Alleviation of Oral Exposure to Aflatoxin B1-Induced Renal Dysfunction, Oxidative Stress, and Cell Apoptosis in Mice Kidney by Curcumin
Abstract
:1. Introduction
2. Materials and Methods
2.1. Animals and Experimental Design
2.2. Sample Collection
2.3. Renal Function Determination
2.4. Hematoxylin–Eosin (H&E) Staining
2.5. Transmission Electron Microscopy (TEM) Observations
2.6. TUNEL Fluorescence Staining to Detect the Rate of Apoptosis
2.7. Antioxidant Levels in the Kidney
2.8. Quantitative Real-Time PCR
2.9. Western Blot Analysis
2.10. Statistical Analysis
3. Results
3.1. Curcumin Improves Growth Retardation and Reduction in Renal Index in Mice Treated with AFB1
3.2. Curcumin Ameliorates AFB1-Induced Renal Dysfunction in Mice
3.3. Evaluation of Pathological Slices of the Kidney
3.4. Ultrastructural Assessment of the Kidney
3.5. Curcumin Ameliorates AFB1-Induced Kidney Oxidative Damage
3.6. Curcumin Attenuates the AFB1-Induced Disturbance in Keap1–Nrf2 Antioxidant Signaling Pathway
3.7. Curcumin Protects against AFB1-Induced Renal Cell Apoptosis of Mice
3.8. Curcumin Restrains AFB1-Induced Mitochondrial Apoptosis Pathway in the Kidney
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Abdel-Daim, M.M.; Abdeen, A.; Jalouli, M.; Abdelkader, A.; Megahed, A.; Alkahtane, A.; Almeer, R.; Norah Alhoshani, N.M.; Al-Johani, N.S.; Alkahtani, S.; et al. Fucoidan supplementation modulates hepato-renal oxidative stress and DNA damage induced by aflatoxin B1 intoxication in rats. Sci. Total Environ. 2021, 768, 144781. [Google Scholar] [CrossRef] [PubMed]
- Xu, F.B.; Wang, P.Y.; Yao, Q.C.; Shao, B.; Yu, H.Y.; Yu, K.Y.; Li, Y.F. Lycopene alleviates AFB(1)-induced immunosuppression by inhibiting oxidative stress and apoptosis in the spleen of mice. Food Funct. 2019, 10, 3868–3879. [Google Scholar] [CrossRef] [PubMed]
- Huang, W.Y.; Cao, Z.; Yao, Q.C.; Ji, Q.; Zhang, J.; Li, Y.F. Mitochondrial damage are involved in Aflatoxin B-1-induced testicular damage and spermatogenesis disorder in mice. Sci. Total Environ. 2020, 701, 10. [Google Scholar] [CrossRef] [PubMed]
- Rushing, B.R.; Selim, M.I. Aflatoxin B1: A review on metabolism, toxicity, occurrence in food, occupational exposure, and detoxification methods. Food Chem. Toxicol. 2019, 124, 81–100. [Google Scholar] [CrossRef]
- Gallo, A.; Giuberti, G.; Frisvad, J.C.; Bertuzzi, T.; Nielsen, K.F. Review on mycotoxin issues in ruminants: Occurrence in forages, effects of mycotoxin ingestion on health status and animal performance and practical strategies to counteract their negative effects. Toxins 2015, 7, 3057–3111. [Google Scholar] [CrossRef]
- Mohsenzadeh, M.S.; Hedayati, N.; Riahi-Zanjani, B.; Karimi, G. Immunosuppression following dietary aflatoxin B1 exposure: A review of the existing evidence. Toxin Rev. 2016, 35, 121–127. [Google Scholar] [CrossRef]
- Zhao, Y.; Wang, T.; Li, P.; Chen, J.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. Bacillus amyloliquefaciens B10 can alleviate aflatoxin B1-induced kidney oxidative stress and apoptosis in mice. Ecotoxicol. Environ. Saf. 2021, 218, 112286. [Google Scholar] [CrossRef]
- Karamkhani, M.; Asilian-Mahabadi, H.; Daraei, B.; Seidkhani-Nahal, A.; Noori-Zadeh, A. Liver and kidney serum profile abnormalities in workers exposed to aflatoxin B1 in urban solid waste management centers. Environ. Monit. Assess. 2020, 192, 472. [Google Scholar] [CrossRef]
- Câmara, N.O.; Iseki, K.; Kramer, H.; Liu, Z.H.; Sharma, K. Kidney disease and obesity: Epidemiology, mechanisms and treatment. Nat. Rev. Nephrol. 2017, 13, 181–190. [Google Scholar] [CrossRef]
- Dlamini, N.Z.; Somboro, A.M.; Amoako, D.G.; Arhin, I.; Khumalo, H.M.; Khan, R.B. Toxicogenicity and mechanistic pathways of aflatoxin B1 induced renal injury. Environ. Toxicol. 2021, 36, 1857–1872. [Google Scholar] [CrossRef]
- Rajput, S.A.; Shaukat, A.; Wu, K.; Rajput, I.R.; Baloch, D.M.; Akhtar, R.W.; Raza, M.A.; Najda, A.; Rafal, P.; Albrakati, A.; et al. Luteolin alleviates aflatoxin B (1)-induced apoptosis and oxidative stress in the liver of mice through activation of Nrf2 signaling pathway. Antioxidants 2021, 10, 1268. [Google Scholar] [CrossRef] [PubMed]
- Umaya, S.R.; Vijayalakshmi, Y.C.; Sejian, V. Exploration of plant products and phytochemicals against aflatoxin toxicity in broiler chicken production: Present status. Toxicon 2021, 200, 55–68. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Liu, F.; Liu, M.; Zhou, X.; Wang, M.; Cao, K.; Jin, S.; Shan, A.; Feng, X. Curcumin mitigates aflatoxin B1-induced liver injury via regulating the NLRP3 inflammasome and Nrf2 signaling pathway. Food Chem. Toxicol. 2022, 161, 112823. [Google Scholar] [CrossRef] [PubMed]
- Trujillo, J.; Chirino, Y.I.; Molina-Jijón, E.; Andérica-Romero, A.C.; Tapia, E.; Pedraza-Chaverrí, J. Renoprotective effect of the antioxidant curcumin: Recent findings. Redox Biol. 2013, 1, 448–456. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Nimiya, Y.; Wang, W.; Du, Z.; Sukamtoh, E.; Zhu, J.; Decker, E.; Zhang, G. Redox modulation of curcumin stability: Redox active antioxidants increase chemical stability of curcumin. Mol. Nutr. Food Res. 2016, 60, 487–494. [Google Scholar] [CrossRef]
- Jin, S.; Yang, H.; Jiao, Y.; Pang, Q.; Wang, Y.; Wang, M.; Shan, A.; Feng, X. Dietary curcumin alleviated acute ileum damage of ducks (Anas platyrhynchos) induced by AFB1 through regulating Nrf2-ARE and NF-κB signaling pathways. Foods 2021, 10, 1370. [Google Scholar] [CrossRef]
- Peng, X.; Dai, C.; Liu, Q.; Li, J.; Qiu, J. Curcumin attenuates on carbon tetrachloride-induced acute liver injury in mice via modulation of the Nrf2/HO-1 and TGF-β1/Smad3 pathway. Molecules 2018, 23, 215. [Google Scholar] [CrossRef] [Green Version]
- Xu, G.; Gu, Y.; Yan, N.; Li, Y.; Sun, L.; Li, B. Curcumin functions as an anti-inflammatory and antioxidant agent on arsenic-induced hepatic and kidney injury by inhibiting MAPKs/NF-κB and activating Nrf2 pathways. Environ. Toxicol. 2021, 36, 2161–2173. [Google Scholar] [CrossRef]
- Longobardi, C.; Damiano, S.; Andretta, E.; Prisco, F.; Russo, V.; Pagnini, F.; Florio, S.; Ciarcia, R. Curcumin modulates nitrosative stress, inflammation, and DNA damage and protects against ochratoxin A-induced hepatotoxicity and nephrotoxicity in rats. Antioxidants 2021, 10, 1239. [Google Scholar] [CrossRef]
- Cheng, P.; Ishfaq, M.; Yu, H.; Yang, Y.; Li, S.; Li, X.; Fazlani, S.A.; Guo, W.; Zhang, X. Curcumin ameliorates duodenal toxicity of AFB1 in chicken through inducing P-glycoprotein and downregulating cytochrome P450 enzymes. Poultry Sci. 2020, 99, 7035–7045. [Google Scholar] [CrossRef]
- Li, S.; Liu, R.; Wei, G.; Guo, G.; Yu, H.; Zhang, Y.; Ishfaq, M.; Fazilani, S.A.; Zhang, X. Curcumin protects against Aflatoxin B1-induced liver injury in broilers via the modulation of long non-coding RNA expression. Ecotoxicol. Environ. Saf. 2021, 208, 111725. [Google Scholar] [CrossRef] [PubMed]
- Damiano, S.; Jarriyawattanachaikul, W.; Girolami, F.; Longobardi, C.; Nebbia, C.; Andretta, E.; Ciarcia, R. Curcumin supplementation protects broiler chickens against the renal oxidative stress induced by the dietary exposure to low levels of aflatoxin B1. Front. Vet. Sci. 2021, 8, 822227. [Google Scholar] [CrossRef] [PubMed]
- Verma, R.J.; Mathuria, N. Curcumin ameliorates aflatoxin-induced lipid-peroxidation in liver and kidney of mice. Acta Pol. Pharm. 2008, 65, 195–202. [Google Scholar] [PubMed]
- El-Mahalaway, A.M. Protective effect of curcumin against experimentally induced aflatoxicosis on the renal cortex of adult male albino rats: A histological and immunohisochemical study. Int. J. Clin. Exp. Pathol. 2015, 8, 6019–6030. [Google Scholar]
- Huang, W.; Cao, Z.; Zhang, J.; Ji, Q.; Li, Y. Aflatoxin B1 promotes autophagy associated with oxidative stress-related PI3K/AKT/mTOR signaling pathway in mice testis. Environ. Pollut. 2019, 255, 113317. [Google Scholar] [CrossRef]
- Xu, F.; Yu, K.; Yu, H.; Wang, P.; Song, M.; Xiu, C.; Li, Y. Lycopene relieves AFB1-induced liver injury through enhancing hepatic antioxidation and detoxification potential with Nrf2 activation. J. Funct. Foods 2017, 39, 215–224. [Google Scholar] [CrossRef]
- Dou, X.; Ma, Z.; Yan, D.; Gao, N.; Li, Z.; Li, Y.; Feng, X.; Meng, L.; Shan, A. Sodium butyrate alleviates intestinal injury and microbial flora disturbance induced by lipopolysaccharides in rats. Food Funct. 2022, 13, 1360. [Google Scholar] [CrossRef]
- Gao, N.; Dou, X.; Yin, T.; Yang, Y.; Yan, D.; Ma, Z.; Bi, C.; Shan, A. Tryptophan promotes intestinal immune defense through calcium-sensing receptor (CaSR)-Dependent metabolic pathways. J. Agr. Food Chem. 2021, 69, 13460–13473. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, Q.; Zhang, J.; Song, M.; Shao, B.; Han, Y.; Yang, X.; Li, Y. The protective effect of selenium on T-2-induced nephrotoxicity is related to the inhibition of ROS-mediated apoptosis in mice kidney. Biol. Trace Elem. Res. 2022, 200, 206–216. [Google Scholar] [CrossRef]
- Benkerroum, N. Chronic and acute toxicities of aflatoxins: Mechanisms of action. Int. J. Environ. Res. Publ. Health 2020, 17, 423. [Google Scholar] [CrossRef] [Green Version]
- Yang, H.; Wang, Y.; Yu, C.; Jiao, Y.; Zhang, R.; Jin, S.; Feng, X. Dietary Resveratrol Alleviates AFB1-Induced Ileum Damage in Ducks via the Nrf2 and NF-κB/NLRP3 Signaling Pathways and CYP1A1/2 Expressions. Agriculture 2022, 12, 54. [Google Scholar] [CrossRef]
- Zhao, J.; Wang, Z.; Chen, Y.; Peng, D.; Xianyu, Y. Horseradish peroxidase-catalyzed formation of polydopamine for ultra-sensitive magnetic relaxation sensing of aflatoxin B1. J. Hazard. Mater. 2021, 419, 126403. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Xing, L.; Zhang, M.; Wang, J.; Zheng, N. The toxic effects of aflatoxin B1 and aflatoxin M1 on kidney through regulating L-Proline and downstream apoptosis. BioMed Res. Int. 2018, 2018, 9074861. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, X.; Lv, Z.; Chen, J.; Nepovimova, E.; Long, M.; Wu, W.; Kuca, K. Bacillus amyloliquefaciens B10 can alleviate liver apoptosis and oxidative stress induced by aflatoxin B1. Food Chem. Toxicol. 2021, 151, 112124. [Google Scholar] [CrossRef] [PubMed]
- Huang, B.; Chen, Q.; Wang, L.; Gao, X.; Zhu, W.; Mu, P.; Deng, Y. Aflatoxin B1 induces neurotoxicity through reactive oxygen species generation, DNA damage, apoptosis, and S-phase cell cycle arrest. Int. J. Mol. Sci. 2020, 21, 6517. [Google Scholar] [CrossRef] [PubMed]
- Kuhad, A.; Pilkhwal, S.; Sharma, S.; Tirkey, N.; Chopra, K. Effect of curcumin on inflammation and oxidative stress in cisplatin-induced experimental nephrotoxicity. J. Agr. Food Chem. 2007, 55, 10150–10155. [Google Scholar] [CrossRef]
- Wang, Y.; Song, M.; Wang, Q.; Guo, C.; Zhang, J.; Zhang, X.; Cui, Y.; Cao, Z.; Li, Y. PINK1/Parkin-mediated mitophagy is activated to protect against AFB1-induced kidney damage in mice. Chem-Biol. Interact. 2022, 358, 109884. [Google Scholar] [CrossRef]
- Corcuera, L.A.; Ibáñez-Vea, M.; Vettorazzi, A.; González-Peñas, E.; Cerain, A.L. Validation of a UHPLC-FLD analytical method for the simultaneous quantification of aflatoxin B1 and ochratoxin a in rat plasma, liver and kidney. J. Chromatogr. B 2011, 879, 2733–2740. [Google Scholar] [CrossRef]
- Dou, X.; Yan, D.; Ma, Z.; Gao, N.; Shan, A. Sodium butyrate alleviates LPS-induced kidney injury via inhibiting TLR2/4 to regulate rBD2 expression. J. Food Biochem. 2022, 00, e14126. [Google Scholar] [CrossRef]
- Gholami-Ahangaran, M.; Rangsaz, N.; Azizi, S. Evaluation of turmeric (Curcuma longa) effect on biochemical and pathological parameters of liver and kidney in chicken aflatoxicosis. Pharm. Biol. 2016, 54, 780–787. [Google Scholar] [CrossRef] [Green Version]
- Salem, R.; El-Habashi, N.; Fadl, S.E.; Sakr, O.A.; Elbialy, Z.I. Effect of probiotic supplement on aflatoxicosis and gene expression in the liver of broiler chicken. Environ. Toxicol. Phar. 2018, 60, 118–127. [Google Scholar] [CrossRef] [PubMed]
- Zabiulla, I.; Malathi, V.; Swamy, H.V.L.N.; Naik, J.; Pineda, L.; Han, Y. The Efficacy of a smectite-based mycotoxin binder in reducing alatoxin B1 toxicity on performance, health and histopathology of broiler chickens. Toxins 2021, 13, 856. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.F.; Su, P.K.; Wang, L.J.; Zheng, H.Q.; Bai, X.F.; Li, P.; Meng, X.P.; Yang, J.Y. T-2 toxin induces apoptosis via the Bax-dependent caspase-3 activation in mouse primary Leydig cells. Toxicol. Mech. Methods 2018, 28, 23–28. [Google Scholar] [CrossRef] [PubMed]
- Abdel-Wahhab, M.A.; Salman, A.S.; Ibrahim, M.I.; El-Kady, A.A.; Abdel-Aziem, S.H.; Hassan, N.S.; Waly, A.I. Curcumin nanoparticles loaded hydrogels protects against aflatoxin B1-induced genotoxicity in rat liver. Food Chem. Toxicol. 2016, 94, 159–171. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Feng, X.; Hu, X.; Sha, J.; Li, B.; Zhang, H.; Fan, H. Dexmedetomidine ameliorates acute stress-induced kidney injury by attenuating oxidative stress and apoptosis through inhibition of the ROS/JNK signaling pathway. Oxid. Med. Cell. Longev. 2018, 2018, 4035310. [Google Scholar] [CrossRef] [PubMed]
- Dumitrescu, L.; Popescu-Olaru, I.; Cozma, L.; Tulbă, D.; Hinescu, M.E.; Ceafalan, L.C.; Gherghiceanu, M.; Popescu, B.O. Oxidative stress and the microbiota-gut-brain axis. Oxid. Med. Cell. Longev. 2018, 2018, 2406594. [Google Scholar] [CrossRef] [Green Version]
- Bai, K.; Huang, Q.; Zhang, J.; He, J.; Zhang, L.; Wang, T. Supplemental effects of probiotic Bacillus subtilis fmbJ on growth performance, antioxidant capacity, and meat quality of broiler chickens. Poultry Sci. 2017, 96, 74–82. [Google Scholar] [CrossRef]
- Marin, D.E.; Pistol, G.C.; Gras, M.; Palade, M.; Taranu, I. A comparison between the effects of ochratoxin A and aristolochic acid on the inflammation and oxidative stress in the liver and kidney of weanling piglets. Naunyn-Schmiedeberg’s Arch. Pharmacol. 2018, 391, 1147–1156. [Google Scholar] [CrossRef]
- Khynriam, D.; Prasad, S.B. Changes in glutathione-related enzymes in tumor-bearing mice after cisplatin treatment. Cell Biol. Toxicol. 2002, 18, 349–358. [Google Scholar] [CrossRef]
- Li, S.; Tan, H.Y.; Wang, N.; Zhang, Z.J.; Lao, L.; Wong, C.W.; Feng, Y. The role of oxidative stress and antioxidants in liver diseases. Int. J. Mol. Sci. 2015, 16, 26087–26124. [Google Scholar] [CrossRef] [Green Version]
- Waly, M.I.; Ali, B.H.; Nemmar, A. Acute effects of diesel exhaust particles and cisplatin on oxidative stress in cultured human kidney (HEK 293) cells, and the influence of curcumin thereon. Toxicol. Vitro 2013, 27, 2299–2304. [Google Scholar] [CrossRef] [PubMed]
- Yamamoto, M.; Kensler, T.W.; Motohashi, H. The Keap1-Nrf2 System: A thiol-based sensor-effector apparatus for maintaining redox homeostasis. Physiol. Rev. 2018, 98, 1169–1203. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ni, Y.H.; Huo, L.J.; Li, T.T. Antioxidant axis Nrf2-Keap1-ARE in inhibition of alcoholic liver fibrosis by IL-22. World J. Gastroenterol. 2017, 23, 2002–2011. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Wang, Y.; Jin, S.; Pang, Q.; Shan, A.; Feng, X. Dietary resveratrol alleviated lipopolysaccharide-induced ileitis through Nrf2 and NF-κB signalling pathways in ducks (Anas platyrhynchos). J. Anim. Physiol. Anim. Nutr. 2021. Available online: https://onlinelibrary.wiley.com/doi/abs/10.1111/jpn.13657 (accessed on 2 November 2021). [CrossRef] [PubMed]
- Wang, H.; Muhammad, I.; Li, W.; Sun, X.; Cheng, P.; Zhang, X. Sensitivity of Arbor Acres broilers and chemoprevention of aflatoxin B(1)-induced liver injury by curcumin, a natural potent inducer of phase-II enzymes and Nrf2. Environ. Toxicol. Pharmacol. 2018, 59, 94–104. [Google Scholar] [CrossRef]
- Guo, Y.; Balasubramanian, B.; Zhao, Z.H.; Liu, W.C. Marine algal polysaccharides alleviate aflatoxin B1-induced bursa of Fabricius injury by regulating redox and apoptotic signaling pathway in broilers. Poultry Sci. 2021, 100, 844–857. [Google Scholar] [CrossRef]
- Liu, Y.; Wang, W. Aflatoxin B1 impairs mitochondrial functions, activates ROS generation, induces apoptosis and involves Nrf2 signal pathway in primary broiler hepatocytes. Anim. Sci. J. 2016, 87, 1490–1500. [Google Scholar] [CrossRef]
- Wang, W.J.; Xu, Z.L.; Yu, C.; Xu, X.H. Effects of aflatoxin B1 on mitochondrial respiration, ROS generation and apoptosis in broiler cardiomyocytes. Anim. Sci. J. 2017, 88, 1561–1568. [Google Scholar] [CrossRef]
- Farombi, E.O.; Shrotriya, S.; Na, H.K.; Kim, S.H.; Surh, Y.J. Curcumin attenuates dimethylnitrosamine-induced liver injury in rats through Nrf2-mediated induction of heme oxygenase-1. Food Chem. Toxicol. 2008, 46, 1279–1287. [Google Scholar] [CrossRef]
- Zhang, X.; Wang, Y.; Yang, X.; Liu, M.; Huang, W.; Zhang, J.; Song, M.; Shao, B.; Li, Y. The nephrotoxicity of T-2 toxin in mice caused by oxidative stress-mediated apoptosis is related to Nrf2 pathway. Food Chem. Toxicol. 2021, 149, 112027. [Google Scholar] [CrossRef]
- Green, D.R.; Reed, J.C. Mitochondria and apoptosis. Science 1998, 281, 1309–1312. [Google Scholar] [CrossRef] [PubMed]
- Twiddy, D.; Brown, D.G.; Adrain, C.; Jukes, R.; Martin, S.J.; Cohen, G.M.; MacFarlane, M.; Cain, K. Pro-apoptotic proteins released from the mitochondria regulate the protein composition and caspase-processing activity of the native Apaf-1/caspase-9 apoptosome complex. J. Biol. Chem. 2004, 279, 19665–19682. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chen, K.; Shu, G.; Peng, X.; Fang, J.; Cui, H.; Chen, J.; Wang, F.; Chen, Z.; Zuo, Z.; Deng, J.; et al. Protective role of sodium selenite on histopathological lesions, decreased T-cell subsets and increased apoptosis of thymus in broilers intoxicated with aflatoxin B1. Food Chem. Toxicol. 2013, 59, 446–454. [Google Scholar] [CrossRef] [PubMed]
Transcripts | Primer Sequence (5′-3′) | Product Size (bp) | Accession No. |
---|---|---|---|
Keap1 | F: GACTGGGTCAAATACGACTGC | 165 | NM_001110307.1 |
R: GAATATCTGCACCAGGTAGTCC | 165 | ||
Nrf2 | F: AAGCACAGCCAGCACATTCTCC | 130 | NM_010902.4 |
R: TGACCAGGACTCACGGGAACTTC | 130 | ||
SOD1 | F: TGTCCATTGAAGATCGTGTGAT | 85 | NM_011434.1 |
R: TCATCTTGTTTCTCATGGACCA | 85 | ||
GCLC | F: CTATCTGCCCAATTGTTATGGC | 120 | NM_010295.2 |
R: CCTCCCGTGTTCTATCATCTAC | 120 | ||
GCLM | F: CTTGGAGCATTTACAGCCTTAC | 226 | NM_008129.4 |
R: GTGAGTCAGTAGCTGTATGTCA | 226 | ||
GSS | F: CTGATGCTAGAGAGATCTCGTG | 186 | NM_001291111.1 |
R: TTCACCCATGTCCAGTGAATAG | 186 | ||
CAT | F: CACCTTCAAGTTGGTTAATGCA | 199 | NM_009804.2 |
R: CATGACCTGGATGTAAAACGTC | 199 | ||
NQO-1 | F: GAAGACATCATTCAACTACGCC | 179 | NM_008706.5 |
R: GAGATGACTCGGAAGGATACTG | 179 | ||
Caspase-3 | F: GAAACTCTTCATCATTCAGGCC | 250 | NM_010295.2 |
R: GCGAGTGAGAATGTGCATAAAT | 250 | ||
Caspase-9 | F: TGTGAATATCTTCAACGGGAGC | 249 | NM_001277932.1 |
R: GAGTAGGACACAAGGATGTCAC | 249 | ||
Bax | F: TTGCCCTCTTCTACTTTGCTAG | 81 | NM_007527.3 |
R: CCATGATGGTTCTGATCAGCTC | 81 | ||
Bcl-2 | F: GATGACTTCTCTCGTCGCTAC | 156 | NM_009741.5 |
R: GAACTCAAAGAAGGCCACAATC | 156 | ||
β-actin | F: CTACCTCATGAAGATCCTGACC | 90 | NM_007393.5 |
R: CACAGCTTCTCTTTGATGTCAC | 90 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Liu, F.; Zhou, X.; Liu, M.; Zang, H.; Liu, X.; Shan, A.; Feng, X. Alleviation of Oral Exposure to Aflatoxin B1-Induced Renal Dysfunction, Oxidative Stress, and Cell Apoptosis in Mice Kidney by Curcumin. Antioxidants 2022, 11, 1082. https://doi.org/10.3390/antiox11061082
Wang Y, Liu F, Zhou X, Liu M, Zang H, Liu X, Shan A, Feng X. Alleviation of Oral Exposure to Aflatoxin B1-Induced Renal Dysfunction, Oxidative Stress, and Cell Apoptosis in Mice Kidney by Curcumin. Antioxidants. 2022; 11(6):1082. https://doi.org/10.3390/antiox11061082
Chicago/Turabian StyleWang, Yingjie, Fangju Liu, Xin Zhou, Mengru Liu, Haoran Zang, Xiao Liu, Anshan Shan, and Xingjun Feng. 2022. "Alleviation of Oral Exposure to Aflatoxin B1-Induced Renal Dysfunction, Oxidative Stress, and Cell Apoptosis in Mice Kidney by Curcumin" Antioxidants 11, no. 6: 1082. https://doi.org/10.3390/antiox11061082