Zika Virus Infection and Antibody Neutralization in FcRn Expressing Placenta and Engineered Cell Lines
Abstract
:1. Introduction
2. Materials and Methods
2.1. Zika Virus and Cells
2.2. Antibodies
2.3. Assessment of ZIKV Infectivity and Antibody Mediated Neutralization
2.4. siRNA and Antibody Knockdown of FcRn Expression
2.5. PCR
2.6. Data Processing and Statistical Analysis
3. Results
3.1. ZIKV Infectivity in MDCK Cells That Overexpress Human FcRn versus Those That Do Not
3.2. ZIKV Infection Reduces FcRn Expression in Placental Trophoblast BeWo Cells
3.3. Non-Monotonous ZIKV Neutralizing Activity of Anti-Viral Antibodies
3.4. Discussion
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Qian, X.; Nguyen, H.N.; Song, M.M.; Hadiono, C.; Ogden, S.C.; Hammack, C.; Yao, B.; Hamersky, G.R.; Jacob, F.; Zhong, C.; et al. Brain-Region-Specific Organoids Using Mini-bioreactors for Modeling ZIKV Exposure. Cell 2016, 165, 1238–1254. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Russo, F.B.; Jungmann, P.; Beltrao-Braga, P.C.B. Zika infection and the development of neurological defects. Cell Microbiol. 2017, 19, e12744. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Moore, C.A.; Staples, J.E.; Dobyns, W.B.; Pessoa, A.; Ventura, C.V.; Fonseca, E.B.; Ribeiro, E.M.; Ventura, L.O.; Neto, N.N.; Arena, J.F.; et al. Characterizing the Pattern of Anomalies in Congenital Zika Syndrome for Pediatric Clinicians. JAMA Pediatr. 2017, 171, 288–295. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Jabrane-Ferrat, N.; Veas, F. Zika Virus Targets Multiple Tissues and Cell Types During the First Trimester of Pregnancy. Methods Mol. Biol. 2020, 2142, 235–249. [Google Scholar] [CrossRef] [PubMed]
- Villazana-Kretzer, D.L.; Wuertz, K.M.; Newhouse, D.; Damicis, J.R.; Dornisch, E.M.; Voss, K.M.; Muruato, A.E.; Paymaster, J.A.; Schmiedecke, S.S.; Edwards, S.M.; et al. ZIKV can infect human term placentas in the absence of maternal factors. Commun. Biol. 2022, 5, 243. [Google Scholar] [CrossRef] [PubMed]
- Rabelo, K.; de Souza, L.J.; Salomao, N.G.; Machado, L.N.; Pereira, P.G.; Portari, E.A.; Basilio-de-Oliveira, R.; Dos Santos, F.B.; Neves, L.D.; Morgade, L.F.; et al. Zika Induces Human Placental Damage and Inflammation. Front. Immunol. 2020, 11, 2146. [Google Scholar] [CrossRef]
- Hirsch, A.J.; Roberts, V.H.J.; Grigsby, P.L.; Haese, N.; Schabel, M.C.; Wang, X.; Lo, J.O.; Liu, Z.; Kroenke, C.D.; Smith, J.L.; et al. Zika virus infection in pregnant rhesus macaques causes placental dysfunction and immunopathology. Nat. Commun. 2018, 9, 263. [Google Scholar] [CrossRef] [Green Version]
- Cooper, H.J.; Iwamoto, M.; Lash, M.; Conners, E.E.; Paladini, M.; Slavinski, S.; Fine, A.D.; Kennedy, J.; Heinke, D.; Ciaranello, A.; et al. Maternal Zika Virus Infection: Association With Small-for-Gestational-Age Neonates and Preterm Birth. Obstet. Gynecol. 2019, 134, 1197–1204. [Google Scholar] [CrossRef] [Green Version]
- Souza, J.P.; Meio, M.; de Andrade, L.M.; Figueiredo, M.R.; Gomes Junior, S.C.; Pereira Junior, J.P.; Brickley, E.; Lopes Moreira, M.E. Adverse fetal and neonatal outcomes in pregnancies with confirmed Zika Virus infection in Rio de Janeiro, Brazil: A cohort study. PLoS Negl. Trop. Dis. 2021, 15, e0008893. [Google Scholar] [CrossRef]
- Zimmerman, M.G.; Quicke, K.M.; O’Neal, J.T.; Arora, N.; Machiah, D.; Priyamvada, L.; Kauffman, R.C.; Register, E.; Adekunle, O.; Swieboda, D.; et al. Cross-Reactive Dengue Virus Antibodies Augment Zika Virus Infection of Human Placental Macrophages. Cell Host Microbe 2018, 24, 731–742.e6. [Google Scholar] [CrossRef]
- Rathore, A.P.S.; Saron, W.A.A.; Lim, T.; Jahan, N.; St John, A.L. Maternal immunity and antibodies to dengue virus promote infection and Zika virus-induced microcephaly in fetuses. Sci. Adv. 2019, 5, eaav3208. [Google Scholar] [CrossRef] [Green Version]
- Xu, Y.; He, Y.; Momben-Abolfath, S.; Eller, N.; Norton, M.; Zhang, P.; Scott, D.; Struble, E.B. Entry and Disposition of Zika Virus Immune Complexes in a Tissue Culture Model of the Maternal-Fetal Interface. Vaccines 2021, 9, 145. [Google Scholar] [CrossRef]
- Grevys, A.; Nilsen, J.; Sand, K.M.K.; Daba, M.B.; Oynebraten, I.; Bern, M.; McAdam, M.B.; Foss, S.; Schlothauer, T.; Michaelsen, T.E.; et al. A human endothelial cell-based recycling assay for screening of FcRn targeted molecules. Nat. Commun. 2018, 9, 621. [Google Scholar] [CrossRef] [Green Version]
- Stapleton, N.M.; Einarsdottir, H.K.; Stemerding, A.M.; Vidarsson, G. The multiple facets of FcRn in immunity. Immunol. Rev. 2015, 268, 253–268. [Google Scholar] [CrossRef]
- Pyzik, M.; Sand, K.M.K.; Hubbard, J.J.; Andersen, J.T.; Sandlie, I.; Blumberg, R.S. The Neonatal Fc Receptor (FcRn): A Misnomer? Front. Immunol. 2019, 10, 1540. [Google Scholar] [CrossRef] [Green Version]
- Kiskova, T.; Mytsko, Y.; Schepelmann, M.; Helmer, H.; Fuchs, R.; Miedl, H.; Wadsack, C.; Ellinger, I. Expression of the neonatal Fc-receptor in placental-fetal endothelium and in cells of the placental immune system. Placenta 2019, 78, 36–43. [Google Scholar] [CrossRef]
- Jennewein, M.F.; Goldfarb, I.; Dolatshahi, S.; Cosgrove, C.; Noelette, F.J.; Krykbaeva, M.; Das, J.; Sarkar, A.; Gorman, M.J.; Fischinger, S.; et al. Fc Glycan-Mediated Regulation of Placental Antibody Transfer. Cell 2019, 178, 202–215.e14. [Google Scholar] [CrossRef] [Green Version]
- Chung, S.; Nguyen, V.; Lin, Y.L.; Lafrance-Vanasse, J.; Scales, S.J.; Lin, K.; Deng, R.; Williams, K.; Sperinde, G.; Li, J.J.; et al. An in vitro FcRn- dependent transcytosis assay as a screening tool for predictive assessment of nonspecific clearance of antibody therapeutics in humans. MAbs 2019, 11, 942–955. [Google Scholar] [CrossRef] [Green Version]
- Yoshida, M.; Claypool, S.M.; Wagner, J.S.; Mizoguchi, E.; Mizoguchi, A.; Roopenian, D.C.; Lencer, W.I.; Blumberg, R.S. Human neonatal Fc receptor mediates transport of IgG into luminal secretions for delivery of antigens to mucosal dendritic cells. Immunity 2004, 20, 769–783. [Google Scholar] [CrossRef] [Green Version]
- Liu, X.; Palaniyandi, S.; Zhu, I.; Tang, J.; Li, W.; Wu, X.; Ochsner, S.P.; Pauza, C.D.; Cohen, J.I.; Zhu, X. Human cytomegalovirus evades antibody-mediated immunity through endoplasmic reticulum-associated degradation of the FcRn receptor. Nat. Commun. 2019, 10, 3020. [Google Scholar] [CrossRef]
- Zhao, X.; Zhang, G.; Liu, S.; Chen, X.; Peng, R.; Dai, L.; Qu, X.; Li, S.; Song, H.; Gao, Z.; et al. Human Neonatal Fc Receptor Is the Cellular Uncoating Receptor for Enterovirus B. Cell 2019, 177, 1553–1565.e16. [Google Scholar] [CrossRef] [PubMed]
- Chen, X.; Qu, X.; Liu, C.; Zhang, Y.; Zhang, G.; Han, P.; Duan, Y.; Li, Q.; Wang, L.; Ruan, W.; et al. Human FcRn Is a Two-in-One Attachment-Uncoating Receptor for Echovirus 18. mBio 2022, 13, e0116622. [Google Scholar] [CrossRef] [PubMed]
- Anderson, D.; Neri, J.; Souza, C.R.M.; Valverde, J.G.; De Araujo, J.M.G.; Nascimento, M.; Branco, R.C.C.; Arrais, N.M.R.; Lassmann, T.; Blackwell, J.M.; et al. Zika Virus Changes Methylation of Genes Involved in Immune Response and Neural Development in Brazilian Babies Born With Congenital Microcephaly. J. Infect. Dis. 2021, 223, 435–440. [Google Scholar] [CrossRef] [PubMed]
- Polonio, C.M.; Peron, J.P.S. ZIKV Infection and miRNA Network in Pathogenesis and Immune Response. Viruses 2021, 13, 1992. [Google Scholar] [CrossRef]
- Stettler, K.; Beltramello, M.; Espinosa, D.A.; Graham, V.; Cassotta, A.; Bianchi, S.; Vanzetta, F.; Minola, A.; Jaconi, S.; Mele, F.; et al. Specificity, cross-reactivity, and function of antibodies elicited by Zika virus infection. Science 2016, 353, 823–826. [Google Scholar] [CrossRef] [Green Version]
- Wan, Y.; Shang, J.; Sun, S.; Tai, W.; Chen, J.; Geng, Q.; He, L.; Chen, Y.; Wu, J.; Shi, Z.; et al. Molecular Mechanism for Antibody-Dependent Enhancement of Coronavirus Entry. J. Virol. 2020, 94, e02015-19. [Google Scholar] [CrossRef] [Green Version]
- Abdiche, Y.N.; Yeung, Y.A.; Chaparro-Riggers, J.; Barman, I.; Strop, P.; Chin, S.M.; Pham, A.; Bolton, G.; McDonough, D.; Lindquist, K.; et al. The neonatal Fc receptor (FcRn) binds independently to both sites of the IgG homodimer with identical affinity. MAbs 2015, 7, 331–343. [Google Scholar] [CrossRef] [Green Version]
- Li, D.; Edwards, R.J.; Manne, K.; Martinez, D.R.; Schafer, A.; Alam, S.M.; Wiehe, K.; Lu, X.; Parks, R.; Sutherland, L.L.; et al. In vitro and in vivo functions of SARS-CoV-2 infection-enhancing and neutralizing antibodies. Cell 2021, 184, 4203–4219.e32. [Google Scholar] [CrossRef]
- Wang, Q.; Zhang, L.; Kuwahara, K.; Li, L.; Liu, Z.; Li, T.; Zhu, H.; Liu, J.; Xu, Y.; Xie, J.; et al. Immunodominant SARS Coronavirus Epitopes in Humans Elicited both Enhancing and Neutralizing Effects on Infection in Non-human Primates. ACS Infect. Dis. 2016, 2, 361–376. [Google Scholar] [CrossRef]
ZIKV 1086 | CCGCTGCCCAACACAAG |
ZIKV 1162c | CCACTAACGTTCTTTTGCAGACAT |
ZIKV 1107 (Probe) | AGCCTACCTTGACAAGCAGTCAGACACTCAA |
Canine GAPDH Forward | GCAAAGTGGATATTGTCGCC |
Canine GAPDH Reverse | TTTCCCGTTCTCAGCCTTG |
Canine GAPDH Probe | TGCCGTGGGTAGAATCATACTGGAAC |
Human GAPDH Forward | CCACTCCTCCACCTTTGAC |
Human GAPDH Reverse | ACCCTGTTGCT GTAGCCA |
Human GAPDH Probe | TTGCCCTCAACGACCACTTTGTC |
Human FcRn Forward | CTCTGTTGTGGAGAAGGATGAG |
Human FcRn Reverse | CGGTGGCTGGAATCACATTTA |
Human FcRn Probe | TTGGATCTCCCTTCGTGGAGACGA |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, Y.; He, Y.; Momben-Abolfath, S.; Vertrees, D.; Li, X.; Norton, M.G.; Struble, E.B. Zika Virus Infection and Antibody Neutralization in FcRn Expressing Placenta and Engineered Cell Lines. Vaccines 2022, 10, 2059. https://doi.org/10.3390/vaccines10122059
Xu Y, He Y, Momben-Abolfath S, Vertrees D, Li X, Norton MG, Struble EB. Zika Virus Infection and Antibody Neutralization in FcRn Expressing Placenta and Engineered Cell Lines. Vaccines. 2022; 10(12):2059. https://doi.org/10.3390/vaccines10122059
Chicago/Turabian StyleXu, Yanqun, Yong He, Sanaz Momben-Abolfath, Devin Vertrees, Xiaohong Li, Malgorzata G. Norton, and Evi Budo Struble. 2022. "Zika Virus Infection and Antibody Neutralization in FcRn Expressing Placenta and Engineered Cell Lines" Vaccines 10, no. 12: 2059. https://doi.org/10.3390/vaccines10122059