The Immunomodulatory Functions of Various CpG Oligodeoxynucleotideson CEF Cells and H9N2 Subtype Avian Influenza Virus Vaccination
Abstract
:1. Introduction
2. Materials and Methods
2.1. CpG ODNSynthesis, CEF and Chickens
2.2. Cell Treatment and MTT Assay
2.3. qPCR
2.4. Inactivated Vaccine Preparation and Chicken Immunization
2.5. HI Antibody Tests
2.6. MTT Assay
2.7. ELISA Assays
2.8. Molecular Assay for Spleen Lymphocyte Surface Activity
2.9. Statistics Analysis
3. Results
3.1. Viabilities of CpG on CEF
3.2. CpG Induced Cytokines Expression in CEF after Treatment
3.3. Viabilities of S-CpG on CEF
3.4. S-CpG Stimulated the Expressions of Immune-Related Genes in CEF
3.5. CpG ODN Stimulated HI Antibody Production
3.6. CpG ODN Induced Cytokine and Specific Antibody Production
3.7. CpG ODN Stimulated theT Lymphocyte Molecular Expressions
3.8. CpG ODN Stimulated Antigen Presentation Related Molecular Expressions
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Farrokhi, S.; Abbasirad, N.; Movahed, A.; Khazaei, H.A.; Pishjoo, M.; Rezaei, N. TLR9-based immunotherapy for the treatment of allergic diseases. Immunotherapy 2017, 9, 339–346. [Google Scholar] [CrossRef] [PubMed]
- Hanagata, N. CpG oligodeoxynucleotide nanomedicines for the prophylaxis or treatment of cancers, infectious diseases, and allergies. Int. J. Nanomed. 2017, 12, 515–531. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Shirota, H.; Tross, D.; Klinman, D.M. CpG Oligonucleotides as Cancer Vaccine Adjuvants. Vaccines 2015, 3, 390–407. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vollmer, J.; Weeratna, R.; Payette, P.; Jurk, M.; Schetter, C.; Laucht, M.; Wader, T.; Tluk, S.; Liu, M.; Davis, H.L.; et al. Characterization of three CpG oligodeoxynucleotide classes with distinct immunostimulatory activities. Eur. J. Immunol. 2004, 34, 251–262. [Google Scholar] [CrossRef]
- Hartmann, G.; Battiany, J.; Poeck, H.; Wagner, M.; Kerkmann, M.; Lubenow, N.; Rothenfusser, S.; Endres, S. Rational design of new CpG oligonucleotides that combine B cell activation with high IFN-alpha induction in plasmacytoid dendritic cells. Eur. J. Immunol. 2003, 33, 1633–1641. [Google Scholar] [CrossRef]
- Krug, A.; Towarowski, A.; Britsch, S.; Rothenfusser, S.; Hornung, V.; Bals, R.; Giese, T.; Engelmann, H.; Endres, S.; Krieg, A.M.; et al. Toll-like receptor expression reveals CpG DNA as a unique microbial stimulus for plasmacytoid dendritic cells which synergizes with CD40 ligand to induce high amounts of IL-12. Eur. J. Immunol. 2001, 31, 3026–3037. [Google Scholar] [CrossRef]
- Verthelyi, D.; Ishii, K.J.; Gursel, M.; Takeshita, F.; Klinman, D.M. Human peripheral blood cells differentially recognize and respond to two distinct CpG motifs. J. Immunol. 2001, 166, 2372–2377. [Google Scholar] [CrossRef]
- Mutwiri, G.K.; Nichani, A.K.; Babiuk, S.; Babiuk, L.A. Strategies for enhancing the immunostimulatory effects of CpG oligodeoxynucleotides. J. Control. Release 2004, 97, 1–17. [Google Scholar] [CrossRef]
- Marshall, J.D.; Fearon, K.; Abbate, C.; Subramanian, S.; Yee, P.; Gregorio, J.; Coffman, R.L.; Van Nest, G. Identification of a novel CpG DNA class and motif that optimally stimulate B cell and plasmacytoid dendritic cell functions. J. Leukocyte Biol. 2003, 73, 781–792. [Google Scholar] [CrossRef]
- Gunawardana, T.; Ahmed, K.A.; Goonewardene, K.; Popowich, S.; Kurukulasuriya, S.; Karunarathna, R.; Gupta, A.; Lockerbie, B.; Foldvari, M.; Tikoo, S.K.; et al. Synthetic CpG-ODN rapidly enriches immune compartments in neonatal chicks to induce protective immunity against bacterial infections. Sci. Rep. 2019, 9, 341. [Google Scholar] [CrossRef] [Green Version]
- Chen, T.H.; Chen, C.C.; Huang, M.H.; Huang, C.H.; Jan, J.T.; Wu, S.C. Use of PELC/CpG Adjuvant for Intranasal Immunization with Recombinant Hemagglutinin to Develop H7N9 Mucosal Vaccine. Vaccines 2020, 8, 240. [Google Scholar] [CrossRef] [PubMed]
- Keestra, A.M.; de Zoete, M.R.; Bouwman, L.I.; van Putten, J.P.M. Chicken TLR21 Is an Innate CpG DNA Receptor Distinct from Mammalian TLR9. J. Immunol. 2010, 185, 460–467. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chuang, Y.C.; Tseng, J.C.; Yang, J.X.; Liu, Y.L.; Yeh, D.W.; Lai, C.Y.; Yu, G.Y.; Hsu, L.C.; Huang, C.M.; Chuang, T.H. Toll-Like Receptor 21 of Chicken and Duck Recognize a Broad Array of Immunostimulatory CpG-oligodeoxynucleotide Sequences. Vaccines 2020, 8, 639. [Google Scholar] [CrossRef] [PubMed]
- Hartmann, G.; Weeratna, R.D.; Ballas, Z.K.; Payette, P.; Blackwell, S.; Suparto, I.; Rasmussen, W.L.; Waldschmidt, M.; Sajuthi, D.; Purcell, R.H.; et al. Delineation of a CpG phosphorothioate oligodeoxynucleotide for activating primate immune responses in vitro and in vivo. J. Immunol. 2000, 164, 1617–1624. [Google Scholar] [CrossRef] [Green Version]
- Yuk, S.S.; Lee, D.H.; Park, J.K.; Eredene-Ochir, T.O.; Kwon, J.H.; Noh, J.Y.; Gomis, S.; Song, C.S. Immune response in domestic ducks following intradermal delivery of inactivated vaccine against H5N1 highly pathogenic avian influenza virus adjuvanted with oligodeoxynucleotides containing CpG motifs. Poult. Sci. 2015, 94, 1836–1842. [Google Scholar] [CrossRef]
- Lu, W.; Cui, C.; Wang, Y.; Sun, X.; Wang, S.; Yang, M.; Yu, Y.; Wang, L. CpG ODN as an adjuvant arouses the vigor of B cells by relieving the negative regulation of surface TLR9 to enhance the antibody response to vaccine. Appl. Microbiol. Biotechnol. 2021, 105, 4213–4224. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Zhang, Y.; Lin, A.; Sui, Q.; Zhang, C.; Tian, Z.; Zhang, J. Phosphorothioate modification of the TLR9 ligand CpG ODN inhibits poly(I:C)-induced apoptosis of hepatocellular carcinoma by entry blockade. Cancer Lett. 2014, 355, 76–84. [Google Scholar] [CrossRef]
- Tian, G.; Zhang, S.; Li, Y.; Bu, Z.; Liu, P.; Zhou, J.; Li, C.; Shi, J.; Yu, K.; Chen, H. Protective efficacy in chickens, geese and ducks of an H5N1-inactivated vaccine developed by reverse genetics. Virology 2005, 341, 153–162. [Google Scholar] [CrossRef] [Green Version]
- Yeh, D.W.; Lai, C.Y.; Liu, Y.L.; Lu, C.H.; Tseng, P.H.; Yuh, C.H.; Yu, G.Y.; Liu, S.J.; Leng, C.H.; Chuang, T.H. CpG-oligodeoxynucleotides developed for grouper toll-like receptor (TLR) 21s effectively activate mouse and human TLR9s mediated immune responses. Sci. Rep. 2017, 7, 17297. [Google Scholar] [CrossRef] [Green Version]
- Fu, J.; Liang, J.; Kang, H.; Lin, J.; Yu, Q.; Yang, Q. Effects of different CpG oligodeoxynucleotides with inactivated avian H5N1 influenza virus on mucosal immunity of chickens. Poult. Sci. 2013, 92, 2866–2875. [Google Scholar] [CrossRef] [PubMed]
- Krieg, A.M. CpG DNA: A pathogenic factor in systemic lupus erythematosus? J. Clin. Immunol. 1995, 15, 284–292. [Google Scholar] [CrossRef] [PubMed]
- Liang, H.; Nishioka, Y.; Reich, C.F.; Pisetsky, D.S.; Lipsky, P.E. Activation of human B cells by phosphorothioate oligodeoxynucleotides. J. Clin. Investig. 1996, 98, 1119–1129. [Google Scholar] [CrossRef] [PubMed]
- Ohtsuki, S.; Takahashi, Y.; Inoue, T.; Takakura, Y.; Nishikawa, M. Reconstruction of Toll-like receptor 9-mediated responses in HEK-Blue hTLR9 cells by transfection of human macrophage scavenger receptor 1 gene. Sci. Rep. 2017, 7, 13661. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Hartmann, G.; Krieg, A.M. Mechanism and function of a newly identified CpG DNA motif in human primary B cells. J. Immunol. 2000, 164, 944–953. [Google Scholar] [CrossRef]
- Singh, S.M.; Alkie, T.N.; Hodgins, D.C.; Nagy, E.; Shojadoost, B.; Sharif, S. Systemic immune responses to an inactivated, whole H9N2 avian influenza virus vaccine using class B CpG oligonucleotides in chickens. Vaccine 2015, 33, 3947–3952. [Google Scholar] [CrossRef]
- Dalpke, A.H.; Zimmermann, S.; Albrecht, I.; Heeg, K. Phosphodiester CpG oligonucleotides as adjuvants: Polyguanosine runs enhance cellular uptake and improve immunostimulative activity of phosphodiester CpG oligonucleotides in vitro and in vivo. Immunology 2002, 106, 102–112. [Google Scholar] [CrossRef]
- Linghua, Z.; Xingshan, T.; Fengzhen, Z. In vivo oral administration effects of various oligodeoxynucleotides containing synthetic immunostimulatory motifs in the immune response to pseudorabies attenuated virus vaccine in newborn piglets. Vaccine 2008, 26, 224–233. [Google Scholar] [CrossRef]
- Yamamoto, S.; Kuramoto, E.; Shimada, S.; Tokunaga, T. In vitro augmentation of natural killer cell activity and production of interferon-alpha/beta and -gamma with deoxyribonucleic acid fraction from Mycobacterium bovis BCG. Jpn. J. Cancer Res. 1988, 79, 866–873. [Google Scholar] [CrossRef]
- Zeng, Q.; Li, H.; Jiang, H.; Yu, J.; Wang, Y.; Ke, H.; Gong, T.; Zhang, Z.; Sun, X. Tailoring polymeric hybrid micelles with lymph node targeting ability to improve the potency of cancer vaccines. Biomaterials 2017, 122, 105–113. [Google Scholar] [CrossRef]
- Krieg, A.M. CpG motifs in bacterial DNA and their immune effects. Annu. Rev. Immunol. 2002, 20, 709–760. [Google Scholar] [CrossRef] [PubMed]
- Butterfield, J.S.S.; Biswas, M.; Shirley, J.L.; Kumar, S.R.P.; Sherman, A.; Terhorst, C.; Ling, C.; Herzog, R.W. TLR9-Activating CpG-B ODN but Not TLR7 Agonists Triggers Antibody Formation to Factor IX in Muscle Gene Transfer. Hum. Gene Ther. Methods 2019, 30, 81–92. [Google Scholar] [CrossRef] [PubMed]
- Marasco, E.; Farroni, C.; Cascioli, S.; Marcellini, V.; Scarsella, M.; Giorda, E.; Piano Mortari, E.; Leonardi, L.; Scarselli, A.; Valentini, D.; et al. B-cell activation with CD40L or CpG measures the function of B-cell subsets and identifies specific defects in immunodeficient patients. Eur. J. Immunol. 2017, 47, 131–143. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence(5′-3′) | Thio-Modification |
---|---|---|
CpG1 | TCGGCGCGCGCCGTCGTCGTTT | |
CpG2 | TCGTCGTTTTCGAGGCCGTCG | |
CpG3 | TCGTCGTTTTGTCGTTTTGTCGT | |
CpG4 | TCGTCGTTTTCGTTGCGCGCCG | Full-text thio |
CpG5 | TCGTCGTTTTGTGTTGGGGGG | Partial thio (terminal G region) |
CpG6 | TCGTCGTTTTCGGCGGCCGCCG | |
CpG2007(Positive control) | TCGTCGTTGTCGTTTTGTCGTT | Full-text thio |
Gene Name | Primer Name | Primer Sequence (5′-3′) | Primer Size (More) | Tm (°C) | Product Size (bp) | GenBank Number |
---|---|---|---|---|---|---|
IL-2 | IL-2-F | ACACCGGAAGTGAATGCAAG | 20 | 61.1 | 81 | AY510091.1 |
IL-2-R | CAAAGTTGGTCAGTTCATGGAGA | 23 | 61.43 | |||
IL-6 | IL-6-F | AAATCCCTCCTCGCCAATCT | 20 | 62.18 | 106 | HM179640.1 |
IL-6-R | CCCTCACGGTCTTCTCCATAAA | 22 | 62.55 | |||
IL-12 | IL-12-F | ACTTTCCTTTGCTGCCCTTCTGG | 23 | 60.35 | 90 | DQ202328.3 |
IL-12-R | GCTGGTGTCTCATCGTTCCACTC | 23 | 60.47 | |||
TLR21 | TLR21-F | TCTCACAGGCGGAGGTCTTCAC | 22 | 61.74 | 116 | JQ042914.1 |
TLR21-R | GCGAGGTTGGATGTCAGAGATGTC | 24 | 60.06 | |||
IFN-α | IFN-α-F | CACGACATCCTTCAGCACCTCTTC | 24 | 60.21 | 87 | GU119896.1 |
IFN-α-R | GAGGAGGCTTTGGCGTTGGC | 20 | 62.95 | |||
IFN-γ | IFN-γ-F | CGACATCCTTCAGCACCTCTTCAC | 24 | 60.21 | 85 | FJ977575.1 |
IFN-γ-R | GAGGAGGCTTTGGCGTTGGC | 20 | 62.95 | |||
β-actin | β-actin-F | CAACACAGTGCTGTCTGGTGG | 21 | 61.68 | 205 | NM_205518.1 |
β-actin-R | CAAAGTTGGTCAGTTCATGGAGA | 23 | 61.43 |
Groups | White Oil (mL) | AIV (mL) | CpG ODN (μg) | PBS(mL) |
---|---|---|---|---|
AIV + white oil + S-CpG 4 | 1.3 | 0.9 | 20 | 0 |
AIV + white oil + S-CpG 5 | 1.3 | 0.9 | 20 | 0 |
AIV + white oil + S-CpG2007 | 1.3 | 0.9 | 20 | 0 |
AIV + white oil | 1.3 | 0.9 | 0 | 0.4 |
PBS + white oil | 1.3 | 0 | 0 | 1.3 |
AIV + S-CpG 4 | 0 | 0.9 | 20 | 1.3 |
AIV + S-CpG 5 | 0 | 0.9 | 20 | 1.3 |
AIV+ S-CpG2007 | 0 | 0.9 | 20 | 1.3 |
AIV +PBS | 0 | 0.9 | 0 | 1.7 |
PBS | 0 | 0 | 0 | 2.6 |
Gene Name | Primer Name | Primer Sequence (5′-3′) | Primer Size (More) | Tm (°C) | Product Size (bp) | GenBank Number |
---|---|---|---|---|---|---|
CD3 | CD3-F | GGACGCTCCCACCATATCAG | 20 | 60 | 113 | NM_205512.1 |
CD3-R | AAGCTCGTGACATGAGTCCC | 20 | 57.1 | |||
CD4 | CD4-F | TGTGGAACTGTCACCTCGTG | 20 | 56.8 | 145 | NM_204649.1 |
CD4-R | CACATGCATGCAAGGCCAAT | 20 | 62.4 | |||
CD8 | CD8-F | GCTGTACTTCAGCTCGGGAC | 20 | 57.2 | 105 | NM_205235.1 |
CD8-R | ATGTCCTTGTTGACGTGGCT | 20 | 57.5 | |||
CD80 | CD80-F | TGTGACCCTCTTTGTCACCG | 20 | 58.7 | 140 | NM_001079739.1 |
CD80-R | GGAATCCACGGATTTCGGGT | 20 | 63.2 | |||
CD86 | CD86-F | ACCAGCAAGCTGAATATCCCA | 21 | 59.7 | 105 | NM_001037839.1 |
CD86-R | GACTAGCGGCACTGAGACAA | 20 | 56 | |||
CD154 | CD154-F | TGCAGAAATGTCAGACGGGA | 20 | 59.5 | 113 | NM_204733.1 |
CD154-R | CAACTCCTCACTGGCTGTCC | 20 | 57.5 | |||
BAAF | BAAF-F | CCTGCTTGCAACTGATTGCT | 20 | 58.8 | 106 | NM_204327.2 |
BAAF-R | TCTTCCAGAGCTGTTCCACG | 20 | 58.4 | |||
β-actin | β-actin-F | GAGAAATTGT GCGTGACATCA | 21 | 56.6 | 152 | NM_205518.1 |
β-actin-R | CCTGAACCTCTCATTGCCA | 19 | 58.3 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, C.; Huang, X.; Cai, J.; Lu, A.; Hao, S.; Zhang, Z.; Sun, H.; Feng, X. The Immunomodulatory Functions of Various CpG Oligodeoxynucleotideson CEF Cells and H9N2 Subtype Avian Influenza Virus Vaccination. Vaccines 2022, 10, 616. https://doi.org/10.3390/vaccines10040616
Li C, Huang X, Cai J, Lu A, Hao S, Zhang Z, Sun H, Feng X. The Immunomodulatory Functions of Various CpG Oligodeoxynucleotideson CEF Cells and H9N2 Subtype Avian Influenza Virus Vaccination. Vaccines. 2022; 10(4):616. https://doi.org/10.3390/vaccines10040616
Chicago/Turabian StyleLi, Chenfei, Xiangyu Huang, Jiaxi Cai, Anran Lu, Shanshan Hao, Ze Zhang, Haifeng Sun, and Xiuli Feng. 2022. "The Immunomodulatory Functions of Various CpG Oligodeoxynucleotideson CEF Cells and H9N2 Subtype Avian Influenza Virus Vaccination" Vaccines 10, no. 4: 616. https://doi.org/10.3390/vaccines10040616