M6A RNA Methylation Mediates NOD1/NF-kB Signaling Activation in the Liver of Piglets Challenged with Lipopolysaccharide
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Treatment
2.2. Cell Culture
2.3. siRNA and Plasmid Transfection
2.4. Serum Biochemical Parameters
2.5. Liver Cytokine Quantification
2.6. Liver Histologic Observation
2.7. Immunofluorescence
2.8. Measurement of ROS
2.9. RNA Isolation, Real-Time qPCR
2.10. Western Blot
2.11. Quantitative Analysis of Total m6A
2.12. RNA-seq and MeRIP-seq
2.13. Statistical Analysis
3. Results
3.1. LPS Induced Hepatic Inflammation and Damage in Piglets
3.2. LPS Triggered the Inflammatory Response through the NOD1/NF-κB Signaling Pathway
3.3. M6A RNA Methylation Profiles of Liver in Piglets after LPS Administration
3.4. The NOD1/NF-κB Pathway Was Regulated by m6A Methylation Modification
3.5. Increase of ROS, HIF-1α and MAT2A May Contribute to Changes of m6A Modification
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Racanelli, V.; Rehermann, B. The liver as an immunological organ. Hepatology 2006, 43, S54–S62. [Google Scholar] [CrossRef]
- Kumar, H.; Kawai, T.; Akira, S. Pathogen recognition by the innate immune system. Int. Rev. Immunol. 2011, 30, 16–34. [Google Scholar] [CrossRef]
- He, P.; Noda, Y.; Sugiyama, K. Green tea suppresses lipopolysaccharide-induced liver injury in d-galactosamine-sensitized rats. J. Nutr. 2001, 131, 1560–1567. [Google Scholar] [CrossRef]
- Li, Q.; Tan, Y.; Chen, S.; Xiao, X.; Zhang, M.; Wu, Q.; Dong, M. Irisin alleviates LPS-induced liver injury and inflammation through inhibition of NLRP3 inflammasome and NF-κB signaling. J. Recept. Signal Transduct. Res. 2021, 41, 294–303. [Google Scholar] [CrossRef]
- Zhang, J.; Xu, X.; Zhu, H.; Wang, Y.; Hou, Y.; Liu, Y. Dietary fish oil supplementation alters liver gene expressions to protect against LPS-induced liver injury in weanling piglets. Innate Immun. 2019, 25, 60–72. [Google Scholar] [CrossRef]
- Correa, R.G.; Milutinovic, S.; Reed, J.C. Roles of NOD1 (NLRC1) and NOD2 (NLRC2) in innate immunity and inflammatory diseases. Biosci. Rep. 2012, 32, 597–608. [Google Scholar] [CrossRef]
- Ting, J.P.; Lovering, R.C.; Alnemri, E.S.; Bertin, J.; Boss, J.M.; Davis, B.K.; Flavell, R.A.; Girardin, S.E.; Godzik, A.; Harton, J.A.; et al. The NLR gene family: A standard nomenclature. Immunity 2008, 28, 285–287. [Google Scholar] [CrossRef]
- Lassailly, G.; Bou Saleh, M.; Leleu-Chavain, N.; Ningarhari, M.; Gantier, E.; Carpentier, R.; Artru, F.; Gnemmi, V.; Bertin, B.; Maboudou, P.; et al. Nucleotide-binding oligomerization domain 1 (NOD1) modulates liver ischemia reperfusion through the expression adhesion molecules. J. Hepatol. 2019, 70, 1159–1169. [Google Scholar] [CrossRef]
- Huang, S.; Zou, S.; Chen, M.; Gao, X.; Chen, L.; Yang, X.; Yu, Q.; Zhao, X.; Du, Y.; Yang, X.; et al. Local Stimulation of Liver Sinusoidal Endothelial Cells with a NOD1 Agonist Activates T Cells and Suppresses Hepatitis B Virus Replication in Mice. J. Immunol. 2018, 200, 3170–3179. [Google Scholar] [CrossRef]
- Caruso, R.; Warner, N.; Inohara, N.; Núñez, G. NOD1 and NOD2: Signaling, host defense, and inflammatory disease. Immunity 2014, 41, 898–908. [Google Scholar] [CrossRef] [Green Version]
- Benko, S.; Philpott, D.J.; Girardin, S.E. The microbial and danger signals that activate Nod-like receptors. Cytokine 2008, 43, 368–373. [Google Scholar] [CrossRef] [PubMed]
- He, J.; Meng, Z.; Lu, D.; Liu, X.; Lin, H. Recognition of DAP and activation of NF-κB by cytosolic sensor NOD1 in Oreochromis niloticus. Fish Shellfish. Immunol. 2021, 110, 75–85. [Google Scholar] [CrossRef] [PubMed]
- Shen, C.; Xuan, B.; Yan, T.; Ma, Y.; Xu, P.; Tian, X.; Zhang, X.; Cao, Y.; Ma, D.; Zhu, X.; et al. m(6)A-dependent glycolysis enhances colorectal cancer progression. Mol. Cancer 2020, 19, 72. [Google Scholar] [CrossRef]
- Zhong, X.; Yu, J.; Frazier, K.; Weng, X.; Li, Y.; Cham, C.M.; Dolan, K.; Zhu, X.; Hubert, N.; Tao, Y.; et al. Circadian Clock Regulation of Hepatic Lipid Metabolism by Modulation of m(6)A mRNA Methylation. Cell Rep. 2018, 25, 1816–1828.e1814. [Google Scholar] [CrossRef] [PubMed]
- Wu, R.; Liu, Y.; Yao, Y.; Zhao, Y.; Bi, Z.; Jiang, Q.; Liu, Q.; Cai, M.; Wang, F.; Wang, Y.; et al. FTO regulates adipogenesis by controlling cell cycle progression via m(6)A-YTHDF2 dependent mechanism. Biochim. Et Biophys. Acta. Mol. Cell Biol. Lipids 2018, 1863, 1323–1330. [Google Scholar] [CrossRef]
- Wu, J.; Frazier, K.; Zhang, J.; Gan, Z.; Wang, T.; Zhong, X. Emerging role of m(6) A RNA methylation in nutritional physiology and metabolism. Obes. Rev. Off. J. Int. Assoc. Study Obes. 2020, 21, e12942. [Google Scholar] [CrossRef]
- Shi, H.; Wei, J.; He, C. Where, When, and How: Context-Dependent Functions of RNA Methylation Writers, Readers, and Erasers. Mol. Cell 2019, 74, 640–650. [Google Scholar] [CrossRef]
- Mapperley, C.; van de Lagemaat, L.N.; Lawson, H.; Tavosanis, A.; Paris, J.; Campos, J.; Wotherspoon, D.; Durko, J.; Sarapuu, A.; Choe, J.; et al. The mRNA m6A reader YTHDF2 suppresses proinflammatory pathways and sustains hematopoietic stem cell function. J. Exp. Med. 2021, 218, e20200829. [Google Scholar] [CrossRef]
- Li, Q.; Ni, Y.; Zhang, L.; Jiang, R.; Xu, J.; Yang, H.; Hu, Y.; Qiu, J.; Pu, L.; Tang, J.; et al. HIF-1α-induced expression of m6A reader YTHDF1 drives hypoxia-induced autophagy and malignancy of hepatocellular carcinoma by promoting ATG2A and ATG14 translation. Signal Transduct. Target. Ther. 2021, 6, 76. [Google Scholar] [CrossRef]
- Li, T.; Hu, P.S.; Zuo, Z.; Lin, J.F.; Li, X.; Wu, Q.N.; Chen, Z.H.; Zeng, Z.L.; Wang, F.; Zheng, J.; et al. METTL3 facilitates tumor progression via an m(6)A-IGF2BP2-dependent mechanism in colorectal carcinoma. Mol. Cancer 2019, 18, 112. [Google Scholar] [CrossRef]
- Han, Y.C.; Xie, H.Z.; Lu, B.; Xiang, R.L.; Zhang, H.P.; Li, J.Y.; Zhang, S.Y. Lipopolysaccharide Alters the m6A Epitranscriptomic Tagging of RNAs in Cardiac Tissue. Front. Mol. Biosci. 2021, 8, 670160. [Google Scholar] [CrossRef] [PubMed]
- Lu, N.; Li, X.; Yu, J.; Li, Y.; Wang, C.; Zhang, L.; Wang, T.; Zhong, X. Curcumin Attenuates Lipopolysaccharide-Induced Hepatic Lipid Metabolism Disorder by Modification of m(6) A RNA Methylation in Piglets. Lipids 2018, 53, 53–63. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Guo, F.; Zhao, R. Hepatic expression of FTO and fatty acid metabolic genes changes in response to lipopolysaccharide with alterations in m(6)A modification of relevant mRNAs in the chicken. Br. Poult. Sci. 2016, 57, 628–635. [Google Scholar] [CrossRef] [PubMed]
- Feng, Z.; Li, Q.; Meng, R.; Yi, B.; Xu, Q. METTL3 regulates alternative splicing of MyD88 upon the lipopolysaccharide-induced inflammatory response in human dental pulp cells. J. Cell. Mol. Med. 2018, 22, 2558–2568. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Wang, F.; Sun, F.; Yue, T.; Zhou, Q.; Yang, C.; Rong, S.; Yang, P.; Xiong, F.; Yu, Q.; et al. Targeted Inhibition of FTO Demethylase Protects Mice Against LPS-Induced Septic Shock by Suppressing NLRP3 Inflammasome. Front. Immunol. 2021, 12, 663295. [Google Scholar] [CrossRef] [PubMed]
- Hou, J.; Zhang, H.; Liu, J.; Zhao, Z.; Wang, J.; Lu, Z.; Hu, B.; Zhou, J.; Zhao, Z.; Feng, M.; et al. YTHDF2 reduction fuels inflammation and vascular abnormalization in hepatocellular carcinoma. Mol. Cancer 2019, 18, 163. [Google Scholar] [CrossRef] [PubMed]
- Zheng, C.; Song, B.; Duan, Y.; Zhong, Y.; Yan, Z.; Zhang, S.; Li, F. Dietary β-hydroxy-β-methylbutyrate improves intestinal function in weaned piglets after lipopolysaccharide challenge. Nutrition 2020, 78, 110839. [Google Scholar] [CrossRef]
- Ramaiah, S.K. A toxicologist guide to the diagnostic interpretation of hepatic biochemical parameters. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2007, 45, 1551–1557. [Google Scholar] [CrossRef]
- Murray, B.; Barbier-Torres, L.; Fan, W.; Mato, J.M.; Lu, S.C. Methionine adenosyltransferases in liver cancer. World J. Gastroenterol. 2019, 25, 4300–4319. [Google Scholar] [CrossRef]
- Liu, Q.; Liu, L.; Zhao, Y.; Zhang, J.; Wang, D.; Chen, J.; He, Y.; Wu, J.; Zhang, Z.; Liu, Z. Hypoxia induces genomic DNA demethylation through the activation of HIF-1α and transcriptional upregulation of MAT2A in hepatoma cells. Mol. Cancer Ther. 2011, 10, 1113–1123. [Google Scholar] [CrossRef] [Green Version]
- Rathinam, V.A.K.; Zhao, Y.; Shao, F. Innate immunity to intracellular LPS. Nat. Immunol. 2019, 20, 527–533. [Google Scholar] [CrossRef] [PubMed]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef]
- Bi, D.; Wang, Y.; Gao, Y.; Li, X.; Chu, Q.; Cui, J.; Xu, T. Recognition of Lipopolysaccharide and Activation of NF-κB by Cytosolic Sensor NOD1 in Teleost Fish. Front. Immunol. 2018, 9, 1413. [Google Scholar] [CrossRef]
- Zhang, C.; Hsu, A.C.; Pan, H.; Gu, Y.; Zuo, X.; Dong, B.; Wang, Z.; Zheng, J.; Lu, J.; Zheng, R.; et al. Columbianadin Suppresses Lipopolysaccharide (LPS)-Induced Inflammation and Apoptosis through the NOD1 Pathway. Molecules 2019, 24, 549. [Google Scholar] [CrossRef] [PubMed]
- Inohara, N.; Koseki, T.; del Peso, L.; Hu, Y.; Yee, C.; Chen, S.; Carrio, R.; Merino, J.; Liu, D.; Ni, J.; et al. Nod1, an Apaf-1-like activator of caspase-9 and nuclear factor-kappaB. J. Biol. Chem. 1999, 274, 14560–14567. [Google Scholar] [CrossRef]
- Wang, C.; Deng, L.; Hong, M.; Akkaraju, G.R.; Inoue, J.; Chen, Z.J. TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 2001, 412, 346–351. [Google Scholar] [CrossRef]
- Mitchell, S.; Vargas, J.; Hoffmann, A. Signaling via the NFκB system. Wiley Interdiscip. Rev. Syst. Biol. Med. 2016, 8, 227–241. [Google Scholar] [CrossRef]
- Hoesel, B.; Schmid, J.A. The complexity of NF-κB signaling in inflammation and cancer. Mol. Cancer 2013, 12, 86. [Google Scholar] [CrossRef] [PubMed]
- Yunna, C.; Mengru, H.; Lei, W.; Weidong, C. Macrophage M1/M2 polarization. Eur. J. Pharmacol. 2020, 877, 173090. [Google Scholar] [CrossRef]
- Liu, L.; Guo, H.; Song, A.; Huang, J.; Zhang, Y.; Jin, S.; Li, S.; Zhang, L.; Yang, C.; Yang, P. Progranulin inhibits LPS-induced macrophage M1 polarization via NF-κB and MAPK pathways. BMC Immunol. 2020, 21, 32. [Google Scholar] [CrossRef]
- Guo, F.; Zhang, Y.; Ma, J.; Yu, Y.; Wang, Q.; Gao, P.; Wang, L.; Xu, Z.; Wei, X.; Jing, M. m(6)A mRNA Methylation Was Associated With Gene Expression and Lipid Metabolism in Liver of Broilers Under Lipopolysaccharide Stimulation. Front. Genet. 2022, 13, 818357. [Google Scholar] [CrossRef] [PubMed]
- Wu, J.; Gan, Z.; Zhuo, R.; Zhang, L.; Wang, T.; Zhong, X. Resveratrol Attenuates Aflatoxin B(1)-Induced ROS Formation and Increase of m(6)A RNA Methylation. Anim. Open Access J. MDPI 2020, 10, 677. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Ni, X. ROS-mediated DNA methylation pattern alterations in carcinogenesis. Curr. Drug Targets 2015, 16, 13–19. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Wang, Y.; Chen, Z.; Yue, Y.; Huang, H.; Wu, B.; Liu, Y.; Zhou, D.X.; Zhao, Y. ROS-stimulated protein lysine acetylation is required for crown root development in rice. J. Adv. Res. 2022; in press. [Google Scholar] [CrossRef]
- Bonello, S.; Zähringer, C.; BelAiba, R.S.; Djordjevic, T.; Hess, J.; Michiels, C.; Kietzmann, T.; Görlach, A. Reactive oxygen species activate the HIF-1alpha promoter via a functional NFkappaB site. Arterioscler. Thromb. Vasc. Biol. 2007, 27, 755–761. [Google Scholar] [CrossRef]
- Masson, N.; Singleton, R.S.; Sekirnik, R.; Trudgian, D.C.; Ambrose, L.J.; Miranda, M.X.; Tian, Y.M.; Kessler, B.M.; Schofield, C.J.; Ratcliffe, P.J. The FIH hydroxylase is a cellular peroxide sensor that modulates HIF transcriptional activity. EMBO Rep. 2012, 13, 251–257. [Google Scholar] [CrossRef]
- Semenza, G.L. Oxygen sensing, hypoxia-inducible factors, and disease pathophysiology. Annu. Rev. Pathol. 2014, 9, 47–71. [Google Scholar] [CrossRef]
- Lu, S.C.; Mato, J.M. S-adenosylmethionine in liver health, injury, and cancer. Physiol. Rev. 2012, 92, 1515–1542. [Google Scholar] [CrossRef]
- Mahmoud, A.M.; Ali, M.M. Methyl Donor Micronutrients that Modify DNA Methylation and Cancer Outcome. Nutrients 2019, 11, 608. [Google Scholar] [CrossRef]
- Bedi, R.K.; Huang, D.; Eberle, S.A.; Wiedmer, L.; Śledź, P.; Caflisch, A. Small-Molecule Inhibitors of METTL3, the Major Human Epitranscriptomic Writer. ChemMedChem 2020, 15, 744–748. [Google Scholar] [CrossRef]
- Villa, E.; Sahu, U.; O′Hara, B.P.; Ali, E.S.; Helmin, K.A.; Asara, J.M.; Gao, P.; Singer, B.D.; Ben-Sahra, I. mTORC1 stimulates cell growth through SAM synthesis and m(6)A mRNA-dependent control of protein synthesis. Mol. Cell 2021, 81, 2076–2093.e2079. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Liu, J.; Huang, J.; Chang, G.; Roy, A.C.; Gao, Q.; Cheng, X.; Shen, X. Sodium butyrate attenuated iE-DAP induced inflammatory response in the mammary glands of dairy goats fed high-concentrate diet. J. Sci. Food Agric. 2021, 101, 1218–1227. [Google Scholar] [CrossRef] [PubMed]
- Martins, M.D.; Jiao, Y.; Larsson, L.; Almeida, L.O.; Garaicoa-Pazmino, C.; Le, J.M.; Squarize, C.H.; Inohara, N.; Giannobile, W.V.; Castilho, R.M. Epigenetic Modifications of Histones in Periodontal Disease. J. Dent. Res. 2016, 95, 215–222. [Google Scholar] [CrossRef] [PubMed]
- Wang, X.; Jin, H.; Jiang, S.; Xu, Y. MicroRNA-495 inhibits the high glucose-induced inflammation, differentiation and extracellular matrix accumulation of cardiac fibroblasts through downregulation of NOD1. Cell. Mol. Biol. Lett. 2018, 23, 23. [Google Scholar] [CrossRef]
- Chu, Q.; Bi, D.; Zheng, W.; Xu, T. MicroRNA negatively regulates NF-κB-mediated immune responses by targeting NOD1 in the teleost fish Miichthys miiuy. Sci. China Life Sci. 2021, 64, 803–815. [Google Scholar] [CrossRef]
- Cai, Y.; Yu, R.; Kong, Y.; Feng, Z.; Xu, Q. METTL3 regulates LPS-induced inflammatory response via the NOD1 signaling pathway. Cell. Signal. 2022, 93, 110283. [Google Scholar] [CrossRef]
- Yin, H.; Zhang, X.; Yang, P.; Zhang, X.; Peng, Y.; Li, D.; Yu, Y.; Wu, Y.; Wang, Y.; Zhang, J.; et al. RNA m6A methylation orchestrates cancer growth and metastasis via macrophage reprogramming. Nat. Commun. 2021, 12, 1394. [Google Scholar] [CrossRef]
- Wang, J.; Yan, S.; Lu, H.; Wang, S.; Xu, D. METTL3 Attenuates LPS-Induced Inflammatory Response in Macrophages via NF-κB Signaling Pathway. Mediat. Inflamm. 2019, 2019, 3120391. [Google Scholar] [CrossRef] [Green Version]
Gene Name 1 | Primer Sequence (5′-3′) | Gene Bank Number | |
---|---|---|---|
GAPDH | Forward | CGTCCCTGAGACACGATGGT | AF017079.1 |
Reverse | GCCTTGACTGTGCCGTGGAAT | ||
METTL3 | Forward | TGAGGCTCCTGGAAGCAAAG | XM_003128580.5 |
Reverse | TCTGTCAGGGTCCCATAGGG | ||
METTL14 | Forward | GTGGTTCTGGGGAGGGATTG | XM_003129231.6 |
Reverse | GAAGTCCCCGTCTGTGCTAC | ||
FTO | Forward | CCCCAGAAAATGCCGTACCT | KM232950.1 |
Reverse | ACCAGGGGTCTCTATGTCCC | ||
ALKBH5 | Forward | CGTGTCCGTGTCCTTCTTCA | XM_021067995.1 |
Reverse | AGGATGATGACAGCTCTGCG | ||
YTHDF1 | Forward | GCACCGCTCCATCAAGTACT | MN606020.1 |
Reverse | GCTGAAGAGCAGGTAGACGG | ||
YTHDF2 | Forward | CCAAGGGATGGCAGCACTAA | XM_005665152.3 |
Reverse | TTTGCCACAGGACCCTTGTT | ||
YTHDF3 | Forward | GAGCAAGGCATGACTGGACT | MN606021.1 |
Reverse | CTGGGGGCACACTATTGGTT | ||
IL-4 | Forward | ACACGACGGAGAAGGAAACC | NM_214123.1 |
Reverse | GTTCCTGTCAAGTCCGCTCA | ||
IL-10 | Forward | TCGGCCCAGTGAAGAGTTTC | NM_214041.1 |
Reverse | CGGCATTACGTCTTCCAGGT | ||
TNF-α | Forward | TCCAATGGCAGAGTGGGTATG | NM_214022.1 |
Reverse | AGCTGGTTGTCTTTCAGCTTCAC | ||
IL-1β | Forward | GCTGATGGCCCCAAAGAGAT | NM_001302388.2 |
Reverse | TGCCACAATCACAGACACCA | ||
IL-6 | Forward | AAATGTCGAGGCTGTGCAGA | NM_214399.1 |
Reverse | TCCACTCGTTCTGTGACTGC | ||
TLR4 | Forward | TCAGTTCTCACCTTCCTCCTG | GQ503242.1 |
Reverse | GTTCATTCCTCACCCAGTCTTC | ||
MyD88 | Forward | GATGGTAGCGGTTGTCTCTGAT | AB292176.1 |
Reverse | GATGCTGGGGAACTCTTTCTTC | ||
NOD1 | Forward | CTGTCGTCAACACCGATCCA | AB187219.1 |
Reverse | CCAGTTGGTGACGCAGCTT | ||
RIPK2 | Forward | CAGTGTCCAGTAAATCGCAGTTG | XM_003355027.1 |
Reverse | CAGGCTTCCGTCATCTGGTT | ||
NFKBIA | Forward | TGTTGGTGTCTTTGGGTGCT | NM_001005150.1 |
Reverse | GACATCAGCCCCACACTTCA | ||
NF-κB p65 | Forward | TACTGATGAGGACCTGGGGG | NM_001114281.1 |
Reverse | ATACACCCTGGTTCAGCAGC | ||
HIF-1α | Forward | AGCCAGATGATCGTGCAACT | NM_001123124.1 |
Reverse | CCATTGATTGCCCCAGGAGT | ||
MAT2A | Forward | GCACACAAGCTCAATGCCAA | NM_001167650.1 |
Reverse | ACTCTGATGGGAAGCACAGC | ||
iNOS | Forward | CCAGGCAATGGAGAGAAACT | NM_001143690.1 |
Reverse | CCGAACACAGCATACCTGAA | ||
CD86 | Forward | TGGTGCTGCCTCCTTGAAAA | L76099.1 |
Reverse | GGACACAGACGATGCTCACA | ||
IL-12 | Forward | GGACTGCGTCTTCACTTCCA | AF330213.1 |
Reverse | TGGAGTTAGCTGCAGACACG | ||
CD206 | Forward | GCCCAGACTGAAGACAGCAT | JN989538.1 |
Reverse | GGCATCTACCAGGCAGTTGT |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, M.; Zhuo, R.; Tao, S.; Liang, Y.; Liu, C.; Liu, Q.; Wang, T.; Zhong, X. M6A RNA Methylation Mediates NOD1/NF-kB Signaling Activation in the Liver of Piglets Challenged with Lipopolysaccharide. Antioxidants 2022, 11, 1954. https://doi.org/10.3390/antiox11101954
Xu M, Zhuo R, Tao S, Liang Y, Liu C, Liu Q, Wang T, Zhong X. M6A RNA Methylation Mediates NOD1/NF-kB Signaling Activation in the Liver of Piglets Challenged with Lipopolysaccharide. Antioxidants. 2022; 11(10):1954. https://doi.org/10.3390/antiox11101954
Chicago/Turabian StyleXu, Menghui, Ruhao Zhuo, Shengxiang Tao, Yaxu Liang, Chunru Liu, Qingyang Liu, Tian Wang, and Xiang Zhong. 2022. "M6A RNA Methylation Mediates NOD1/NF-kB Signaling Activation in the Liver of Piglets Challenged with Lipopolysaccharide" Antioxidants 11, no. 10: 1954. https://doi.org/10.3390/antiox11101954