.; Son, H.; Sapao, P.; Li, W.; Zhang, Z.; Strauss, J.F.; Teves, M.E. SPAG17 is required for male germ cell differentiation and fertility. Int. J. Mol. Sci. 2018, 19, 1252. [Google Scholar] [CrossRef] [PubMed]
- Xu, X.; Sha, Y.W.; Mei, L.B.; Ji, Z.Y.; Qiu, P.P.; Ji, H.; Li, P.; Wang, T.; Li, L. A familial study of twins with severe asthenozoospermia identified a homozygous SPAG17 mutation by whole-exome sequencing. Clin. Genet. 2018, 93, 345–349. [Google Scholar] [CrossRef] [PubMed]
- Salilew-Wondim, D.; Hölker, M.; Rings, F.; Ghanem, N.; Ulas-Cinar, M.; Peippo, J.; Tholen, E.; Looft, C.; Schellander, K.; Tesfaye, D. Bovine pretransfer endometrium and embryo transcriptome fingerprints as predictors of pregnancy success after embryo transfer. Physiol. Genom. 2010, 42, 201–218. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Siliņa, K.; Zayakin, P.; Kalniņa, Z.; Ivanova, L.; Meistere, I.; Endzeliņš, E.; Abols, A.; Stengrēvics, A.; Leja, M.; Ducena, K.; et al. Sperm-associated antigens as targets for cancer immunotherapy: Expression pattern and humoral immune response in cancer patients. J. Immunother. 2011, 34, 28–44. [Google Scholar] [CrossRef] [PubMed]
- Teves, M.E.; Sundaresan, G.; Cohen, D.J.; Hyzy, S.L.; Kajan, I.; Maczis, M.; Zhang, Z.; Costanzo, R.M.; Zweit, J.; Schwartz, Z.; et al. Spag17 deficiency results in skeletal malformations and bone abnormalities. PLoS ONE 2015, 10, e0125936. [Google Scholar] [CrossRef] [PubMed]
- Andjelkovic, M.; Minic, P.; Vreca, M.; Stojiljkovic, M.; Skakic, A.; Sovtic, A.; Rodic, M.; Skodric-Trifunovic, V.; Maric, N.; Visekruna, J.; et al. Genomic profiling supports the diagnosis of primary ciliary dyskinesia and reveals novel candidate genes and genetic variants. PLoS ONE 2018, 13, e0205422. [Google Scholar] [CrossRef] [PubMed]
- Weedon, M.N.; Frayling, T.M. Reaching new heights: Insights into the genetics of human stature. Trends Genet. 2008, 24, 595–603. [Google Scholar] [CrossRef] [PubMed]
- Córdova-Fletes, C.; Becerra-Solano, L.E.; Rangel-Sosa, M.M.; Rivas-Estilla, A.M.; Alberto Galán-Huerta, K.; Ortiz-López, R.; Rojas-Martínez, A.; Juárez-Vázquez, C.I.; García-Ortiz, J.E. Uncommon runs of homozygosity disclose homozygous missense mutations in two ciliopathy-related genes (SPAG17 and WDR35) in a patient with multiple brain and skeletal anomalies. Eur. J. Med. Genet. 2018, 61, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J.; Li, M.; Bradfield, J.P.; Zhang, H.; Mentch, F.D.; Wang, K.; Sleiman, P.M.; Kim, C.E.; Glessner, J.T.; Hou, C.; et al. The role of height-associated loci identified in genome wide association studies in the determination of pediatric stature. BMC Med. Genet. 2010, 11, 96. [Google Scholar] [CrossRef]
- Kim, J.J.; Lee, H.I.; Park, T.; Kim, K.; Lee, J.E.; Cho, N.H.; Shin, C.; Cho, Y.S.; Lee, J.Y.; Han, B.G.; et al. Identification of 15 loci influencing height in a Korean population. J. Hum. Genet. 2010, 55, 27–31. [Google Scholar] [CrossRef] [PubMed]
- Weedon, M.N.; Lango, H.; Lindgren, C.M.; Wallace, C.; Evans, D.M.; Mangino, M.; Freathy, R.M.; Perry, J.R.; Stevens, S.; Hall, A.S.; et al. Genome-wide association analysis identifies 20 loci that influence adult height. Nat. Genet. 2008, 40, 575–583. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- N’Diaye, A.; Chen, G.K.; Palmer, C.D.; Ge, B.; Tayo, B.; Mathias, R.A.; Ding, J.; Nalls, M.A.; Adeyemo, A.; Adoue, V.; et al. Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. PLoS Genet. 2011, 7, e1002298. [Google Scholar] [CrossRef]
- Van der Valk, R.J.; Kreiner-Møller, E.; Kooijman, M.N.; Guxens, M.; Stergiakouli, E.; Sääf, A.; Bradfield, J.P.; Geller, F.; Hayes, M.G.; Cousminer, D.L.; et al. A novel common variant in DCST2 is associated with length in early life and height in adulthood. Hum. Mol. Genet. 2015, 24, 1155–1168. [Google Scholar] [CrossRef] [PubMed]
- Zhao, J. Shaanbei White Cashmere Goats “Breeding Three Times within Two Years” Management Technology Solutions. Master’s Thesis, Northwest A&F University, Yangling, China, 2017. (In Chinese). [Google Scholar]
- Wang, L.; Cai, B.; Zhou, S.; Zhu, H.; Qu, L.; Wang, X.; Chen, Y. RNA-seq reveals transcriptome changes in goats following myostatin gene knockout. PLoS ONE 2017, 12, e0187966. [Google Scholar] [CrossRef]
- Shi, L.G.; Zhou, X.; Zhou, H.L.; Huang, X.Z.; Wang, D.J.; Li, B.; Liu, Y.J. Germplasm characteristics of Hainan black goat. Chin. Livest. Poult. Breed. 2016, 11, 70–71. (In Chinese) [Google Scholar]
- Wang, X.Y.; Yang, Q.; Wang, K.; Zhang, S.H.; Pan, C.Y.; Chen, H.; Qu, L.; Yan, H.L.; Lan, X.Y. A novel 12-bp indel polymorphism within the GDF9 gene is significantly associated with litter size and growth traits in goats. Anim. Genet. 2017, 48, 735–736. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Yan, H.; Li, J.; Xu, H.; Wang, K.; Zhu, H.; Chen, H.; Qu, L.; Lan, X. A novel 14-bp duplicated deletion within goat GHR gene is significantly associated with growth traits and litter size. Anim. Genet. 2017, 48, 499–500. [Google Scholar] [CrossRef]
- Cui, Y.; Yan, H.; Wang, K.; Xu, H.; Zhang, X.; Zhu, H.; Liu, J.; Qu, L.; Lan, X.; Pan, C. Insertion/deletion within the KDM6A gene is significantly associated with litter size in goat. Front. Genet. 2018, 9, 91. [Google Scholar] [CrossRef]
- Wu, X.; Jia, W.; Zhang, J.; Li, X.; Pan, C.; Lei, C.; Chen, H.; Lan, X. Determination of the novel genetic variants of goat stat5a, gene and their effects on body measurement traits in two Chinese native breeds. Small Rumin. Res. 2014, 121, 232–243. [Google Scholar] [CrossRef]
- Salako, A.E. Application of Morphological Indices in the Assessment of Type and Function in Sheep. Int. J. Morphol. 2006, 24, 13–18. [Google Scholar] [CrossRef]
- Aljanabi, S.M.; Martinez, I. Universal and rapid salt-extraction of high quality genomic DNA for PCR-based techniques. Nucleic Acid. Res. 1997, 25, 4692–4693. [Google Scholar] [CrossRef] [PubMed]
- Yang, Q.; Zhang, S.; Li, J.; Wang, X.; Peng, K.; Lan, X.; Pan, C. Development of a touch-down multiplex PCR method for simultaneously rapidly detecting three novel insertion/deletions (indels) within one gene: An example for goat GHR gene. Anim. Biotechnol. 2018, 11, 1–6. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, Z.; He, Z.; Tang, W.; Li, T.; Zeng, Z.; He, L.; Shi, Y. A partition-ligation-combination-subdivision EM algorithm for haplotype inference with multiallelic markers: Update of the SHEsis (http://analysis.bio-x.cn). Cell Res. 2009, 19, 519–523. [Google Scholar] [CrossRef]
- Nei, M. Analysis of gene diversity in subdivided populations. Proc. Natl. Acad. Sci. USA 1973, 70, 3321–3323. [Google Scholar] [CrossRef] [PubMed]
- Kang, Z.; Jiang, E.; Wang, K.; Pan, C.; Chen, H.; Yan, H.; Zhu, H.; Liu, J.; Qu, L.; Lan, X. Goat membrane associated ring-CH-type finger 1 (MARCH1) mRNA expression and association with litter size. Theriogenology 2019, 128, 8–16. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Yang, Q.; Wang, K.; Yan, H.; Pan, C.; Chen, H.; Liu, J.; Zhu, H.; Qu, L.; Lan, X. Two strongly linked single nucleotide polymorphisms (Q320P and V397I) in GDF9 gene are associated with litter size in cashmere goats. Theriogenology 2019, 125, 115–121. [Google Scholar] [CrossRef]
- Wang, X.; Liu, J.; Zhou, G.; Guo, J.; Yan, H.; Niu, Y.; Li, Y.; Yuan, C.; Geng, R.; Lan, X.; et al. Whole-genome sequencing of eight goat populations for the detection of selection signatures underlying production and adaptive traits. Sci. Rep. 2016, 6, 38932. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bai, H.; Cao, Y.; Quan, J.; Dong, L.; Li, Z.; Zhu, Y.; Zhu, L.; Dong, Z.; Li, D. Identifying the genome-wide sequence variations and developing new molecular markers for genetics research by re-sequencing a Landrace cultivar of foxtail millet. PLoS ONE 2013, 8, e73514. [Google Scholar] [CrossRef] [PubMed]
- Vaz-Drago, R.; Custódio, N.; Carmo-Fonseca, M. Deep intronic mutations and human disease. Hum. Genet. 2017, 136, 1093–1111. [Google Scholar] [CrossRef]
- Van Laere, A.S.; Nguyen, M.; Braunschweig, M.; Nezer, C.; Collette, C.; Moreau, L.; Archibald, A.L.; Haley, C.S.; Buys, N.; Tally, M.; et al. A regulatory mutation in IGF2 causes a major QTL effect on muscle growth in the pig. Nature 2003, 425, 832–836. [Google Scholar] [CrossRef] [PubMed]
- Thi Tran, H.T.; Takeshima, Y.; Surono, A.; Yagi, M.; Wada, H.; Matsuo, M. A G-to-A transition at the fifth position of intron-32 of the dystrophin gene inactivates a splice-donor site both in vivo and in vitro. Mol. Genet. Metab. 2005, 85, 213–219. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Zhong, J.; Gao, Y.; Ju, Z.; Huang, J. A SNP in intron 8 of CD46 causes a novel transcript associated with mastitis in Holsteins. BMC Genom. 2014, 15, 630. [Google Scholar] [CrossRef] [PubMed]
Primers | Primer Sequences (5’→3’) | Product Sizes (bp) | Location |
---|---|---|---|
P1 | F: AAACGAAGCCTCCAAAGA | 263 | Intron 2 |
R: TGATCCATCGACCTGTAAGA | |||
P2 | F: TGAAGGTGAACTTCCGAATA | 287 | Intron 4 |
R: ATGAAACCAGAGCCCAGA | |||
P3 | F: TCAAGTTCAAGGTGGTTTCA | 168 | Intron 10 |
R: CCTTCAGCCCATCACTTACT | |||
P4 | F: GAGGGAATGTGAGCAGGAT | 169 | Intron 22 |
R: TTTGATGACAAGGAAGGGA | |||
P5 | F: GATTTGGCTGAGTTATACGAGG | 184 | Intron 42 |
R: GTAGGCAAAATGCGAGGT | |||
P6 | F: AAGTTCAGGGAGTGTTAAGGA | 241 | Intron 47 |
R: CTGTGCCAGACAGATGGTC |
Loci/Breeds | Sizes (N) | Genotypic Frequencies | p Value e | Allelic Frequencies | p Value f | a HWE p Values | Population Genetic Parameters | |||||
---|---|---|---|---|---|---|---|---|---|---|---|---|
II | ID | DD | I | D | Hob | Nec | PICd | |||||
14 bp indel | ||||||||||||
SBWC | 1510 | 0.013 | 0.140 | 0.847 | 3.4 × 10 −70 | 0.083 | 0.917 | 2.7 × 10 −83 | p < 0.05 | 0.848 | 1.179 | 0.140 |
HNBG | 211 | 0.218 | 0.384 | 0.398 | 0.410 | 0.590 | p < 0.05 | 0.519 | 1.926 | 0.365 | ||
17 bp indel | ||||||||||||
SBWC | 1191 | 0.036 | 0.354 | 0.610 | 1.4 × 10 −35 | 0.213 | 0.787 | 1.9 × 10 −34 | p > 0.05 | 0.664 | 1.505 | 0.279 |
HNBG | 211 | 0.223 | 0.545 | 0.232 | 0.495 | 0.505 | p > 0.05 | 0.500 | 2.000 | 0.375 |
Loci-Body Measurement Traits | Genotypes (Mean ± SE) | p Values | ||
---|---|---|---|---|
II (n = 19) | ID (n = 211) | DD (n = 1278) | ||
14 bp indel | ||||
Body height (cm) | 60.11 A ± 0.57 | 57.89 B ± 0.34 | 56.99 B ± 0.12 | 4.12 × 10 −4 |
Chest width (cm) | 20.34 A ± 0.66 | 18.98 A ± 0.22 | 18.30 B ± 0.09 | 3.05 × 10 −4 |
Chest depth (cm) | 28.50 AB ± 0.74 | 28.75 A ± 0.20 | 27.99 B ± 0.10 | 0.003 |
Body length (cm) | 65.84 AB ± 1.35 | 65.00 A ± 0.38 | 63.82 B ± 0.15 | 0.006 |
Heart girth (cm) | 86.42 ± 2.13 | 86.42 ± 0.57 | 85.32 ± 0.27 | 0.270 |
Cannon circumference (cm) | 7.91 ± 0.21 | 7.77 ± 0.06 | 7.70 ± 0.03 | 0.377 |
Height at hip cross (cm) | 60.03 ± 1.18 | 60.04 ± 0.29 | 59.74 ± 0.13 | 0.643 |
17 bp indel | II (n = 43) | ID (n = 421) | DD (n = 725) | pValues |
Body height (cm) | 59.13 A ± 0.46 | 57.15 B ± 0.22 | 57.07 B ± 0.17 | 0.006 |
Chest width (cm) | 19.42 a ± 0.51 | 18.54 ab ± 0.15 | 18.42 b ± 0.12 | 0.043 |
Chest depth (cm) | 28.69 ± 0.48 | 28.18 ± 0.17 | 28.17 ± 0.14 | 0.533 |
Body length (cm) | 65.38 ± 0.78 | 64.25 ± 0.28 | 64.16 ± 0.20 | 0.363 |
Heart girth (cm) | 87.36 ± 1.14 | 86.45 ± 0.45 | 85.68 ± 0.34 | 0.241 |
Cannon circumference (cm) | 7.92 ± 0.12 | 7.85 ± 0.04 | 7.77 ± 0.03 | 0.215 |
Height at hip cross (cm) | 60.61 ± 0.63 | 60.00 ± 0.22 | 59.66 ± 0.16 | 0.228 |
Loci-Body Measurement Traits | Genotypes (Mean ± SE) | p Values | ||
---|---|---|---|---|
II (n = 42) | ID (n = 76) | DD (n = 81) | ||
14 bp indel | ||||
Body weight (kg) | 29.71 ± 1.13 | 29.69 ± 0.68 | 29.44 ± 0.77 | 0.967 |
Body height (cm) | 52.68 ± 0.54 | 53.93 ± 0.49 | 53.11 ± 0.41 | 0.201 |
Body length (cm) | 56.42 ± 0.78 | 56.52 ± 0.49 | 56.49 ± 0.49 | 0.994 |
Heart girth (cm) | 73.09 ± 1.00 | 73.56 ± 0.66 | 72.84 ± 0.69 | 0.757 |
Chest depth (cm) | 26.76 ± 0.29 | 27.04 ± 0.24 | 26.71 ± 0.24 | 0.579 |
Chest width (cm) | 14.96 ± 0.33 | 15.09 ± 0.17 | 15.29 ± 0.20 | 0.585 |
Hip width (cm) | 13.75 ± 0.19 | 14.08 ± 0.16 | 13.72 ± 0.15 | 0.203 |
Cannon circumference (cm) | 8.00 ± 0.11 | 7.93 ± 0.07 | 8.03 ± 0.07 | 0.610 |
Body trunk index | 129.92 ± 1.55 | 130.39 ± 0.99 | 129.11 ± 0.88 | 0.646 |
Body length index | 107.23 ± 1.27 | 105.08 ± 0.83 | 106.66 ± 0.97 | 0.304 |
Heart girth index | 138.87 ± 1.56 | 136.67 ± 0.99 | 137.38 ± 1.19 | 0.510 |
Cannon circumference index | 15.21 ± 0.21 | 14.74 ± 0.13 | 15.18 ± 0.15 | 0.050 |
Chest width index | 55.85 ± 0.97 | 55.91 ± 0.53 | 57.34 ± 0.65 | 0.190 |
Thurl width index | 108.80 ± 1.81 | 107.76 ± 1.23 | 111.80 ± 1.27 | 0.070 |
17 bp indel | II (n = 44) | ID (n = 109) | DD (n = 46) | pValues |
Body weight (kg) | 30.09 ± 1.02 | 29.49 ± 0.57 | 29.35 ± 1.18 | 0.847 |
Body height (cm) | 53.14 ± 0.53 | 53.38 ± 0.37 | 53.38 ± 0.64 | 0.937 |
Body length (cm) | 56.86 ± 0.71 | 56.35 ± 0.40 | 56.43 ± 0.74 | 0.813 |
Heart girth (cm) | 73.24 ± 0.96 | 73.45 ± 0.53 | 72.42 ± 1.03 | 0.632 |
Chest depth (cm) | 26.80 ± 0.32 | 26.95 ± 0.19 | 26.65 ± 0.32 | 0.703 |
Chest width (cm) | 15.28 ± 0.29 | 15.16 ± 0.15 | 14.98 ± 0.29 | 0.706 |
Hip width (cm) | 13.79 ± 0.20 | 14.03 ± 0.12 | 13.54 ± 0.22 | 0.110 |
Cannon circumference (cm) | 7.90 ± 0.11 | 8.05 ± 0.06 | 7.91 ± 0.10 | 0.293 |
Body trunk index | 129.06 ± 1.36 | 130.60 ± 0.85 | 128.48 ± 1.15 | 0.314 |
Body length index | 107.22 ± 1.33 | 105.88 ± 0.80 | 105.88 ± 1.02 | 0.626 |
Heart girth index | 137.93 ± 1.47 | 137.92 ± 0.98 | 135.76 ± 1.29 | 0.426 |
Cannon circumference index | 14.90 ± 0.19 | 15.14 ± 0.13 | 14.85 ± 0.15 | 0.320 |
Chest width index | 57.04 ± 0.83 | 56.33 ± 0.49 | 56.30 ± 0.96 | 0.751 |
Thurl width index | 111.12 ± 1.80 | 108.47 ± 1.05 | 110.95 ± 1.67 | 0.281 |
Body Measurement Traits | Combined Genotypes (Mean ± SE)/Frequencies (Number) | p Values | |||
---|---|---|---|---|---|
ID-ID 0.061 (71) | ID-DD 0.290 (339) | DD-ID 0.100 (117) | DD-DD 0.511 (598) | ||
Body height (cm) | 58.02 a ± 0.63 | 56.93 a ± 0.24 | 58.01 b ± 0.43 | 56.83 b ± 0.18 | 0.009 |
Chest width (cm) | 18.72 ab ± 0.39 | 18.46 ab ± 0.17 | 19.08 a ± 0.30 | 18.27 b ± 0.13 | 0.011 |
Chest depth (cm) | 28.72 ± 0.35 | 28.14 ± 0.19 | 28.78 ± 0.26 | 28.18 ± 0.17 | 0.265 |
Body length (cm) | 65.07 ± 0.74 | 64.02 ± 0.31 | 64.93 ± 0.48 | 63.95 ± 0.22 | 0.152 |
Heart girth (cm) | 87.02 ± 0.93 | 86.27 ± 0.53 | 86.02 ± 0.80 | 85.65 ± 0.38 | 0.581 |
Cannon circumference (cm) | 7.88 ± 0.12 | 7.83 ± 0.05 | 7.71 ± 0.07 | 7.79 ± 0.03 | 0.416 |
Height at hip cross (cm) | 59.69 ± 0.53 | 60.05 ± 0.24 | 60.29 ± 0.35 | 59.53 ± 0.18 | 0.186 |
Body Measurement Traits (n = 199) | Combined Genotypes (Mean ± SE)/Frequencies (Number) | p Value | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
II-II 0.055 (11) | II-ID 0.096 (n = 19) | II-DD 0.060 (12) | ID-II 0.080 (16) | ID-ID 0.221 (44) | ID-DD 0.080 (16) | DD-II 0.086 (17) | DD-ID 0.231 (46) | DD-DD 0.091 (18) | ||
Body weight (kg) | 30.23 abc ± 1.72 | 27.37 c ± 1.30 | 32.94 a ± 2.85 | 28.44 abc ± 1.33 | 30.95 ab ± 0.84 | 27.53 b ± 1.69 | 31.56 abc ± 2.03 | 29.00 abc ± 0.91 | 28.58 abc ± 1.70 | 0.022 |
Body height (cm) | 52.18 ab ± 0.77 | 52.01 b ± 0.88 | 54.21 ab ± 1.01 | 52.36 b ± 0.79 | 54.60 a ± 0.62 | 53.64 ab ± 1.32 | 54.51 ab ± 1.00 | 52.79 b ± 0.50 | 52.61 ab ± 0.93 | 0.015 |
Body length (cm) | 57.45 abcd ± 1.23 | 54.38 d ± 0.97 | 58.70 a ± 1.76 | 55.46 abcd ± 1.15 | 57.45 ab ± 0.59 | 55.00 bcd ± 1.12 | 57.80 abc ± 1.23 | 56.12 abcd ± 0.61 | 56.19 abcd ± 1.02 | 0.008 |
Heart girth (cm) | 73.64 ab ± 1.93 | 71.69 ab ± 1.22 | 74.79 ab ± 2.34 | 72.16 ab ± 1.35 | 74.63 a ± 0.84 | 72.03 ab ± 1.63 | 74.01 ab ± 1.79 | 73.05 ab ± 0.82 | 71.19 b ± 1.54 | 0.045 |
Chest depth (cm) | 26.53 ab ± 0.61 | 26.39 ab ± 0.37 | 27.56 a ± 0.62 | 26.31 ab ± 0.44 | 27.45 a ± 0.31 | 26.65 ab ± 0.58 | 27.44 a ± 0.59 | 26.70 ab ± 0.3 | 26.04 b ± 0.46 | 0.015 |
Chest width (cm) | 15.31 ± 0.53 | 14.36 ± 0.38 | 15.58 ± 0.86 | 15.13 ± 0.40 | 15.30 ± 0.20 | 14.49 ± 0.35 | 15.41 ± 0.58 | 15.35 ± 0.25 | 15.01 ± 0.35 | 0.399 |
Hip width (cm) | 13.56 ab ± 0.22 | 13.67 b ± 0.27 | 14.04 ab ± 0.47 | 13.78 ab ± 0.27 | 14.39 a ± 0.19 | 13.51 b ± 0.41 | 13.95 ab ± 0.44 | 13.83 b ± 0.18 | 13.23 b ± 0.27 | 0.002 |
Cannon circumference (cm) | 8.14 ± 0.21 | 8.00 ± 0.16 | 7.88 ± 0.25 | 7.72 ± 0.18 | 8.06 ± 0.09 | 7.78 ± 0.14 | 7.92 ± 0.17 | 8.06 ± 0.08 | 8.06 ± 0.15 | 0.538 |
Body trunk index | 128.29 ± 2.55 | 132.30 ± 2.57 | 127.64 ± 2.66 | 130.58 ± 2.70 | 130.10 ± 1.30 | 131.01 ± 1.67 | 128.12 ± 1.92 | 130.38 ± 1.18 | 126.79 ± 1.79 | 0.635 |
Body length index | 110.19 a ± 2.22 | 104.88 ab ± 2.02 | 108.22 ab ± 2.21 | 106.01 ab ± 1.89 | 105.54 ab ± 1.13 | 102.86 b ± 1.60 | 106.44 ab ± 2.58 | 106.61 ab ± 1.32 | 107.00 ab ± 1.49 | 0.022 |
Heart girth index | 141.05 ± 2.66 | 138.14 ± 2.18 | 138.02 ± 3.62 | 137.91 ± 2.05 | 136.99 ± 1.36 | 134.58 ± 1.96 | 135.94 ± 2.81 | 138.72 ± 1.72 | 135.31 ± 1.52 | 0.749 |
Cannon circumference index | 15.61 ab ± 0.35 | 15.44 ab ± 0.34 | 14.50 c ± 0.31 | 14.74 abc ± 0.27 | 14.81 b ± 0.18 | 14.54 b ± 0.19 | 14.58 b ± 0.34 | 15.33 a ± 0.20 | 15.34 abc ± 0.24 | 0.028 |
Chest width index | 57.68 ab ± 1.36 | 54.43 b ± 1.23 | 56.40 ab ± 2.51 | 57.48 ab ± 1.11 | 55.85 ab ± 0.67 | 54.54 ab ± 1.21 | 56.21 ab ± 1.68 | 57.58 a ± 0.79 | 57.80 ab ± 1.43 | 0.037 |
Thurl width index | 113.03 ab ± 3.95 | 105.32 b ± 2.46 | 110.44 ab ± 3.24 | 109.91 ab ± 2.51 | 106.87 b ± 1.72 | 108.04 ab ± 2.42 | 111.01 ab ± 3.24 | 111.29 ab ± 1.51 | 113.88 a ± 2.96 | 0.022 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, S.; Jiang, E.; Wang, K.; Zhang, Y.; Yan, H.; Qu, L.; Chen, H.; Lan, X.; Pan, C. Two Insertion/Deletion Variants within SPAG17 Gene Are Associated with Goat Body Measurement Traits. Animals 2019, 9, 379. https://doi.org/10.3390/ani9060379
Zhang S, Jiang E, Wang K, Zhang Y, Yan H, Qu L, Chen H, Lan X, Pan C. Two Insertion/Deletion Variants within SPAG17 Gene Are Associated with Goat Body Measurement Traits. Animals. 2019; 9(6):379. https://doi.org/10.3390/ani9060379
Chicago/Turabian StyleZhang, Sihuan, Enhui Jiang, Ke Wang, Yu Zhang, Hailong Yan, Lei Qu, Hong Chen, Xianyong Lan, and Chuanying Pan. 2019. "Two Insertion/Deletion Variants within SPAG17 Gene Are Associated with Goat Body Measurement Traits" Animals 9, no. 6: 379. https://doi.org/10.3390/ani9060379