Comparative Study on Hepatoprotective Effects of Traditional Herbs, Roots of Angelica gigas Nakai, Glycyrrhiza uralensis Fischer, Zizyphus jujuba Mill., and Fruits of Paeonia lactiflora Pall., on Ethanol-Induced Liver Injury in Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents
2.2. Free Radical Scavenging Activity
2.3. Animals
2.4. Ethanol-Induced Liver Injury Model and Treatments
2.5. Blood Biochemistry
2.6. Assessments of Hepatic Antioxidant and Anti-Inflammatory Activities
2.7. Real-Time Reverse Transcription PCR
2.8. Immunoblotting
2.9. Histopathological Analysis
2.10. Immunohistochemistry
2.11. Statistical Analysis
3. Results
3.1. Free Radical Scavenging Activity of Traditional Herbs
3.2. Changes in Body Weight and Liver Weight
3.3. Improvements in Serum Biomarkers of Liver Injury
3.4. Hepatic Antioxidant and Anti-Inflammatory Activities
3.5. Signaling Pathway Related to Alcohol Metabolism in the Liver
3.6. Gene Regulation Related to Lipid Metabolism in the Liver
3.7. Histopathological Improvements in the Liver
3.8. Hepatic Antioxidant and Anti-Inflammatory Effects in Immunohistochemistry
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Hernández-Évole, H.; Jiménez-Esquivel, N.; Pose, E.; Bataller, R. Alcohol-associated liver disease: Epidemiology and management. Ann. Hepatol. 2024, 29, 101162. [Google Scholar] [CrossRef] [PubMed]
- Dunn, W.; Shah, V.H. Pathogenesis of Alcoholic Liver Disease. Clin. Liver Dis. 2016, 20, 445–456. [Google Scholar] [CrossRef] [PubMed]
- O’shea, R.S.; Dasarathy, S.; McCullough, A.J. Diseases PGCotAAftSoL. Gastroenterology PPCotACo. Alcoholic liver disease. Hepatology 2010, 51, 307–328. [Google Scholar] [CrossRef] [PubMed]
- Parker, R.; Aithal, G.P.; Becker, U.; Gleeson, D.; Masson, S.; Wyatt, J.I.; Rowe, I.A.; WALDO Study Group. Natural history of histologically proven alcohol-related liver disease: A systematic review. J. Hepatol. 2019, 71, 586–593. [Google Scholar] [CrossRef] [PubMed]
- You, M.; Arteel, G.E. Effect of ethanol on lipid metabolism. J. Hepatol. 2019, 70, 237–248. [Google Scholar] [CrossRef]
- Kong, L.Z.; Chandimali, N.; Han, Y.H.; Lee, D.H.; Kim, J.S.; Kim, S.U.; Kim, T.D.; Jeong, D.K.; Sun, H.N.; Lee, D.S.; et al. Pathogenesis, Early Diagnosis, and Therapeutic Management of Alcoholic Liver Disease. Int. J. Mol. Sci. 2019, 20, 2712. [Google Scholar] [CrossRef]
- Bradford, B.U.; Kono, H.; Isayama, F.; Kosyk, O.; Wheeler, M.D.; Akiyama, T.E.; Bleye, L.; Krausz, K.W.; Gonzalez, F.J.; Koop, D.R.; et al. Cytochrome P450 CYP2E1, but not nicotinamide adenine dinucleotide phosphate oxidase, is required for ethanol-induced oxidative DNA damage in rodent liver. Hepatology 2005, 41, 336–344. [Google Scholar] [CrossRef]
- Nagappan, A.; Kim, J.H.; Jung, D.Y.; Jung, M.H. Cryptotanshinone from the Salvia miltiorrhiza Bunge Attenuates Ethanol-Induced Liver Injury by Activation of AMPK/SIRT1 and Nrf2 Signaling Pathways. Int. J. Mol. Sci. 2019, 21, 265. [Google Scholar] [CrossRef]
- McClain, C.J.; Barve, S.; Deaciuc, I.; Kugelmas, M.; Hill, D. Cytokines in alcoholic liver disease. Semin. Liver Dis. 1999, 19, 205–219. [Google Scholar] [CrossRef]
- Kim, M.S.; Ong, M.; Qu, X. Optimal management for alcoholic liver disease: Conventional medications, natural therapy or combination? World J. Gastroenterol. 2016, 22, 8–23. [Google Scholar] [CrossRef]
- Whitfield, K.; Rambaldi, A.; Wetterslev, J.; Gluud, C. Pentoxifylline for alcoholic hepatitis. Cochrane Database Syst. Rev. 2009, 2009, CD007339. [Google Scholar] [CrossRef] [PubMed]
- Prince, D.S.; Nash, E.; Liu, K. Alcohol-Associated Liver Disease: Evolving Concepts and Treatments. Drugs 2023, 83, 1459–1474. [Google Scholar] [CrossRef] [PubMed]
- Adekunle, A.D.; Adejumo, A.; Singal, A.K. Therapeutic targets in alcohol-associated liver disease: Progress and challenges. Ther. Adv. Gastroenterol. 2023, 16, 17562848231170946. [Google Scholar] [CrossRef] [PubMed]
- Li, S.; Zhou, X.; Chen, R.; Zhang, Q.; Sun, Y.; Chen, H. Effect of natural polysaccharides on alcoholic liver disease: A review. Int. J. Biol. Macromol. 2023, 251, 126317. [Google Scholar] [CrossRef] [PubMed]
- Yan, J.; Nie, Y.; Luo, M.; Chen, Z.; He, B. Natural Compounds: A Potential Treatment for Alcoholic Liver Disease? Front. Pharmacol. 2021, 12, 694475. [Google Scholar] [CrossRef]
- Souid, A.; Giambastiani, L.; Castagna, A.; Santin, M.; Vivarelli, F.; Canistro, D.; Morosini, C.; Paolini, M.; Franchi, P.; Lucarini, M.; et al. Assessment of the Antioxidant and Hypolipidemic Properties of Salicornia europaea for the Prevention of TAFLD in Rats. Antioxidants 2024, 13, 596. [Google Scholar] [CrossRef]
- Gillessen, A.; Schmidt, H.H.J. Silymarin as Supportive Treatment in Liver Diseases: A Narrative Review. Adv. Ther. 2020, 37, 1279–1301. [Google Scholar] [CrossRef]
- Dwyer, J.T.; Coates, P.M.; Smith, M.J. Dietary Supplements: Regulatory Challenges and Research Resources. Nutrients 2018, 10, 41. [Google Scholar] [CrossRef]
- Shivnitwar, S.K.; Gilada, I.; Rajkondawar, A.V.; Ojha, S.K.; Katiyar, S.; Arya, N.; Babu, U.V.; Kumawat, R. Safety and Effectiveness of Liv.52 DS in Patients with Varied Hepatic Disorders: An Open-Label, Multi-centre, Phase IV Study. Cureus 2024, 16, e60898. [Google Scholar] [CrossRef]
- Liu, Z.L.; Xie, L.Z.; Zhu, J.; Li, G.Q.; Grant, S.J.; Liu, J.P. Herbal medicines for fatty liver diseases. Cochrane Database Syst. Rev. 2013, 2013, CD009059. [Google Scholar] [CrossRef]
- Asl, M.N.; Hosseinzadeh, H. Review of pharmacological effects of Glycyrrhiza sp. and its bioactive compounds. Phytother. Res. 2008, 22, 709–724. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Y.; Yao, R.; Li, L.; Li, W.; Li, C.; Pan, Y.; Li, S. Medication rule and mechanism of traditional Chinese medicine in treating metabolism-associated fatty liver disease based on bioinformatics technology. Digit. Chin. Med. 2023, 6, 257–271. [Google Scholar] [CrossRef]
- He, D.Y.; Dai, S.M. Anti-inflammatory and immunomodulatory effects of paeonia lactiflora pall., a traditional chinese herbal medicine. Front. Pharmacol. 2011, 2, 10. [Google Scholar] [CrossRef] [PubMed]
- Sobhani, Z.; Nikoofal-Sahlabadi, S.; Amiri, M.S.; Ramezani, M.; Emami, S.A.; Sahebkar, A. Therapeutic Effects of Ziziphus jujuba Mill. Fruit in Traditional and Modern Medicine: A Review. Med. Chem. 2020, 16, 1069–1088. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Li, L.; Jiang, C.; Xing, C.; Kim, S.H.; Lu, J. Anti-cancer and other bioactivities of Korean Angelica gigas Nakai (AGN) and its major pyranocoumarin compounds. Anti-Cancer Agents Med. Chem. 2012, 12, 1239–1254. [Google Scholar] [CrossRef] [PubMed]
- Ma, W.; Ren, H.; Meng, X.; Liu, S.; Du, K.; Fang, S.; Chang, Y. A review of the ethnopharmacology, phytochemistry, pharmacology, pharmacokinetics and quality control of Paeonia lactiflora Pall. J. Ethnopharmacol. 2024, 335, 118616. [Google Scholar] [CrossRef]
- Lu, Y.; Bao, T.; Mo, J.; Ni, J.; Chen, W. Research advances in bioactive components and health benefits of jujube (Ziziphus jujuba Mill.) fruit. J. Zhejiang Univ. Sci. B 2021, 22, 431–449. [Google Scholar] [CrossRef]
- Yun, J.W.; Che, J.H.; Kwon, E.; Kim, Y.S.; Kim, S.H.; You, J.R.; Kim, W.H.; Kim, H.H.; Kang, B.C. Safety evaluation of Angelica gigas: Genotoxicity and 13-weeks oral subchronic toxicity in rats. Regul. Toxicol. Pharmacol. 2015, 72, 473–480. [Google Scholar] [CrossRef]
- Song, X.; Yin, S.; Huo, Y.; Liang, M.; Fan, L.; Ye, M.; Hu, H. Glycycoumarin ameliorates alcohol-induced hepatotoxicity via activation of Nrf2 and autophagy. Free. Radic. Biol. Med. 2015, 89, 135–146. [Google Scholar] [CrossRef]
- Wang, M.; Zhang, F.; Zhou, J.; Gong, K.; Chen, S.; Zhu, X.; Zhang, M.; Duan, Y.; Liao, C.; Han, J. Glabridin Ameliorates Alcohol-Caused Liver Damage by Reducing Oxidative Stress and Inflammation via p38 MAPK/Nrf2/NF-κB Pathway. Nutrients 2023, 15, 2157. [Google Scholar] [CrossRef]
- Jung, J.C.; Lee, Y.H.; Kim, S.H.; Kim, K.J.; Kim, K.M.; Oh, S.; Jung, Y.S. Hepatoprotective effect of licorice, the root of Glycyrrhiza uralensis Fischer, in alcohol-induced fatty liver disease. BMC Complement. Altern. Med. 2016, 16, 19. [Google Scholar] [CrossRef] [PubMed]
- Chigurupati, H.; Auddy, B.; Biyani, M.; Stohs, S.J. Hepatoprotective Effects of a Proprietary Glycyrrhizin Product during Alcohol Consumption: A Randomized, Double-Blind, Placebo-Controlled, Crossover Study. Phytother. Res. 2016, 30, 1943–1953. [Google Scholar] [CrossRef] [PubMed]
- Song, Y.R.; Jang, B.; Lee, S.M.; Bae, S.J.; Bak, S.B.; Kim, Y.W. Angelica gigas NAKAI and Its Active Compound, Decursin, Inhibit Cellular Injury as an Antioxidant by the Regulation of AMP-Activated Protein Kinase and YAP Signaling. Molecules 2022, 27, 1858. [Google Scholar] [CrossRef] [PubMed]
- Bae, U.J.; Choi, E.K.; Oh, M.R.; Jung, S.J.; Park, J.; Jung, T.S.; Park, T.S.; Chae, S.W.; Park, B.H. Angelica gigas Ameliorates Hyperglycemia and Hepatic Steatosis in C57BL/KsJ-db/db Mice via Activation of AMP-Activated Protein Kinase Signaling Pathway. Am. J. Chin. Med. 2016, 44, 1627–1638. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.; Xiong, A.Z.; Teng, Z.Q.; Yang, Q.W.; Shi, Y.H.; Yang, L. Radix Paeoniae Rubra and Radix Paeoniae Alba Attenuate CCl4-induced acute liver injury: An ultra-performance liquid chromatography-mass spectrometry (UPLC-MS) based metabolomic approach for the pharmacodynamic study of Traditional Chinese Medicines (TCMs). Int. J. Mol. Sci. 2012, 13, 14634–14647. [Google Scholar] [CrossRef]
- Li, Y.; Deng, X.; Hu, Q.; Chen, Y.; Zhang, W.; Qin, X.; Wei, F.; Lu, X.; Ma, X.; Zeng, J.; et al. Paeonia lactiflora Pall. ameliorates acetaminophen-induced oxidative stress and apoptosis via inhibiting the PKC-ERK pathway. J. Ethnopharmacol. 2024, 329, 118107. [Google Scholar] [CrossRef]
- Sun, S.; Lan, W.; Ji, L.; Ai, L.; Wu, Y.; Zhang, H. A Homogalacturonan from Peel of Winter Jujube (Zizyphus jujuba Mill. cv. Dongzao): Characterization and Protective Effects against CCl(4)-Induced Liver Injury. Foods 2022, 11, 4087. [Google Scholar] [CrossRef]
- Tedyanto, C.P.; Wihanto, L.; Hendrata, A.P. Hepatoprotective Effect of Dried Red Jujube Fruit Extract Against Acetaminophen-Induced Acute Hepatotoxicity. Cureus 2023, 15, e33272. [Google Scholar] [CrossRef]
- Park, S.H.; Seo, W.; Xu, M.-J.; Mackowiak, B.; Lin, Y.; He, Y.; Fu, Y.; Hwang, S.; Kim, S.-J.; Guan, Y.; et al. Ethanol and its Nonoxidative Metabolites Promote Acute Liver Injury by Inducing ER Stress, Adipocyte Death, and Lipolysis. Cell. Mol. Gastroenterol. Hepatol. 2023, 15, 281–306. [Google Scholar] [CrossRef]
- Oh, T.W.; Park, K.H.; Jung, H.W.; Park, Y.K. Neuroprotective effect of the hairy root extract of Angelica gigas NAKAI on transient focal cerebral ischemia in rats through the regulation of angiogenesis. BMC Complement. Altern. Med. 2015, 15, 101. [Google Scholar] [CrossRef]
- Hong, M.K.; Han, Y.; Park, H.J.; Shin, M.R.; Roh, S.S.; Kwon, E.Y. The Synergistic Action of Metformin and Glycyrrhiza uralensis Fischer Extract Alleviates Metabolic Disorders in Mice with Diet-Induced Obesity. Int. J. Mol. Sci. 2023, 24, 936. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.M.; Li, M.L.; Tse, Y.C.; Leung, S.C.; Lee, M.M.; Tsui, S.K.; Fung, K.P.; Lee, C.Y.; Waye, M.M. Paeoniae Radix, a Chinese herbal extract, inhibit hepatoma cells growth by inducing apoptosis in a p53 independent pathway. Life Sci. 2002, 71, 2267–2277. [Google Scholar] [CrossRef] [PubMed]
- Hong, S.; Kim, Y.; Sung, J.; Lee, H.; Heo, H.; Jeong, H.S.; Lee, J. Jujube (Ziziphus jujuba Mill.) Protects Hepatocytes against Alcohol-Induced Damage through Nrf2 Activation. Evid. Based Complement. Altern. Med. 2020, 2020, 6684331. [Google Scholar] [CrossRef] [PubMed]
- Dachuri, V.; Song, P.H.; Ku, S.K.; Song, C.H. Protective Effects of Traditional Herbal Formulas on Cisplatin-Induced Nephrotoxicity in Renal Epithelial Cells via Antioxidant and Antiapoptotic Properties. Evid. Based Complement. Altern. Med. 2020, 2020, 5807484. [Google Scholar] [CrossRef] [PubMed]
- Choi, B.R.; Cho, I.J.; Jung, S.J.; Kim, J.K.; Park, S.M.; Lee, D.G.; Ku, S.K.; Park, K.M. Lemon balm and dandelion leaf extract synergistically alleviate ethanol-induced hepatotoxicity by enhancing antioxidant and anti-inflammatory activity. J. Food Biochem. 2020, 44, e13232. [Google Scholar] [CrossRef]
- Jegal, K.H.; Park, H.R.; Choi, B.R.; Kim, J.K.; Ku, S.K. Synergistic Protective Effect of Fermented Schizandrae Fructus Pomace and Hoveniae Semen cum Fructus Extracts Mixture in the Ethanol-Induced Hepatotoxicity. Antioxidants 2023, 12, 1602. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Maher, J.J. Exploring alcohol’s effects on liver function. Alcohol Health Res. World 1997, 21, 5–12. [Google Scholar]
- Alatalo, P.; Koivisto, H.; Puukka, K.; Hietala, J.; Anttila, P.; Bloigu, R.; Niemela, O. Biomarkers of liver status in heavy drinkers, moderate drinkers and abstainers. Alcohol Alcohol. 2009, 44, 199–203. [Google Scholar] [CrossRef]
- Mandrekar, P.; Szabo, G. Signalling pathways in alcohol-induced liver inflammation. J. Hepatol. 2009, 50, 1258–1266. [Google Scholar] [CrossRef]
- Li, S.; Hong, M.; Tan, H.-Y.; Wang, N.; Feng, Y. Insights into the role and interdependence of oxidative stress and inflammation in liver diseases. Oxidative Med. Cell. Longev. 2016, 2016, 4234061. [Google Scholar] [CrossRef]
- He, Z.; Wang, Y.; Chen, Y.; Geng, F.; Jiang, Z.; Li, X. Angelica gigas Nakai: An overview on its chemical composition and pharmacological activity. Biochem. Syst. Ecol. 2023, 111, 104717. [Google Scholar] [CrossRef]
- Huang, W.; Wang, Y.; Jiang, X.; Sun, Y.; Zhao, Z.; Li, S. Protective effect of flavonoids from Ziziphus jujuba cv. Jinsixiaozao against acetaminophen-induced liver injury by inhibiting oxidative stress and inflammation in mice. Molecules 2017, 22, 1781. [Google Scholar] [CrossRef]
- Gong, H.; Li, H.-D.; Yan, M.; Zhang, B.-K.; Jiang, P.; Fan, X.-R.; Deng, Y. Effect of licorice on the induction of phase II metabolizing enzymes and phase III transporters and its possible mechanism. Pharmazie 2014, 69, 894–897. [Google Scholar] [PubMed]
- Qiu, Z.-K.; He, J.-L.; Liu, X.; Zeng, J.; Xiao, W.; Fan, Q.-H.; Chai, X.-M.; Ye, W.-H.; Chen, J.-S. Anxiolytic-like effects of paeoniflorin in an animal model of post traumatic stress disorder. Metab. Brain Dis. 2018, 33, 1175–1185. [Google Scholar] [CrossRef] [PubMed]
- Mao, L.; Chen, J.; Cheng, K.; Dou, Z.; Leavenworth, J.D.; Yang, H.; Xu, D.; Luo, L. Nrf2-Dependent Protective Effect of Paeoniflorin on alpha-Naphthalene Isothiocyanate-Induced Hepatic Injury. Am. J. Chin. Med. 2022, 50, 1331–1348. [Google Scholar] [CrossRef] [PubMed]
- You, M.; Liang, X.; Ajmo, J.M.; Ness, G.C. Involvement of mammalian sirtuin 1 in the action of ethanol in the liver. Am. J. Physiol. Gastrointest. Liver Physiol. 2008, 294, G892–G898. [Google Scholar] [CrossRef] [PubMed]
- Hwang, J.T.; Kim, S.H.; Hur, H.J.; Kim, H.J.; Park, J.H.; Sung, M.J.; Yang, H.J.; Ryu, S.Y.; Kim, Y.S.; Cha, M.R.; et al. Decursin, an active compound isolated from Angelica gigas, inhibits fat accumulation, reduces adipocytokine secretion and improves glucose tolerance in mice fed a high-fat diet. Phytother. Res. 2012, 26, 633–638. [Google Scholar] [CrossRef]
- Jung, S.J.; Kim, W.R.; Oh, M.R.; Cha, Y.S.; Park, B.H.; Chae, S.W. A Randomized, Double-Blind, Placebo-Controlled Clinical Trial Assessing the Effects of Angelica Gigas Nakai Extract on Blood Triglycerides. Nutrients 2020, 12, 377. [Google Scholar] [CrossRef]
- Mackowiak, B.; Fu, Y.; Maccioni, L.; Gao, B. Alcohol-associated liver disease. J. Clin. Investig. 2024, 134, e176345. [Google Scholar] [CrossRef] [PubMed]
- Lu, K.H.; Liu, C.T.; Raghu, R.; Sheen, L.Y. Therapeutic potential of Chinese herbal medicines in alcoholic liver disease. J. Tradit. Complement. Med. 2012, 2, 115–122. [Google Scholar] [CrossRef] [PubMed]
- Kim, K.-M.; Lee, Y.-J.; Hong, Y.-G.; Kang, J.-S. Oral acute and subacute toxicity studies of decursin and decursinol angelate of Angelica gigas Nakai. Mol. Cell. Toxicol. 2009, 5, 153–159. [Google Scholar]
- Seo, Y.J.; Kwon, M.S.; Park, S.H.; Sim, Y.B.; Choi, S.M.; Huh, G.H.; Lee, J.K.; Suh, H.W. The analgesic effect of decursinol. Arch. Pharmacal Res. 2009, 32, 937–943. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.B.; Hwang, E.S.; Choi, G.Y.; Lee, S.; Park, T.S.; Lee, C.W.; Lee, E.S.; Kim, Y.C.; Kim, S.S.; Lee, S.O.; et al. ESP-102, a Combined Herbal Extract of Angelica gigas, Saururus chinensis, and Schisandra chinensis, Changes Synaptic Plasticity and Attenuates Scopolamine-Induced Memory Impairment in Rat Hippocampus Tissue. Evid. Based Complement. Altern. Med. 2016, 2016, 8793095. [Google Scholar] [CrossRef]
- Wang, Z.; Zhang, Y.; Zhang, Q.; Ao, Q.; Luo, C.; Wang, B.; Bai, C.; Ge, X.; Wang, Y.; Wang, J.; et al. On the Core Prescriptions and Their Mechanisms of Traditional Chinese Medicine in Hepatitis B, Liver Cirrhosis, and Liver Cancer Treatment. J. Oncol. 2022, 2022, 5300523. [Google Scholar] [CrossRef]
- He, Z.; Guo, T.; Cui, Z.; Xu, J.; Wu, Z.; Yang, X.; Hu, H.; Mei, H.; Zhou, J.; Zhang, Y.; et al. New understanding of Angelica sinensis polysaccharide improving fatty liver: The dual inhibition of lipid synthesis and CD36-mediated lipid uptake and the regulation of alcohol metabolism. Int. J. Biol. Macromol. 2022, 207, 813–825. [Google Scholar] [CrossRef]
Targets (GenBank IDs) | Sequence (5′–3′) |
---|---|
ACOX1 (NM_013495) | Forward: GAATCAGGGCACCACTGCTCA |
Reverse: CCTCGAAGATGAGTTCCGTGG | |
CPT1 (NM_013495) | Forward: TGCATACCAAAGTGGACCCC |
Reverse: ACGCCACTCACGATGTTCTT | |
FAS (NM_0079883) | Forward: GCTTCGCCAACTCTACCATG |
Reverse: CCATCGCTTCCAGGACAATG | |
DGAT2 (NM_026384) | Forward: AGTGGCAATGCTATCATCATCGT |
Reverse: AAGGAATAAGTGGGAACCAGATCA | |
PPARα (NM_001113418) | Forward: TGCCTTCCCTGTGAACTGAC |
Reverse: CCATGTTGGATGGATGTGGC | |
PPARγ (NM_001127330) | Forward: ACGCGGAAGAAGAGACCTGG |
Reverse: AGTGTGACTTCTCCTCAGCC | |
SCD1 (NM_009127) | Forward: TGGAGACGGGAGTCACAAGA Reverse: CCCCGATAGCAATATCCAGTTG |
SREBP1c (NM_011480) | Forward: GATGTGCGAACTGGACACAG Reverse: CATAGGGGGCGTCAAACAG |
β-actin (NM_007393) | Forward: CAGCAAGCAGGAGTACGATGA |
Reverse: AACGCAGCTCAGTAACAGTCC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Kim, S.-Y.; Oh, K.-J.; Seo, Y.-R.; Kim, Y.-W.; Song, P.H.; Song, C.-H. Comparative Study on Hepatoprotective Effects of Traditional Herbs, Roots of Angelica gigas Nakai, Glycyrrhiza uralensis Fischer, Zizyphus jujuba Mill., and Fruits of Paeonia lactiflora Pall., on Ethanol-Induced Liver Injury in Mice. Antioxidants 2024, 13, 1137. https://doi.org/10.3390/antiox13091137
Kim S-Y, Oh K-J, Seo Y-R, Kim Y-W, Song PH, Song C-H. Comparative Study on Hepatoprotective Effects of Traditional Herbs, Roots of Angelica gigas Nakai, Glycyrrhiza uralensis Fischer, Zizyphus jujuba Mill., and Fruits of Paeonia lactiflora Pall., on Ethanol-Induced Liver Injury in Mice. Antioxidants. 2024; 13(9):1137. https://doi.org/10.3390/antiox13091137
Chicago/Turabian StyleKim, So-Yeon, Kyung-Jin Oh, Yu-Ri Seo, Young-Woo Kim, Phil Hyun Song, and Chang-Hyun Song. 2024. "Comparative Study on Hepatoprotective Effects of Traditional Herbs, Roots of Angelica gigas Nakai, Glycyrrhiza uralensis Fischer, Zizyphus jujuba Mill., and Fruits of Paeonia lactiflora Pall., on Ethanol-Induced Liver Injury in Mice" Antioxidants 13, no. 9: 1137. https://doi.org/10.3390/antiox13091137