Taurine Enhances Iron-Related Proteins and Reduces Lipid Peroxidation in Differentiated C2C12 Myotubes
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Cell Viability Test
2.3. Thiobarbituric Acid Reactive Substances (TBARS)
2.4. Lipid Peroxidation Determined by BODIPY Assay
2.5. Cellular Total Glutathione
2.6. Quantitative Real Time Polymerase Chain Reaction (qRT-PCR)
2.7. Western Blotting
2.8. Catalase Activity
2.9. Statistical Analysis
3. Results
3.1. The Impact of Taurine on Cell Viability and Cellular Taurine Management
3.2. The Impact of Taurine on Celluar Redox-Homeostasis
3.3. The Impact of Taurine on Iron-Related Proteins
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Finch, C.A.; Deubelbeiss, K.; Cook, J.D.; Eschbach, J.W.; Harker, L.A.; Funk, D.D.; Marsaglia, G.; Hillman, R.S.; Slichter, S.; Adamson, J.W.; et al. Ferrokinetics in man. Medicine 1970, 49, 17–53. [Google Scholar] [CrossRef] [PubMed]
- Lill, R. Function and biogenesis of iron-sulphur proteins. Nature 2009, 460, 831–838. [Google Scholar] [CrossRef] [PubMed]
- Cozzi, A.; Corsi, B.; Levi, S.; Santambrogio, P.; Albertini, A.; Arosio, P. Overexpression of wild type and mutated human ferritin H-chain in HeLa cells: In vivo role of ferritin ferroxidase activity. J. Biol. Chem. 2000, 275, 25122–25129. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gao, J.; Richardson, D.R. The potential of iron chelators of the pyridoxal isonicotinoyl hydrazone class as effective antiproliferative agents, IV: The mechanisms involved in inhibiting cell-cycle progression. Blood 2001, 98, 842–850. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Boniecki, M.T.; Freibert, S.A.; Mühlenhoff, U.; Lill, R.; Cygler, M. Structure and functional dynamics of the mitochondrial Fe/S cluster synthesis complex. Nat. Commun. 2017, 8, 1287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lebigot, E.; Gaignard, P.; Dorboz, I.; Slama, A.; Rio, M.; de Lonlay, P.; Héron, B.; Sabourdy, F.; Boespflug-Tanguy, O.; Cardoso, A.; et al. Impact of mutations within the Fe-S cluster or the lipoic acid biosynthesis pathways on mitochondrial protein expression profiles in fibroblasts from patients. Mol. Genet. Metab. 2017, 122, 85–94. [Google Scholar] [CrossRef] [PubMed]
- Breuer, W.; Epsztejn, S.; Ioav Cabantchik, Z. Dynamics of the cytosolic chelatable iron pool of K562 cells. FEBS Lett. 1996, 382, 304–308. [Google Scholar] [CrossRef] [Green Version]
- Ayala, A.; Muñoz, M.F.; Argüelles, S. Lipid peroxidation: Production, metabolism, and signaling mechanisms of malondialdehyde and 4-hydroxy-2-nonenal. Oxid. Med. Cell. Longev. 2014, 2014, 360438. [Google Scholar] [CrossRef]
- Stipanuk, M.H.; Ueki, I. Dealing with methionine/homocysteine sulfur: Cysteine metabolism to taurine and inorganic sulfur. J. Inherit. Metab. Dis. 2011, 34, 17–32. [Google Scholar] [CrossRef] [Green Version]
- Seidel, U.; Huebbe, P.; Rimbach, G. Taurine: A Regulator of Cellular Redox Homeostasis and Skeletal Muscle Function. Mol. Nutr. Food Res. 2019, 63, e1800569. [Google Scholar] [CrossRef]
- Laidlaw, S.A.; Grosvenor, M.; Kopple, J.D. The taurine content of common foodstuffs. JPEN J. Parenter. Enteral Nutr. 1990, 14, 183–188. [Google Scholar] [CrossRef]
- Huxtable, R.J. Physiological actions of taurine. Physiol. Rev. 1992, 72, 101–163. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ripps, H.; Shen, W. Review: Taurine: A “very essential” amino acid. Mol. Vis. 2012, 18, 2673–2686. [Google Scholar]
- Chesney, R.W. Taurine: Its biological role and clinical implications. Adv. Pediatr. 1985, 32, 1–42. [Google Scholar] [PubMed]
- Oliveira, M.W.S.; Minotto, J.B.; de Oliveira, M.R.; Zanotto-Filho, A.; Behr, G.A.; Rocha, R.F.; Moreira, J.C.F.; Klamt, F. Scavenging and antioxidant potential of physiological taurine concentrations against different reactive oxygen/nitrogen species. Pharmacological. Reports 2010, 62, 185–193. [Google Scholar] [CrossRef]
- Wang, Y.; Grenell, A.; Zhong, F.; Yam, M.; Hauer, A.; Gregor, E.; Zhu, S.; Lohner, D.; Zhu, J.; Du, J. Metabolic signature of the aging eye in mice. Neurobiol. Aging 2018, 71, 223–233. [Google Scholar] [CrossRef]
- Massie, H.R.; Williams, T.R.; DeWolfe, L.K. Changes in taurine in aging fruit flies and mice. Exp. Gerontol. 1989, 24, 57–65. [Google Scholar] [CrossRef]
- Dawson, R.; Pelleymounter, M.A.; Cullen, M.J.; Gollub, M.; Liu, S. An age-related decline in striatal taurine is correlated with a loss of dopaminergic markers. Brain Res. Bull. 1999, 48, 319–324. [Google Scholar] [CrossRef]
- Eppler, B.; Dawson, R. Dietary taurine manipulations in aged male Fischer 344 rat tissue: Taurine concentration, taurine biosynthesis, and oxidative markers. Biochem. Pharmacol. 2001, 62, 29–39. [Google Scholar] [CrossRef]
- Pierno, S.; de Luca, A.; Camerino, C.; Huxtable, R.J.; Camerino, D.C. Chronic administration of taurine to aged rats improves the electrical and contractile properties of skeletal muscle fibers. J. Pharmacol. Exp. Ther. 1998, 286, 1183–1190. [Google Scholar]
- Tallon, M.J.; Harris, R.C.; Maffulli, N.; Tarnopolsky, M.A. Carnosine, taurine and enzyme activities of human skeletal muscle fibres from elderly subjects with osteoarthritis and young moderately active subjects. Biogerontology 2007, 8, 129–137. [Google Scholar] [CrossRef] [PubMed]
- Cornet, M.; Bousset, J. Free amino acids and dipeptides in porcine muscles: Differences between ‘red’ and ‘white’ muscles. Meat Sci. 1999, 51, 215–219. [Google Scholar] [CrossRef]
- Dunnett, M.; Harris, R.C.; Sewell, D.A. Taurine content and distribution in equine skeletal muscle. Scand. J. Clin. Lab. Invest. 1992, 52, 725–730. [Google Scholar] [CrossRef]
- Iwata, H.; Obara, T.; Kim, B.K.; Baba, A. Regulation of taurine transport in rat skeletal muscle. J. Neurochem. 1986, 47, 158–163. [Google Scholar] [CrossRef]
- Matsuzaki, Y.; Miyazaki, T.; Miyakawa, S.; Bouscarel, B.; Ikegami, T.; Tanaka, N. Decreased taurine concentration in skeletal muscles after exercise for various durations. Med. Sci. Sports Exerc. 2002, 34, 793–797. [Google Scholar] [CrossRef] [PubMed]
- Stuerenburg, H.J.; Stangneth, B.; Schoser, B.G.H. Age related profiles of free amino acids in human skeletal muscle. Neuro Endocrinol. Lett. 2006, 27, 133–136. [Google Scholar]
- Terrill, J.R.; Grounds, M.D.; Arthur, P.G. Taurine deficiency, synthesis and transport in the mdx mouse model for Duchenne Muscular Dystrophy. Int. J. Biochem. Cell Biol. 2015, 66, 141–148. [Google Scholar] [CrossRef] [Green Version]
- Hofer, T.; Marzetti, E.; Xu, J.; Seo, A.Y.; Gulec, S.; Knutson, M.D.; Leeuwenburgh, C.; Dupont-Versteegden, E.E. Increased iron content and RNA oxidative damage in skeletal muscle with aging and disuse atrophy. Exp. Gerontol. 2008, 43, 563–570. [Google Scholar] [CrossRef] [Green Version]
- DeRuisseau, K.C.; Park, Y.-M.; DeRuisseau, L.R.; Cowley, P.M.; Fazen, C.H.; Doyle, R.P. Aging-related changes in the iron status of skeletal muscle. Exp. Gerontol. 2013, 48, 1294–1302. [Google Scholar] [CrossRef] [Green Version]
- Cheong, S.H.; Moon, S.H.; Lee, S.J.; Kim, S.H.; Chang, K.J. Antioxidant and DNA protection effects of taurine by electron spin resonance spectroscopy. Adv. Exp. Med. Biol. 2013, 776, 167–177. [Google Scholar] [CrossRef]
- Piao, S.; Cha, Y.-N.; Kim, C. Taurine chloramine protects RAW 264.7 macrophages against hydrogen peroxide-induced apoptosis by increasing antioxidants. J. Clin. Biochem. Nutr. 2011, 49, 50–56. [Google Scholar] [CrossRef] [Green Version]
- Kang, I.S.; Kim, C. Taurine chloramine administered in vivo increases NRF2-regulated antioxidant enzyme expression in murine peritoneal macrophages. Adv. Exp. Med. Biol. 2013, 775, 259–267. [Google Scholar] [CrossRef] [PubMed]
- Yang, W.; Huang, J.; Xiao, B.; Liu, Y.; Zhu, Y.; Wang, F.; Sun, S. Taurine Protects Mouse Spermatocytes from Ionizing Radiation-Induced Damage Through Activation of Nrf2/HO-1 Signaling. Cell. Physiol. Biochem. 2017, 44, 1629–1639. [Google Scholar] [CrossRef]
- Jong, C.J.; Azuma, J.; Schaffer, S. Mechanism underlying the antioxidant activity of taurine: Prevention of mitochondrial oxidant production. Amino Acids 2012, 42, 2223–2232. [Google Scholar] [CrossRef]
- Oudit, G.Y.; Trivieri, M.G.; Khaper, N.; Husain, T.; Wilson, G.J.; Liu, P.; Sole, M.J.; Backx, P.H. Taurine supplementation reduces oxidative stress and improves cardiovascular function in an iron-overload murine model. Circulation 2004, 109, 1877–1885. [Google Scholar] [CrossRef] [Green Version]
- Zhang, Z.; Liu, D.; Yi, B.; Liao, Z.; Tang, L.; Yin, D.; He, M. Taurine supplementation reduces oxidative stress and protects the liver in an iron-overload murine model. Mol. Med. Rep. 2014, 10, 2255–2262. [Google Scholar] [CrossRef] [Green Version]
- Gabr, S.A.; Gabr, N.S.; Elsaed, W.M. Protective Activity of Taurine and Molecular Fibrogenesis in Iron Overloaded Hepatic Tissues. Int. J. Pharmacol. 2019, 15, 418–427. [Google Scholar] [CrossRef]
- Petrova, Y.S.; Neudachina, L.K. Potentiometric study of complexation between taurine and metal ions. Russ. J. Inorg. Chem. 2013, 58, 617–620. [Google Scholar] [CrossRef] [Green Version]
- Borenfreund, E.; Puerner, J.A. Toxicity determined in vitro by morphological alterations and neutral red absorption. Toxicol. Lett. 1985, 24, 119–124. [Google Scholar] [CrossRef]
- Kei, S. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta 1978, 90, 37–43. [Google Scholar] [CrossRef]
- Vandeputte, C.; Guizon, I.; Genestie-Denis, I.; Vannier, B.; Lorenzon, G. A microtiter plate assay for total glutathione and glutathione disulfide contents in cultured/isolated cells: Performance study of a new miniaturized protocol. Cell Biol. Toxicol. 1994, 10, 415–421. [Google Scholar] [CrossRef] [PubMed]
- Rahman, I.; Kode, A.; Biswas, S.K. Assay for quantitative determination of glutathione and glutathione disulfide levels using enzymatic recycling method. Nat. Protoc. 2006, 1, 3159–3165. [Google Scholar] [CrossRef]
- Johansson, L.H.; Håkan Borg, L.A. A spectrophotometric method for determination of catalase activity in small tissue samples. Anal. Biochem. 1988, 174, 331–336. [Google Scholar] [CrossRef]
- Ito, T.; Yoshikawa, N.; Inui, T.; Miyazaki, N.; Schaffer, S.W.; Azuma, J. Tissue depletion of taurine accelerates skeletal muscle senescence and leads to early death in mice. PLoS ONE 2014, 9, e107409. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ito, T.; Yoshikawa, N.; Schaffer, S.W.; Azuma, J. Tissue taurine depletion alters metabolic response to exercise and reduces running capacity in mice. J. Amino Acids 2014, 2014, 964680. [Google Scholar] [CrossRef] [Green Version]
- Ito, T.; Kimura, Y.; Uozumi, Y.; Takai, M.; Muraoka, S.; Matsuda, T.; Ueki, K.; Yoshiyama, M.; Ikawa, M.; Okabe, M.; et al. Taurine depletion caused by knocking out the taurine transporter gene leads to cardiomyopathy with cardiac atrophy. J. Mol. Cell. Cardiol. 2008, 44, 927–937. [Google Scholar] [CrossRef] [PubMed]
- Warskulat, U.; Flögel, U.; Jacoby, C.; Hartwig, H.-G.; Thewissen, M.; Merx, M.W.; Molojavyi, A.; Heller-Stilb, B.; Schrader, J.; Häussinger, D. Taurine transporter knockout depletes muscle taurine levels and results in severe skeletal muscle impairment but leaves cardiac function uncompromised. FASEB J. 2004, 18, 577–579. [Google Scholar] [CrossRef] [Green Version]
- Heller-Stilb, B.; van Roeyen, C.; Rascher, K.; Hartwig, H.-G.; Huth, A.; Seeliger, M.W.; Warskulat, U.; Häussinger, D. Disruption of the taurine transporter gene (taut) leads to retinal degeneration in mice. FASEB J. 2002, 16, 231–233. [Google Scholar] [CrossRef]
- Froger, N.; Moutsimilli, L.; Cadetti, L.; Jammoul, F.; Wang, Q.-P.; Fan, Y.; Gaucher, D.; Rosolen, S.G.; Neveux, N.; Cynober, L.; et al. Taurine: The comeback of a neutraceutical in the prevention of retinal degenerations. Prog. Retin. Eye Res. 2014, 41, 44–63. [Google Scholar] [CrossRef]
- Han, X.; Budreau, A.M.; Chesney, R.W. Adaptive regulation of MDCK cell taurine transporter (pNCT) mRNA: Transcription of pNCT gene is regulated by external taurine concentration. Biochim. Biophys. Acta Gen Struct. Expr. 1997, 1351, 296–304. [Google Scholar] [CrossRef]
- Voss, J.W.; Pedersen, S.F.; Christensen, S.T.; Lambert, I.H. Regulation of the expression and subcellular localization of the taurine transporter TauT in mouse NIH3T3 fibroblasts. Eur. J. Biochem. 2004, 271, 4646–4658. [Google Scholar] [CrossRef] [PubMed]
- Hansen, D.B.; Guerra, B.; Jacobsen, J.H.; Lambert, I.H. Regulation of taurine homeostasis by protein kinase CK2 in mouse fibroblasts. Amino Acids 2011, 40, 1091–1106. [Google Scholar] [CrossRef] [PubMed]
- Ito, T.; Murakami, S.; Schaffer, S.W. Taurine-Conjugated Metabolites in Hearts. Adv. Exp. Med. Biol. 2019, 1155, 523–529. [Google Scholar] [CrossRef] [PubMed]
- Minotti, G.; Aust, S.D. Redox cycling of iron and lipid peroxidation. Lipids 1992, 27, 219–226. [Google Scholar] [CrossRef]
- Tadolini, B.; Cabrini, L.; Menna, C.; Pinna, G.G.; Hakim, G. Iron (III) stimulation of lipid hydroperoxide-dependent lipid peroxidation. Free Radic. Res. 1997, 27, 563–576. [Google Scholar] [CrossRef]
- Park, S.Y.; Ahn, C.-B.; Chang, K.J.; Kim, S.H.; Lee, W.; Um, J.H.; Han, E.J.; Jeon, Y.-J.; Cheong, S.H.; Ahn, G. Hepatoprotective Effects of Xylose-Taurine Reduced Against Hydrogen Peroxide-Induced Oxidative Stress in Cultured Hepatocytes. Adv. Exp. Med. Biol. 2017, 975 Pt 1, 621–631. [Google Scholar] [CrossRef]
- Sun, Q.; Jia, N.; Yang, J.; Chen, G. Nrf2 Signaling Pathway Mediates the Antioxidative Effects of Taurine Against Corticosterone-Induced Cell Death in HUMAN SK-N-SH Cells. Neurochem. Res. 2018, 43, 276–286. [Google Scholar] [CrossRef]
- Sun Jang, J.; Piao, S.; Cha, Y.-N.; Kim, C. Taurine Chloramine Activates Nrf2, Increases HO-1 Expression and Protects Cells from Death Caused by Hydrogen Peroxide. J. Clin. Biochem. Nutr. 2009, 45, 37–43. [Google Scholar] [CrossRef] [Green Version]
- Cheong, S.H.; Lee, D.-S. Taurine Chloramine Prevents Neuronal HT22 Cell Damage Through Nrf2-Related Heme Oxygenase-1. Adv. Exp. Med. Biol. 2017, 975 Pt 1, 145–157. [Google Scholar] [CrossRef]
- Harrison, P.M.; Arosio, P. The ferritins: Molecular properties, iron storage function and cellular regulation. Biochim. Biophys. Acta Bioenerg. 1996, 1275, 161–203. [Google Scholar] [CrossRef] [Green Version]
- Arosio, P.; Yokota, M.; Drysdale, J.W. Structural and Immunological Relationships of Isoferritins in Normal and Malignant Cells. Cancer Res. 1976, 36, 1735–1739. [Google Scholar]
- Levi, S.; Santambrogio, P.; Cozzi, A.; Rovida, E.; Corsi, B.; Tamborini, E.; Spada, S.; Albertini, A.; Arosio, P. The role of the L-chain in ferritin iron incorporation. Studies of homo and heteropolymers. J. Mol. Biol. 1994, 238, 649–654. [Google Scholar] [CrossRef] [PubMed]
- Epsztejn, S.; Glickstein, H.; Picard, V.; Slotki, I.N.; Breuer, W.; Beaumont, C.; Cabantchik, Z.I. H-ferritin subunit overexpression in erythroid cells reduces the oxidative stress response and induces multidrug resistance properties. Blood 1999, 94, 3593–3603. [Google Scholar] [CrossRef]
- Orino, K.; Lehman, L.; Tsuji, Y.; Ayaki, H.; Torti, S.V.; Torti, F.M. Ferritin and the response to oxidative stress. Biochem. J. 2001, 357, 241–247. [Google Scholar] [CrossRef] [PubMed]
- Hider, R.C.; Kong, X.L. Glutathione: A key component of the cytoplasmic labile iron pool. Biometals 2011, 24, 1179–1187. [Google Scholar] [CrossRef]
- Sammarco, M.C.; Ditch, S.; Banerjee, A.; Grabczyk, E. Ferritin L and H subunits are differentially regulated on a post-transcriptional level. J. Biol. Chem. 2008, 283, 4578–4587. [Google Scholar] [CrossRef] [Green Version]
- Wang, J.; Pantopoulos, K. Regulation of cellular iron metabolism. Biochem. J. 2011, 434, 365–381. [Google Scholar] [CrossRef] [Green Version]
- Gryzik, M.; Srivastava, A.; Longhi, G.; Bertuzzi, M.; Gianoncelli, A.; Carmona, F.; Poli, M.; Arosio, P. Expression and characterization of the ferritin binding domain of Nuclear Receptor Coactivator-4 (NCOA4). Biochim. Biophys. Acta Gen. Subj. 2017, 1861, 2710–2716. [Google Scholar] [CrossRef]
- Sirdah, M.M.; El-Agouza, I.M.A.; Abu Shahla, A.N.K. Possible ameliorative effect of taurine in the treatment of iron-deficiency anaemia in female university students of Gaza, Palestine. Eur. J. Haematol. 2002, 69, 236–242. [Google Scholar] [CrossRef]
- Momma, R.; Kumagai, H.; Oshiden, M.; Iemitsu, M.; Maeda, S. Relationship between anemia and circulating levels of amino acids in female endurance athletes. Jpn. J. Phys. Fit. Sports Med. 2017, 66, 391–397. [Google Scholar] [CrossRef]
Animals | Tissue | Taurine/Taurine Metabolites | Relative Changes in Aged Compared to Young Control Animals | Reference |
---|---|---|---|---|
C57 BL/6J mice | Lens | Hypotaurine, cystathionine | >70% decrease | [16] |
C57 BL/6J mice | Skeletal muscle (Rectus femoris) | Taurine | ~15% decrease | [17] |
Heart muscle | ~55% increase | |||
Brain | ~35% decrease | |||
Liver | No change | |||
Kidney | No change | |||
Blood | No change | |||
Long-Evans rats | Brain (Striatum) | Taurine | ~20% decrease | [18] |
Fischer 344 rats | Liver | Taurine | ~60% decrease | [19] |
Kidney | ~30% decrease | |||
Brain (Cerebellum) | ~14% decrease | |||
Wistar rats | Skeletal muscle (Tibialis anterior) | Taurine | ~25% decrease | [20] |
Blood | No change |
Gene ID | Symbol | Ta (°C) | Sequence (5′–3′) | |
---|---|---|---|---|
55,991 | Ap3d1 | 55 | F | AGGAGCTGAAGCAGGACAAC |
R | CGCTTGAATGTGAACTTGGA | |||
78,653 | Bola3 | 61 | F | ACCTTGCAGATGTGTCCAGG |
R | CTAGAGCAGCATCCCAGAGC | |||
12,359 | Cat | 60 | F | CGAGGGTCACGAACTGTGTCA |
R | GGTCACCCACGATATCACCAGATAC | |||
14,319 | Fth | 57 | F | GTGGCTCTGAAGAACTTTGC |
R | AGTCATCACGGTCTGGTTTC | |||
14,325 | Ftl | 57 | F | CTTCCAGGATGTGCAGAAG |
R | ATCCAAGAGGGCCTGATT | |||
14,629 | Gclc | 57 | F | GTGGAGGCCAATATGAGGAA |
R | GGGTGCTTGTTTATGGCTTC | |||
73,046 | Glxr5 | 60 | F | GACTATGCGGCCTACAACGT |
R | GTTGAGGTACACTTGCGGGA | |||
15,368 | Hmox1 | 60 | F | GAGCCTGAATCGAGCAGAAC |
R | AGCCTTCTCTGGACACCTGA | |||
56,748 | Nfu1 | 60 | F | AAGCGTCTTCTTCGGACCAG |
R | CTCCTGCACAGTTGGCCTTA | |||
76,826 | Nubpl | 60 | F | TGTCTCCACACCTCAGGACA |
R | TCTTGCACCATCAGCACCAA | |||
22,042 | Tfr | 57 | F | AAGCCAGATCAGCATTCTCT |
R | CGGCATTTTCTTCTTCATCT | |||
21,366 | TauT | 55 | F | CGCTCTGCCTCCTCTTAGTC |
R | GAATTTGATGCCTTCACCAG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Seidel, U.; Lüersen, K.; Huebbe, P.; Rimbach, G. Taurine Enhances Iron-Related Proteins and Reduces Lipid Peroxidation in Differentiated C2C12 Myotubes. Antioxidants 2020, 9, 1071. https://doi.org/10.3390/antiox9111071
Seidel U, Lüersen K, Huebbe P, Rimbach G. Taurine Enhances Iron-Related Proteins and Reduces Lipid Peroxidation in Differentiated C2C12 Myotubes. Antioxidants. 2020; 9(11):1071. https://doi.org/10.3390/antiox9111071
Chicago/Turabian StyleSeidel, Ulrike, Kai Lüersen, Patricia Huebbe, and Gerald Rimbach. 2020. "Taurine Enhances Iron-Related Proteins and Reduces Lipid Peroxidation in Differentiated C2C12 Myotubes" Antioxidants 9, no. 11: 1071. https://doi.org/10.3390/antiox9111071