Effect of Four Functional Feed Additives on Growth, Serum Biochemistry, Antioxidant Capacity, Gene Expressions, Histomorphology, Digestive Enzyme Activities and Disease Resistance in Juvenile Olive Flounder, Paralichthys olivaceus
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethics Statement
2.2. Experimental Diets
2.3. Experimental Fish and Feeding Trial
2.4. Sample Collection and Analysis
2.5. Non-Specific Immune Response Analysis
2.6. Bacterial Infection Test
2.7. Real-Time PCR
2.8. Histology
2.9. Digestive Enzyme
2.10. Statistical Analysis
3. Results
3.1. Growth Performance
3.2. Whole-Body Proximate Composition
3.3. Hematological Parameters
3.4. Non-Specific Immune Responses
3.5. Growth- and Immune-Related Gene Expressions
3.6. Histology
3.7. Digestive Enzyme
3.8. Challenge Test
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Food and Agriculture Organization (FAO). Global Aquaculture Production (Online Query). 2020. Available online: http://www.fao.org/fishery/statistics/global-aquaculture-production/en (accessed on 7 June 2023).
- Galkanda-Arachchige, H.S.; Wilson, A.E.; Davis, D.A. Success of fishmeal replacement through poultry by-product meal in aquaculture feed formulations: A meta-analysis. Rev. Aquacult. 2020, 12, 1624–1636. [Google Scholar] [CrossRef]
- Young, N.; Brattland, C.; Digiovanni, C.; Hersoug, B.; Johnsen, J.P.; Karlsen, K.M.; Kvalvik, I.; Olofsson, E.; Simonsen, K.; Solås, A.M.; et al. Limitations to growth: Social-ecological challenges to aquaculture development in five wealthy nations. Mar. Policy 2019, 104, 216–224. [Google Scholar]
- Bush, S.R.; Marschke, M.J. Making social sense of aquaculture transitions. Ecol. Soc. 2014, 19, 3. [Google Scholar] [CrossRef] [Green Version]
- Young, N.; Matthews, R. The Aquaculture Controversy in Canada: Activism, Policy, and Contested Science; UBC Press: Vancouver, BC, Canada, 2011. [Google Scholar]
- Mente, E.; Coutteau, P.; Houlihan, D.; Davidson, I.; Sorgeloos, P. Protein turnover, amino acid profile and amino acid flux in juvenile shrimp Litopenaeus vannamei: Effects of dietary protein source. J. Exp. Biol. 2002, 205, 3107–3122. [Google Scholar]
- Dawson, M.R.; Alam, M.S.; Watanabe, W.O.; Carroll, P.M.; Seaton, P.J. Evaluation of poultry by-product meal as an alternative to fish meal in the diet of juvenile black sea bass reared in a recirculating aquaculture system. N. Am. J. Aquacult. 2018, 80, 74–87. [Google Scholar] [CrossRef]
- Tacon, A.G.; Metian, M.; Hasan, M.R. Feed Ingredients and Fertilizers for Farmed Aquatic Animals: Sources and Composition; Food and Agriculture Organization of the United Nations (FAO): Rome, Italy, 2009. [Google Scholar]
- Tacon, A.G.; Metian, M. Feed matters: Satisfying the feed demand of aquaculture. Rev. Fish. Sci. Aquacult. 2015, 23, 1–10. [Google Scholar] [CrossRef]
- Hardy, R.W. Utilization of plant proteins in fish diets: Effects of global demand and supplies of fishmeal. Aquacult. Res. 2010, 41, 770–776. [Google Scholar] [CrossRef]
- Han, D.; Shan, X.; Zhang, W.; Chen, Y.; Wang, Q.; Li, Z.; Zhang, G.; Xu, P.; Li, J.; Xie, S. A revisit to fishmeal usage and associated consequences in Chinese aquaculture. Rev. Aquacult. 2018, 10, 493–507. [Google Scholar] [CrossRef]
- Oliva-Teles, A.; Enes, P.; Peres, H. Replacing fishmeal and fish oil in industrial aquafeeds for carnivorous fish. In Feed and Feeding Practices in Aquaculture; Woodhead Publishing: Cambridge, UK, 2015; pp. 203–233. [Google Scholar]
- Liu, T.; Han, T.; Wang, J.; Liu, T.; Bian, P.; Wang, Y.; Cai, X. Effects of replacing fish meal with soybean meal on growth performance, feed utilization and physiological status of juvenile redlip mullet Liza haematocheila. Aquacult. Rep. 2021, 20, 100756. [Google Scholar] [CrossRef]
- Nandakumar, S.; Ambasankar, K.; Ali, S.S.R.; Syamadayal, J.; Vasagam, K. Replacement of fish meal with corn gluten meal in feeds for Asian seabass (Lates calcarifer). Aquacult. Int. 2017, 25, 1495–1505. [Google Scholar] [CrossRef]
- Lin, H.; Deng, Y.; Zhu, D.; Yang, Q.; Zhou, X.; Tan, B.; Feng, L.; Chi, S. Effects of partially replacing fishmeal with corn gluten meal on growth, feed utilization, digestive enzyme activity, and apparent nutrient digestibility for juvenile white shrimp, Litopenaeus vannamei. Front. Vet. Sci. 2023, 10, 1162599. [Google Scholar] [CrossRef]
- Moutinho, S.; Martinez-Llorens, S.; Tomas-Vidal, A.; Jover-Cerda, M.; Oliva-Teles, A.; Peres, H. Meat and bone meal as partial replacement for fish meal in diets for gilthead seabream (Sparus aurata) juveniles: Growth, feed efficiency, amino acid utilization, and economic efficiency. Aquaculture 2017, 468, 271–277. [Google Scholar] [CrossRef]
- Davis, D.A.; Arnold, C. Replacement of fish meal in practical diets for the Pacific white shrimp, Litopenaeus vannamei. Aquaculture 2000, 185, 291–298. [Google Scholar] [CrossRef]
- NRC (National Research Council). Nutrient Requirements of Fish and Shrimp; National Academies Press: Washington, DC, USA, 2011.
- Hossain, M.S.; Small, B.C.; Kumar, V.; Hardy, R. Utilization of functional feed additives to produce cost-effective, ecofriendly aquafeeds high in plant-based ingredients. Rev. Aquacult. 2023, 1–33. [Google Scholar] [CrossRef]
- Bai, S.C.; Katya, K.; Yun, H. Additives in aquafeed: An overview. In Feed and Feeding Practices in Aquaculture; Woodhead Publishing: Cambridge, UK, 2015; pp. 171–202. [Google Scholar]
- Bae, J.; Hamidoghli, A.; Won, S.; Choi, W.; Lim, S.G.; Kim, K.W.; Bai, S.C. Evaluation of seven different functional feed additives in a low fish meal diet for olive flounder, Paralichthys olivaceus. Aquaculture 2020, 525, 735333. [Google Scholar] [CrossRef]
- Wang, X.; Luo, H.; Zheng, Y.; Wang, D.; Wang, Y.; Zhang, W.; Chen, Z.; Chen, X.; Shao, J. Effects of poultry by-product meal replacing fish meal on growth performance, feed utilization, intestinal morphology and microbiota communities in juvenile large yellow croaker (Larimichthys crocea). Aquacult. Rep. 2023, 30, 101547. [Google Scholar] [CrossRef]
- Ge, H.; Wang, Q.; Chen, H.; Liu, G.; Pan, Y.; Chen, J.; Zhang, W.; Mai, K. Effects of antimicrobial peptide APSH-07 on the growth performance, anti-oxidation responses, stress resistance and intestine microbiota in large yellow croaker Larimichthys crocea. Aquacult. Nutri. 2020, 26, 715–726. [Google Scholar] [CrossRef]
- Zasloff, M. Antimicrobial peptides of multicellular organisms. Nature 2002, 415, 389–395. [Google Scholar] [CrossRef]
- Kim, S.-K.; Takeuchi, T.; Yokoyama, M.; Murata, Y.; Kaneniwa, M.; Sakakura, Y. Effect of dietary taurine levels on growth and feeding behavior of juvenile Japanese flounder Paralichthys olivaceus. Aquaculture 2005, 250, 765–774. [Google Scholar] [CrossRef]
- Salze, G.P.; Davis, D.A. Taurine: A critical nutrient for future fish feeds. Aquaculture 2015, 437, 215–229. [Google Scholar] [CrossRef]
- Jo, S.-J.; Park, S.-J.; Lee, S.-B.; Tran, B.T.; Kim, J.S.; Song, J.W.; Lee, B.-J.; Hur, S.-W.; Nam, T.-J.; Lee, K.-J.; et al. Effect of low-fishmeal diets on some digestive physiological responses of juvenile and growing olive flounder (Paralichthys olivaceus) fed at an industrial-scale fish farm. Aquacult. Rep. 2021, 21, 100904. [Google Scholar] [CrossRef]
- Gaylord, T.G.; Teague, A.M.; Barrows, F.T. Taurine supplementation of all-plant protein diets for rainbow trout (Oncorhynchus mykiss). J. World Aquacult. Soc. 2006, 37, 509–517. [Google Scholar] [CrossRef]
- Lall, S.P.; Kaushik, S.J. Nutrition and Metabolism of Minerals in Fish. Animals 2021, 11, 2711. [Google Scholar] [CrossRef]
- Prabhu, P.A.J.; Geurden, I.; Fontagne-Dicharry, S.; Veron, V.; Larroquet, L.; Mariojouls, C.; Schrama, J.W.; Kaushik, S.J. Responses in Micro-Mineral Metabolism in Rainbow Trout to Change in Dietary Ingredient Composition and Inclusion of a Micro-Mineral Premix. PLoS ONE 2016, 11, e0149378. [Google Scholar]
- Won, S.; Moniruzzaman, M.; Lee, S.; Hong, J.; Park, J.-K.; Kim, S.; Bai, S.C. Evaluation of dietary natural mineral materials as an antibiotic replacer on growth performance, non-specific immune responses and disease resistance in rainbow trout, Oncorhynchus mykiss. Aquac. Res. 2017, 48, 4735–4747. [Google Scholar] [CrossRef]
- Gil, A. Modulation of the immune response mediated by dietary nucleotides. Eur. J. Clin. Nutr. 2002, 56 (Suppl. 3), S1–S4. [Google Scholar] [CrossRef]
- Gatlin, D.M., III; Li, P. Nucleotides. In Dietary Supplements for the Health and Quality of Cultured Fish; Nakagawa, H., Sato, M., Gatlin, D.M., III, Eds.; CABI: Oxford, UK, 2007; pp. 193–209. [Google Scholar]
- Hossain, M.S.; Koshio, S.; Kestemont, P. Recent advances of nucleotide nutrition research in aquaculture: A review. Rev. Aquacult. 2020, 12, 1028–1053. [Google Scholar] [CrossRef]
- Bae, J.; Song, Y.; Moniruzzaman, M.; Hamidoghli, A.; Lee, S.; Je, H.; Choi, W.; Min, T.; Bai, S.C. Evaluation of Dietary Soluble Extract Hydrolysates with or without Supplementation of Inosine Monophosphate Based on Growth, Hematology, Non-Specific Immune Responses and Disease Resistance in Juvenile Nile Tilapia Oreochromis niloticus. Animals 2021, 11, 1107. [Google Scholar] [CrossRef]
- Choi, W.; Moniruzzaman, M.; Bae, J.; Hamidoghli, A.; Lee, S.; Choi, Y.-H.; Min, T.; Bai, S.C. Evaluation of Dietary Probiotic Bacteria and Processed Yeast (GroPro-Aqua) as the Alternative of Antibiotics in Juvenile Olive Flounder Paralichthys olivaceus. Antibiotics 2022, 11, 129. [Google Scholar] [CrossRef]
- Tacon, A.G.J.; Metian, M. Global overview on the use of fish meal and fish oil in industrially compounded aquafeeds: Trends and future prospects. Aquaculture 2008, 285, 146–158. [Google Scholar] [CrossRef]
- AOAC Official Methods of Analysis, 16th ed.; Association of Official Analytical Chemists: Arlington, VA, USA, 1995.
- Quade, M.J.; Roth, J.A. A rapid, direct assay to measure degranulation of bovine neutrophil primary granules. Vet. Immunol. Immunopathol. 1997, 58, 239–248. [Google Scholar] [CrossRef]
- Kaplan, E.L.; Meier, P. Nonparametric estimation from incomplete observations. J. Am. Stat. Assoc. 1958, 53, 457–481. [Google Scholar] [CrossRef]
- Xiong, J.; Jin, M.; Yuan, Y.; Luo, J.X.; Lu, Y.; Zhou, Q.C.; Liang, C.; Tan, Z.L. Dietary nucleotide-rich yeast supplementation improves growth, innate immunity and intestinal morphology of Pacific white shrimp (Litopenaeus vannamei). Aquac. Nutr. 2018, 24, 1425–1435. [Google Scholar] [CrossRef]
- Li, P.; Gatlin, D.M., III. Nucleotide nutrition in fish: Current knowledge and future applications. Aquaculture 2006, 251, 141–152. [Google Scholar] [CrossRef]
- Kim, S.K.; Matsunari, H.; Takeuchi, T.; Yokoyama, M.; Murata, Y.; Ishihara, K. Effect of different dietary taurine levels on the conjugated bile acid composition and growth performance of juvenile and fingerling Japanese flounder Paralichthys olivaceus. Aquaculture 2007, 273, 595–601. [Google Scholar] [CrossRef]
- Fang, Y.Z.; Yang, S.; Wu, G.Y. Free radicals, antioxidants, and nutrition. Nutrition 2002, 18, 872–879. [Google Scholar] [CrossRef]
- Higuchi, M.; Celino, F.T.; Tamai, A.; Miura, C.; Miura, T. The synthesis and role of taurine in the Japanese eel testis. Amino Acids 2012, 43, 773–781. [Google Scholar] [CrossRef]
- Kim, J.M.; Malintha, G.H.T.; Gunathilaka, G.L.B.E.; Lee, C.; Kim, M.G.; Lee, B.J.; Kim, J.D.; Lee, K.J. Taurine supplementation in diet for olive flounder at low water temperature. Fish. Aquat. Sci. 2017, 20, 20. [Google Scholar] [CrossRef] [Green Version]
- Han, Y.; Koshio, S.; Jiang, Z.; Ren, T.; Ishikawa, M.; Yokoyama, S.; Gao, J. Interactive effects of dietary taurine and glutamine on growth performance, blood parameters and oxidative status of Japanese flounder Paralichthys olivaceus. Aquaculture 2014, 434, 348–354. [Google Scholar] [CrossRef]
- Saurabh, S.; Sahoo, P.K. Lysozyme: An important defence molecule of fish innate immune system. Aquac. Res. 2008, 39, 223–239. [Google Scholar] [CrossRef]
- Ren, T.; Koshio, S.; Ishikawa, M.; Yokoyama, S.; Micheal, F.R.; Uyan, O.; Tung, H.T. Influence of dietary vitamin C and bovine lactoferrin on blood chemistry and nonspecific immune responses of Japanese eel, Anguilla japonica. Aquaculture 2007, 267, 31–37. [Google Scholar] [CrossRef]
- Zhou, J.; Song, X.L.; Huang, J.; Wang, X.H. Effects of dietary supplementation of A3α-peptidoglycan on innate immune responses and defense activity of Japanese flounder (Paralichthys olivaceus). Aquaculture 2006, 251, 172–181. [Google Scholar] [CrossRef]
- Owens, B.; McCracken, K.J. A comparison of the effects of different yeast products and antibiotic on broiler performance. Br. Poult. Sci. 2007, 48, 49–54. [Google Scholar] [CrossRef]
- Savage, T.F.; Zakrzewska, E.I. The performance of male turkeys fed a starter diet containing mannanoligosaccharide supplementation (Biomos) from day-old to eight weeks of age. In Proceedings of the Alltech’s 12th Annual Symposium on the Biotechnological Feed Industry; Lyons, T.P., Jacques, K.A., Eds.; Nottingham University Press: Nottingham, UK, 1996; pp. 47–54. [Google Scholar]
- Solis de los Santos, F.; Donoghue, A.M.; Farnell, M.B.; Huff, G.R.; Huff, W.E.; Donoghue, D.J. Gastrointestinal maturation is accelerated in turkey poults supplemented with a mannan-oligosaccharide yeast extract (Alphamune). Poult. Sci. 2007, 86, 921–930. [Google Scholar] [CrossRef]
- Gao, J.; Zhang, H.J.; Yu, S.H.; Wu, S.G.; Yoon, I.; Quigley, J.; Gao, Y.P.; Qi, G.H. Effects of yeast culture in broiler diets on performance and immunomodulatory functions. Poult. Sci. 2008, 87, 1377–1384. [Google Scholar] [CrossRef]
- Greenwood, F.C.; Landon, J. Growth hormone secretion in response to stress in man. Nature 1966, 210, 540–541. [Google Scholar] [CrossRef]
- Bornfeldt, K.E.; Arnqvist, H.J.; Dahlkvist, H.H.; Skottner, A.; Wikberg, J.E. Receptors for insulin-like growth factor-I in plasma membranes isolated from bovine mesenteric arteries. Acta Endocrinol. 1988, 117, 428–434. [Google Scholar] [CrossRef]
- Clemmons, D.R.; Busby, W.; Clarke, J.B.; Parker, A.; Duan, C.; Nam, T.J. Modifications of insulin-like growth factor 254 binding proteins and their role in controlling IGF actions. Endocr. J. 1998, 45, S1–S8. [Google Scholar] [CrossRef] [Green Version]
- Thanissery, R.; McReynolds, J.L.; Conner, D.E.; Macklin, K.S.; Curtis, P.A.; Fasina, Y.O. Evaluation of the efficacy of yeast extract in reducing intestinal Clostridium perfringens levels in broiler chickens. Poult. Sci. 2010, 89, 2380–2388. [Google Scholar] [CrossRef]
- Cha, B.K.; Chang, M.W.; Jung, Y.K.; Kim, K.H. Effects of Eucalyptus and Geranium on Production of IL-2 and IL-4 in Mouse Splenocytes. J. Life Sci. 2010, 16, 162–167. [Google Scholar]
- Ryu, H.S.; Kim, K.O.; Kim, H.S. Effects of plant water extract Codonopsis lanceolata on mouse immune cell activation ex vivo. Korean J. Nutr. 2009, 42, 207–212. [Google Scholar] [CrossRef] [Green Version]
- Kim, H.J.; Choi, J.L.; Kim, D.J.; Kim, J.H.; Chun, B.S.; Ahn, D.H.; Yook, H.S.; Byun, M.W.; Kim, M.J.; Shin, M.G.; et al. Effect of ionizing radiation on the physiological activities of ethanol extract from Hizikia fusiformis cooking drips. Appl. Rad. Iso. 2009, 67, 1509–1512. [Google Scholar] [CrossRef]
- Song, J.W.; Jang, J.W.; Kim, S.S.; Oh, D.H.; Cha, J.H.; Lee, K.J. Effect of Dietary Supplementation with Alga (Hizikia fusiformis and Ecklonia cava) on the Non-specific Immune Responses of Parrot Fish Oplegnathus fasciatus. Korean J. Fish. Aquat. Sci. 2011, 44, 332–338. [Google Scholar]
- Siddik, M.A.B.; Foysal, M.J.; Fotedar, R.; Francis, D.S.; Gupta, S.K. Probiotic yeast Saccharomyces cerevisiae coupled with Lactobacillus casei modulates physiological performance and promotes gut microbiota in juvenile barramundi, Lates calcarifer. Aquaculture 2022, 546, 737346. [Google Scholar] [CrossRef]
Ingredients | Percentage (%) |
---|---|
Fish meal, sardine 1 | 22.5 |
Fish meal, anchovy 1 | 22.5 |
Soybean meal | 12.0 |
Starch 2 | 3.8 |
Wheat gluten meal 2 | 4.5 |
Soy protein concentrate | 5.5 |
Tankage meal | 8.0 |
Poultry by-product meal | 4.5 |
Wheat flour | 7.0 |
Fish oil 3 | 4.3 |
Vitamin premix 4 | 1.2 |
Mineral premix 5 | 1.2 |
Others 6 | 3.0 |
Proximate analysis (% of dry matter basis) | |
Moisture | 8.2 |
Crude protein | 54.8 |
Crude lipid | 9.4 |
Crude ash | 10.4 |
Item | Diets (%) | ||||||||
---|---|---|---|---|---|---|---|---|---|
CON | PT | TW | MW | GRO | GROMW | GROPT | GROTW | OTC | |
Moisture | 8.19 | 8.08 | 8.20 | 8.21 | 8.23 | 8.21 | 8.15 | 8.16 | 8.23 |
Crude protein | 54.8 | 54.5 | 54.2 | 54.1 | 54.8 | 54.7 | 54.6 | 54.5 | 54.2 |
Crude lipid | 9.39 | 9.12 | 9.02 | 9.12 | 9.06 | 9.29 | 9.31 | 9.23 | 9.21 |
Crude ash | 10.4 | 10.2 | 10.4 | 10.4 | 10.6 | 10.9 | 10.1 | 10.4 | 10.1 |
Name of Gene | Sense | Oligonucleotide Sequence (5′→3′) | Amplicon Length (bp) | Gene Bank Accession Number |
---|---|---|---|---|
β-actin | Forward | CAGCATCATGAAGTGTGACGTG | 107 | HQ386788.1 |
Reverse | CTTCTGCATACGGTCAGCAATG | |||
FGH 1 | Forward | CGCCGTATGGAAACTCTGAACT | 160 | M23439.1 |
Reverse | GGGTGCAGTTAGCTTCTGGAAA | |||
IL-1β 2 | Forward | ATGGAATCCAAGATGGAATGC | 250 | KF025662.1 |
Reverse | GAGACGAGCTTCTCTCACAC | |||
IL-10 3 | Forward | AGCGAACGATGACCTAGACACG | 114 | KF025662.1 |
Reverse | ACCGTGCTCAGGTAGAAGTCCA |
Item | Diets | Pooled SEM 12 | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
CON | PT | TW | MW | GRO | GROMW | GROPT | GROTW | OTC | ||
IBW 2 | 5.20 ns | 5.19 | 5.19 | 5.16 | 5.12 | 5.15 | 5.09 | 5.16 | 5.11 | 0.01 |
FBW 3 | 22.9 d | 23.6 bcd | 23.1 cd | 24.9 abcd | 25.5 ab | 25.8 a | 25.1 abc | 26.9 a | 23.1 cd | 0.48 |
WG (%) 4 | 340 d | 354 bcd | 345 cd | 382 abcd | 398 ab | 402 a | 392 abc | 422 a | 352 cd | 9.76 |
SGR (%/day) 5 | 2.69 c | 2.75 bc | 2.71 c | 2.86 abc | 2.91 ab | 2.93 a | 2.90 ab | 3.00 a | 2.74 c | 0.04 |
FE (%) 6 | 122 bcd | 114 cd | 109 d | 118 cd | 124 bc | 132 ab | 127 abc | 139 a | 114 d | 3.21 |
PER 7 | 1.75 c | 1.82 bc | 1.76 c | 1.96 abc | 2.07 ab | 2.07 ab | 1.93 abc | 2.14 a | 1.84 c | 0.05 |
Survival (%) 8 | 97.3 ns | 89.3 | 86.7 | 86.7 | 88.0 | 93.3 | 96.0 | 96.0 | 91.0 | 1.30 |
HSI (%) 9 | 0.89 ns | 1.24 | 1.27 | 0.99 | 1.27 | 1.11 | 1.03 | 1.26 | 1.00 | 0.05 |
VSI (%) 10 | 1.65 ns | 1.85 | 1.76 | 1.64 | 1.72 | 1.75 | 1.50 | 1.76 | 1.70 | 0.03 |
CF 11 | 0.78 ns | 0.80 | 0.79 | 0.77 | 0.82 | 0.76 | 0.75 | 0.78 | 0.76 | 0.01 |
Item | Diets | Pooled SEM | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
CON | PT | TW | MW | GRO | GROMW | GROPT | GROTW | OTC | ||
Moisture | 76.3 ns | 75.4 | 74.3 | 75.9 | 75.3 | 75.9 | 76.3 | 76.1 | 75.3 | 0.24 |
Protein | 17.9 ns | 18.4 | 18.7 | 17.7 | 18.6 | 18.1 | 18.2 | 17.8 | 18.5 | 0.14 |
Lipid | 1.87 ns | 2.08 | 2.54 | 2.08 | 2.32 | 2.17 | 1.72 | 2.23 | 2.1 | 0.09 |
Ash | 4.37 ns | 4.51 | 4.55 | 4.31 | 4.24 | 4.34 | 4.46 | 4.40 | 4.55 | 0.04 |
Item | Diets | Pooled SEM | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
CON | PT | TW | MW | GRO | GROMW | GROPT | GROTW | OTC | ||
GOT 2 | 35 ns | 27 | 32 | 30 | 31 | 40 | 25 | 25 | 25 | 1.69 |
GPT 3 | 12.7 a | 11.0 ab | 10.7 ab | 10.7 ab | 10.3 ab | 11.3 ab | 8.3 b | 9.7 ab | 9.7 ab | 0.4 |
GLU 4 | 13.3 ns | 11.3 | 9.7 | 14.0 | 13.0 | 13.3 | 11.0 | 11.3 | 10.3 | 0.51 |
TP 5 | 2.6 ns | 2.8 | 2.7 | 3.1 | 2.8 | 3.2 | 2.3 | 2.6 | 2.4 | 0.1 |
Item | Diets | Pooled SEM | ||||||||
---|---|---|---|---|---|---|---|---|---|---|
CON | PT | TW | MW | GRO | GROMW | GROPT | GROTW | OTC | ||
SOD 2 | 75.4 d | 82.4 c | 81.7 c | 76.5 d | 90.5 b | 93.7 ab | 97.5 a | 95.9 ab | 92.4 b | 2.81 |
Lysozyme 3 | 0.77 cd | 0.83 a | 0.74 d | 0.78 bc | 0.83 a | 0.86 a | 0.88 a | 0.85 a | 0.79 b | 0.02 |
MPO 4 | 1.98 d | 2.09 d | 2.25 c | 2.15 d | 2.46 c | 2.65 ab | 2.87 a | 2.25 b | 2.19 bc | 0.10 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Choi, W.; Moniruzzaman, M.; Hamidoghli, A.; Bae, J.; Lee, S.; Lee, S.; Min, T.; Bai, S.C. Effect of Four Functional Feed Additives on Growth, Serum Biochemistry, Antioxidant Capacity, Gene Expressions, Histomorphology, Digestive Enzyme Activities and Disease Resistance in Juvenile Olive Flounder, Paralichthys olivaceus. Antioxidants 2023, 12, 1494. https://doi.org/10.3390/antiox12081494
Choi W, Moniruzzaman M, Hamidoghli A, Bae J, Lee S, Lee S, Min T, Bai SC. Effect of Four Functional Feed Additives on Growth, Serum Biochemistry, Antioxidant Capacity, Gene Expressions, Histomorphology, Digestive Enzyme Activities and Disease Resistance in Juvenile Olive Flounder, Paralichthys olivaceus. Antioxidants. 2023; 12(8):1494. https://doi.org/10.3390/antiox12081494
Chicago/Turabian StyleChoi, Wonsuk, Mohammad Moniruzzaman, Ali Hamidoghli, Jinho Bae, Seunghyung Lee, Seunghan Lee, Taesun Min, and Sungchul C. Bai. 2023. "Effect of Four Functional Feed Additives on Growth, Serum Biochemistry, Antioxidant Capacity, Gene Expressions, Histomorphology, Digestive Enzyme Activities and Disease Resistance in Juvenile Olive Flounder, Paralichthys olivaceus" Antioxidants 12, no. 8: 1494. https://doi.org/10.3390/antiox12081494
APA StyleChoi, W., Moniruzzaman, M., Hamidoghli, A., Bae, J., Lee, S., Lee, S., Min, T., & Bai, S. C. (2023). Effect of Four Functional Feed Additives on Growth, Serum Biochemistry, Antioxidant Capacity, Gene Expressions, Histomorphology, Digestive Enzyme Activities and Disease Resistance in Juvenile Olive Flounder, Paralichthys olivaceus. Antioxidants, 12(8), 1494. https://doi.org/10.3390/antiox12081494