MicroRNA-223 Attenuates Stretch-Injury-Induced Apoptosis in Brain Microvascular Endothelial Cells by Regulating RhoB Expression
Abstract
:1. Introduction
2. Method
2.1. Endothelial Cells Culture
2.2. Mechanical Cell Injury
2.3. Cell Transfection
2.4. Immunostaining
2.5. Relative Real-Time Polymerase Chain Reaction
- miR-223-F: 5′-TGTCAGTTTGTCAAATA-3′;
- miR-223-R: 5′-GTGCAGGGTCCGAGGT-3′;
- U6-F: 5′CGCTTCGGCAGCACATATAC-3′;
- U6-R: 5′- AAATATGGAACGCT-TCACGA-3′;
- RhoB-F:5′-TCGTGTTCAGTAAGGACGAG-3′;
- RhoB-R:5′-ACTTCTCGGGGATGTTCTC-3′;
- GAPDH-F: 5′- TGAGGCCGGTGCTGAGTATGT -3′;
- GAPDH-R: 5′- CAGTCTTCTGGGTGGCAGTGAT-3′;
2.6. Western Blot Analysis
2.7. Flow Cytometry
2.8. Statistical Analysis
3. Result
3.1. The Expression of miR-223 Increased after SI
3.2. miR-223 Was Overexpressed in bEnd.3 Cells by Lentivirus Transfection
3.3. miR-223 Attenuates the Loss of Tight Junction Protein after SI in bEnd.3 Cells
3.4. miR-223 Inhibits Apoptosis of bEnd.3 Cells after Stretch Injury
3.5. miR-223 Modulated SI-Induced Caspase-3 Activation
3.6. MiR-223 Inhibited RhoB Expression, and Knockdown of RhoB Decreased Caspase-3 Activation
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Pourhoseini, S.; Seth, R.K.; Das, S.; Dattaroy, D.; Kadiiska, M.B.; Xie, G.; Michelotti, G.A.; Nagarkatti, M.; Diehl, A.M.; Chatterjee, S. Upregulation of miR21 and repression of Grhl3 by leptin mediates sinusoidal endothelial injury in experimental nonalcoholic steatohepatitis. PLoS ONE 2015, 10, e0116780. [Google Scholar]
- Jiao, P.; Wang, X.P.; Luoreng, Z.M.; Yang, J.; Jia, L.; Ma, Y.; Wei, D.W. miR-223: An Effective Regulator of Immune Cell Differentiation and Inflammation. Int. J. Biol. Sci. 2021, 17, 2308–2322. [Google Scholar] [CrossRef]
- Wei, H.; Xu, Y.; Chen, Q.; Chen, H.; Zhu, X.; Li, Y. Mesenchymal stem cell-derived exosomal miR-223 regulates neuronal cell apoptosis. Cell Death Dis. 2020, 11, 290. [Google Scholar] [CrossRef]
- Zhang, Y.; Wu, Q.; Niu, G.; Liu, J.; Cao, F.; An, X.; Cao, B. EGF-Induced miR-223 Modulates Goat Mammary Epithelial Cell Apoptosis and Inflammation via ISG15. Front. Cell Dev. Biol. 2021, 9, 660933. [Google Scholar] [CrossRef]
- Wang, B.; Cao, X.; Lin, J.; Qian, Q.; Yu, L.; Qian, Q. Up-regulation of microRNA-223 inhibits brain injury and hippocampal neuron apoptosis of rats after febrile seizure through the NLRP3-Caspase-1 signaling pathway. Biomed. Pharmacother. 2019, 114, 108683. [Google Scholar] [CrossRef]
- Yang, Z.; Zhong, L.; Xian, R.; Yuan, B. MicroRNA-223 regulates inflammation and brain injury via feedback to NLRP3 inflammasome after intracerebral hemorrhage. Mol. Immunol. 2015, 65, 267–276. [Google Scholar] [CrossRef]
- Lei, P.; Li, Y.; Chen, X.; Yang, S.; Zhang, J. Microarray based analysis of microRNA expression in rat cerebral cortex after traumatic brain injury. Brain Res. 2009, 1284, 191–201. [Google Scholar] [CrossRef]
- Wang, W.X.; Visavadiya, N.P.; Pandya, J.D.; Nelson, P.T.; Sullivan, P.G.; Springer, J.E. Mitochondria-associated microRNAs in rat hippocampus following traumatic brain injury. Exp. Neurol. 2015, 265, 84–93. [Google Scholar] [CrossRef]
- Truettner, J.S.; Alonso, O.F.; Bramlett, H.M.; Dietrich, W.D. Therapeutic hypothermia alters microRNA responses to traumatic brain injury in rats. J. Cereb. Blood Flow Metab. 2011, 31, 1897–1907. [Google Scholar]
- Couderc, B.; Pradines, A.; Rafii, A.; Golzio, M.; Deviers, A.; Allal, C.; Berg, D.; Penary, M.; Teissie, J.; Favre, G. In vivo restoration of RhoB expression leads to ovarian tumor regression. Cancer Gene Ther. 2008, 15, 456–464. [Google Scholar] [CrossRef]
- He, Q.; Liu, H.; Huang, C.; Wang, R.; Luo, M.; Lu, W. Herpes Simplex Virus 1-Induced Blood-Brain Barrier Damage Involves Apoptosis Associated With GM130-Mediated Golgi Stress. Front. Mol. Neurosci. 2020, 13, 2. [Google Scholar] [CrossRef]
- Zhang, L.; Yang, H.; Li, W.J.; Liu, Y.H. LncRNA MALAT1 Promotes OGD-Induced Apoptosis of Brain Microvascular Endothelial Cells by Sponging miR-126 to Repress PI3K/Akt Signaling Pathway. Neurochem. Res. 2020, 45, 2091–2099. [Google Scholar] [CrossRef] [PubMed]
- Daneman, R. The blood-brain barrier in health and disease. Ann. Neurol. 2012, 72, 648–672. [Google Scholar] [CrossRef] [PubMed]
- Bosche, B.; Macdonald, R.L. Letter by Bosche and Macdonald regarding article, “relevance of blood-brain barrier disruption after endovascular treatment of ischemic stroke: Dual-energy computed tomographic study”. Stroke 2015, 46, e126–e127. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.L.; Xu, Z.M.; Yang, G.Y.; Yang, D.X.; Ding, J.; Chen, H.; Yuan, F.; Tian, H.L. Sesamin alleviates blood-brain barrier disruption in mice with experimental traumatic brain injury. Acta Pharmacol. Sin. 2017, 38, 1445–1455. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.L.; Yuan, F.; Yang, D.X.; Xu, Z.M.; Jing, Y.; Yang, G.Y.; Geng, Z.; Xia, W.L.; Tian, H.L. Adjudin Attenuates Cerebral Edema and Improves Neurological Function in Mice with Experimental Traumatic Brain Injury. J. Neurotrauma 2018, 35, 2850–2860. [Google Scholar] [CrossRef]
- Bosche, B.; Molcanyi, M.; Noll, T.; Rej, S.; Zatschler, B.; Doeppner, T.R.; Hescheler, J.; Muller, D.J.; Macdonald, R.L.; Hartel, F.V. A differential impact of lithium on endothelium-dependent but not on endothelium-independent vessel relaxation. Prog. Neuro-Psychopharmacol. Biol. Psychiatry 2016, 67, 98–106. [Google Scholar] [CrossRef]
- Xu, Z.; Liu, Y.; Yang, D.; Yuan, F.; Ding, J.; Chen, H.; Tian, H. Sesamin protects SH-SY5Y cells against mechanical stretch injury and promoting cell survival. BMC Neurosci. 2017, 18, 57. [Google Scholar] [CrossRef]
- Xu, Z.M.; Yuan, F.; Liu, Y.L.; Ding, J.; Tian, H.L. Glibenclamide Attenuates Blood-Brain Barrier Disruption in Adult Mice after Traumatic Brain Injury. J. Neurotrauma 2017, 34, 925–933. [Google Scholar] [CrossRef]
- Zhang, M.; Tang, M.; Wu, Q.; Wang, Z.; Chen, Z.; Ding, H.; Hu, X.; Lv, X.; Zhao, S.; Sun, J.; et al. LncRNA DANCR attenuates brain microvascular endothelial cell damage induced by oxygen-glucose deprivation through regulating of miR-33a-5p/XBP1s. Aging 2020, 12, 1778–1791. [Google Scholar] [CrossRef]
- Wang, D.P.; Kang, K.; Sun, J.; Lin, Q.; Lv, Q.L.; Hai, J. URB597 and Andrographolide Improve Brain Microvascular Endothelial Cell Permeability and Apoptosis by Reducing Oxidative Stress and Inflammation Associated with Activation of Nrf2 Signaling in Oxygen-Glucose Deprivation. Oxidative Med. Cell. Longev. 2022, 2022, 4139330. [Google Scholar] [CrossRef]
- Li, J.; Wang, J.; Wang, Z. Circ_0006768 upregulation attenuates oxygen-glucose deprivation/reoxygenation-induced human brain microvascular endothelial cell injuries by upregulating VEZF1 via miR-222-3p inhibition. Metab. Brain Dis. 2021, 36, 2521–2534. [Google Scholar] [CrossRef] [PubMed]
- Sun, X.; Liu, B. Donepezil ameliorates oxygen-glucose deprivation/reoxygenation-induced brain microvascular endothelial cell dysfunction via the SIRT1/FOXO3a/NF-kappaB pathways. Bioengineered 2022, 13, 7760–7770. [Google Scholar] [CrossRef]
- Wang, Q.; Yu, H.; Yu, H.; Ma, M.; Ma, Y.; Li, R. miR2233p/TIAL1 interaction is involved in the mechanisms associated with the neuroprotective effects of dexmedetomidine on hippocampal neuronal cells in vitro. Mol. Med. Rep. 2019, 19, 805–812. [Google Scholar]
- Ding, Q.; Shen, L.; Nie, X.; Lu, B.; Pan, X.; Su, Z.; Yan, A.; Yan, R.; Zhou, Y.; Li, L.; et al. MiR-223-3p overexpression inhibits cell proliferation and migration by regulating inflammation-associated cytokines in glioblastomas. Pathol.-Res. Pract. 2018, 214, 1330–1339. [Google Scholar] [CrossRef] [PubMed]
- Nakanishi, K.; Nakasa, T.; Tanaka, N.; Ishikawa, M.; Yamada, K.; Yamasaki, K.; Kamei, N.; Izumi, B.; Adachi, N.; Miyaki, S.; et al. Responses of microRNAs 124a and 223 following spinal cord injury in mice. Spinal Cord 2010, 48, 192–196. [Google Scholar] [CrossRef] [PubMed]
- Xiao, Y.; Li, Y.; Zhang, H.; Yang, L.; Jiang, Y.; Wei, C.; Feng, X.; Xun, Y.; Yuan, S.; Xiang, S.; et al. TNFAIP1 Is Upregulated in APP/PS1 Mice and Promotes Apoptosis in SH-SY5Y Cells by Binding to RhoB. J. Mol. Neurosci. 2021, 71, 1221–1233. [Google Scholar] [CrossRef]
- Wei, L.J.; Li, J.A.; Bai, D.M.; Song, Y. miR-223-RhoB signaling pathway regulates the proliferation and apoptosis of colon adenocarcinoma. Chem.-Biol. Interact. 2018, 289, 9–14. [Google Scholar] [CrossRef]
- Li, S.; Feng, Y.; Huang, Y.; Liu, Y.; Wang, Y.; Liang, Y.; Zeng, H.; Qu, H.; Wei, L. MiR-223-3p regulates cell viability, migration, invasion, and apoptosis of non-small cell lung cancer cells by targeting RHOB. Open Life Sci. 2020, 15, 389–399. [Google Scholar] [CrossRef]
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liu, Y.; Li, W.; Liu, Y.; Jiang, Y.; Wang, Y.; Xu, Z.; Cui, D.; Gao, L. MicroRNA-223 Attenuates Stretch-Injury-Induced Apoptosis in Brain Microvascular Endothelial Cells by Regulating RhoB Expression. Brain Sci. 2022, 12, 1157. https://doi.org/10.3390/brainsci12091157
Liu Y, Li W, Liu Y, Jiang Y, Wang Y, Xu Z, Cui D, Gao L. MicroRNA-223 Attenuates Stretch-Injury-Induced Apoptosis in Brain Microvascular Endothelial Cells by Regulating RhoB Expression. Brain Sciences. 2022; 12(9):1157. https://doi.org/10.3390/brainsci12091157
Chicago/Turabian StyleLiu, Yingliang, Wenjing Li, Yingxiu Liu, Yang Jiang, Yida Wang, Zhiming Xu, Daming Cui, and Liang Gao. 2022. "MicroRNA-223 Attenuates Stretch-Injury-Induced Apoptosis in Brain Microvascular Endothelial Cells by Regulating RhoB Expression" Brain Sciences 12, no. 9: 1157. https://doi.org/10.3390/brainsci12091157