An Efficacious Transgenic Strategy for Triple Knockout of Xeno-Reactive Antigen Genes GGTA1, CMAH, and B4GALNT2 from Jeju Native Pigs
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Approval
2.2. Animals and Chemicals
2.3. Primary Cell Culture
2.4. Designing of Guide RNA (gRNA)
2.5. Preparation of Vector Expressing Cas9 and gRNA Targeting Triple Gene
2.6. Transfection of Primary Cell
2.7. Oocyte Collection and In Vitro Maturation
2.8. Somatic Cell Nuclear Transfer and Embryo Transfer
2.9. Extraction of DNA and Sequence Analysis
2.10. Histologic Analysis and Immunofluorescence Microscopy
3. Results
3.1. The Procedure of Production Triple-Knockout JNPs
3.2. Expression Patterns of α-Gal, Neu5Gc, and Sd(a) in the Kidneys, Heart, Lung, and Liver of TKO JNPs
3.3. Human IgM/IgG Binding Analysis of the Kidneys, Heart, Lungs, and Liver of TKO JNP
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Klymiuk, N.; Aigner, B.; Brem, G.; Wolf, E. Genetic modification of pigs as organ donors for xenotransplantation. Mol. Reprod. Dev. 2010, 77, 209–221. [Google Scholar] [CrossRef]
- Iwase, H.; Kobayashi, T. Current status of pig kidney xenotransplantation. Int. J. Surg. 2015, 23, 229–233. [Google Scholar] [CrossRef]
- Butler, J.R.; Ladowski, J.; Martens, G.R.; Tector, M.; Tector, A.J. Recent advances in genome editing and creation of genetically modified pigs. Int. J. Surg. 2015, 23, 217–222. [Google Scholar] [CrossRef]
- Cooper, D.K.; Pierson, R.N., 3rd; Hering, B.J.; Mohiuddin, M.M.; Fishman, J.A.; Denner, J.; Ahn, C.; Azimzadeh, A.M.; Buhler, L.; Cowan, P.J.; et al. Regulation of Clinical Xenotransplantation—Time for a Reappraisal. Transplantation 2017, 101, 1766–1769. [Google Scholar] [CrossRef]
- Oura, T.; Hotta, K.; Lei, J.; Markmann, J.; Rosales, I.; Dehnadi, A.; Kawai, K.; Ndishabandi, D.; Smith, R.-N.; Cosimi, A.B.; et al. Immunosuppression With CD40 Costimulatory Blockade Plus Rapamycin for Simultaneous Islet-Kidney Transplantation in Nonhuman Primates. Am. J. Transplant. 2017, 17, 646–656. [Google Scholar] [CrossRef]
- Yamamoto, T.; Iwase, H.; Patel, D.; Jagdale, A.; Ayares, D.; Anderson, D.; Eckhoff, D.E.; Cooper, D.K.C.; Hara, H. Old World Monkeys are less than ideal transplantation models for testing pig organs lacking three carbohydrate antigens (Triple-Knockout). Sci. Rep. 2020, 10, 9771. [Google Scholar] [CrossRef]
- Mohiuddin, M.M.; Singh, A.K.; Corcoran, P.C.; Iii, M.L.T.; Clark, T.; Lewis, B.G.; Hoyt, R.F.; Eckhaus, M.; Iii, R.N.P.; Belli, A.; et al. Chimeric 2C10R4 anti-CD40 antibody therapy is critical for long-term survival of GTKO.hCD46.hTBM pig-to-primate cardiac xenograft. Nat. Commun. 2016, 7, 11138. [Google Scholar] [CrossRef]
- Cui, Y.; Yamamoto, T.; Raza, S.; Morsi, M.; Nguyen, H.Q.; Ayares, D.; Cooper, D.K.; Hara, H. Evidence for GTKO/β4GalNT2KO Pigs as the Preferred Organ-source for Old World Nonhuman Primates as a Preclinical Model of Xenotransplantation. Transplant. Direct 2020, 6, e590. [Google Scholar] [CrossRef]
- Estrada, J.L.; Martens, G.; Li, P.; Adams, A.; Newell, K.A.; Ford, M.L.; Butler, J.R.; Sidner, R.; Tector, M.; Tector, J. Evaluation of human and non-human primate antibody binding to pig cells lacking GGTA 1/ CMAH /β4Gal NT 2 genes. Xenotransplantation 2015, 22, 194–202. [Google Scholar] [CrossRef]
- Hara, H.; Ezzelarab, M.; Rood, P.P.M.; Lin, Y.J.; Busch, J.; Ibrahim, Z.; Zhu, X.; Ball, S.; Ayares, D.; Zeevi, A.; et al. Allosensitized humans are at no greater risk of humoral rejection of GT-KO pig organs than other humans. Xenotransplantation 2006, 13, 357–365. [Google Scholar] [CrossRef]
- Yang, J.Y.C.; Sarwal, M.M. Transplant genetics and genomics. Nat. Rev. Genet. 2017, 18, 309–326. [Google Scholar] [CrossRef]
- Wieczorek, M.; Abualrous, E.T.; Sticht, J.; Álvaro-Benito, M.; Stolzenberg, S.; Noé, F.; Freund, C. Major Histocompatibility Complex (MHC) Class I and MHC Class II Proteins: Conformational Plasticity in Antigen Presentation. Front. Immunol. 2017, 8, 292. [Google Scholar] [CrossRef]
- Martens, G.R.; Reyes, L.M.; Li, P.; Butler, J.R.; Ladowski, J.M.; Estrada, J.L.; Sidner, R.A.; Eckhoff, D.E.; Tector, M.; Tector, A.J. Humoral Reactivity of Renal Transplant-Waitlisted Patients to Cells From GGTA1/CMAH/B4GalNT2, and SLA Class I Knockout Pigs. Transplantation 2017, 101, e86–e92. [Google Scholar] [CrossRef]
- Ladowski, J.; Reyes, L.M.; Martens, G.R.; Butler, J.R.; Wang, Z.-Y.; Eckhoff, D.E.; Tector, M.; Tector, A.J. Swine Leukocyte Antigen Class II Is a Xenoantigen. Transplantation 2018, 102, 249–254. [Google Scholar] [CrossRef]
- Kim, G.; Roy, P.K.; Fang, X.; Hassan, B.M.; Cho, J. Improved preimplantation development of porcine somatic cell nuclear transfer embryos by caffeine treatment. J. Veter.-Sci. 2019, 20, e31. [Google Scholar] [CrossRef]
- Kaneko, H.; Kikuchi, K.; Men, N.T.; Noguchi, J. Embryo production by intracytoplasmic injection of sperm retrieved from Meishan neonatal testicular tissue cryopreserved and grafted into nude mice. Anim. Sci. J. 2018, 90, 158–166. [Google Scholar] [CrossRef]
- Yoshioka, K. Development and Application of a Chemically Defined Medium for the In Vitro Production of Porcine Embryos. J. Reprod. Dev. 2011, 57, 9–16. [Google Scholar] [CrossRef]
- Boquest, A.C.; Grupen, C.G.; Harrison, S.J.; McIlfatrick, S.M.; Ashman, R.J.; D’Apice, A.J.; Nottle, M.B. Production of Cloned Pigs from Cultured Fetal Fibroblast Cells. Biol. Reprod. 2002, 66, 1283–1287. [Google Scholar] [CrossRef]
- Lutz, A.J.; Li, P.; Estrada, J.L.; Sidner, R.A.; Chihara, R.K.; Downey, S.M.; Burlak, C.; Wang, Z.-Y.; Reyes, L.M.; Ivary, B.; et al. Double knockout pigs deficient in N-glycolylneuraminic acid and Galactose α-1,3-Galactose reduce the humoral barrier to xenotransplantation. Xenotransplantation 2013, 20, 27–35. [Google Scholar] [CrossRef]
- Salama, A.; Evanno, G.; Harb, J.; Soulillou, J.-P. Potential deleterious role of anti-Neu5Gc antibodies in xenotransplantation. Xenotransplantation 2015, 22, 85–94. [Google Scholar] [CrossRef]
- Kim, D.; Seong, P.; Cho, S.; Kim, J.; Lee, J.; Jo, C.; Lim, D. Fatty acid composition and meat quality traits of organically reared Korean native black pigs. Livest. Sci. 2009, 120, 96–102. [Google Scholar] [CrossRef]
- Kilkenny, C.; Browne, W.J.; Cuthill, I.C.; Emerson, M.; Altman, D.G. Improving Bioscience Research Reporting: The ARRIVE Guidelines for Reporting Animal Research. PLoS Biol. 2010, 8, e1000412. [Google Scholar] [CrossRef] [PubMed]
- Ran, F.A.; Hsu, P.D.; Wright, J.; Agarwala, V.; Scott, D.A.; Zhang, F. Genome engineering using the CRISPR-Cas9 system. Nat. Protoc. 2013, 8, 2281–2308. [Google Scholar] [CrossRef] [PubMed]
- Ekser, B.; Li, P.; Cooper, D.K. Xenotransplantation: Past, present, and future. Curr. Opin. Organ Transplant. 2017, 22, 513–521. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.-Y.; Martens, G.R.; Blankenship, R.L.; Sidner, R.A.; Li, P.; Estrada, J.L.; Tector, M.; Tector, A.J. Eliminating Xenoantigen Expression on Swine RBC. Transplantation 2017, 101, 517–523. [Google Scholar] [CrossRef]
- Amano, S.; Shimomura, N.; Kaji, Y.; Ishii, K.; Yamagami, S.; Araie, M. Antigenicity of porcine cornea as xenograft. Curr. Eye Res. 2003, 26, 313–318. [Google Scholar] [CrossRef]
- Sato, M.; Miyoshi, K.; Nagao, Y.; Nishi, Y.; Ohtsuka, M.; Nakamura, S.; Sakurai, T.; Watanabe, S. The combinational use of CRISPR/Cas9-based gene editing and targeted toxin technology enables efficient biallelic knockout of the α-1,3-galactosyltransferase gene in porcine embryonic fibroblasts. Xenotransplantation 2014, 21, 291–300. [Google Scholar] [CrossRef]
- Zhou, X.; Xin, J.; Fan, N.; Zou, Q.; Huang, J.; Ouyang, Z.; Zhao, Y.; Zhao, B.; Liu, Z.; Lai, S.; et al. Generation of CRISPR/Cas9-mediated gene-targeted pigs via somatic cell nuclear transfer. Cell. Mol. Life Sci. 2014, 72, 1175–1184. [Google Scholar] [CrossRef]
- Wang, X.; Zhou, J.; Cao, C.; Huang, J.; Hai, T.; Wang, Y.; Zheng, Q.; Zhang, H.; Qin, G.; Miao, X.; et al. Efficient CRISPR/Cas9-mediated biallelic gene disruption and site-specific knockin after rapid selection of highly active sgRNAs in pigs. Sci. Rep. 2015, 5, 13348. [Google Scholar] [CrossRef]
- Mohiuddin, M.M.; Corcoran, P.C.; Singh, A.K.; Azimzadeh, A.M.; Hoyt, R.F., Jr.; Thomas, M.L.; Eckhaus, M.; Seavey, C.N.; Ayares, D.; Pierson, R.N.; et al. B-Cell Depletion Extends the Survival of GTKO.hCD46Tg Pig Heart Xenografts in Baboons for up to 8 Months. Am. J. Transplant. 2012, 12, 763–771. [Google Scholar] [CrossRef] [Green Version]
- Lee, W.; Hara, H.; Ezzelarab, M.B.; Iwase, H.; Bottino, R.; Long, C.; Ramsoondar, J.; Ayares, D.; Cooper, D.K. Initial in vitro studies on tissues and cells from GTKO/CD46/NeuGcKO pigs. Xenotransplantation 2016, 23, 137–150. [Google Scholar] [CrossRef] [PubMed]
- Burlak, C.; Bern, M.; Brito, A.E.; Isailovic, D.; Wang, Z.-Y.; Estrada, J.L.; Li, P.; Tector, A.J. N-linked glycan profiling of GGTA1/CMAH knockout pigs identifies new potential carbohydrate xenoantigens. Xenotransplantation 2013, 20, 277–291. [Google Scholar] [CrossRef] [PubMed]
- Wang, Z.-Y.; Burlak, C.; Estrada, J.L.; Li, P.; Tector, M.F.; Tector, A.J. Erythrocytes from GGTA1/CMAH knockout pigs: Implications for xenotransfusion and testing in non-human primates. Xenotransplantation 2014, 21, 376–384. [Google Scholar] [CrossRef] [PubMed]
- Zhang, R.; Wang, Y.; Chen, L.; Wang, R.; Li, C.; Li, X.; Fang, B.; Ren, X.; Ruan, M.; Liu, J.; et al. Reducing immunoreactivity of porcine bioprosthetic heart valves by genetically-deleting three major glycan antigens, GGTA1/β4GalNT2/CMAH. Acta Biomater. 2018, 72, 196–205. [Google Scholar] [CrossRef] [PubMed]
- Wang, R.-G.; Ruan, M.; Zhang, R.-J.; Chen, L.; Li, X.-X.; Fang, B.; Li, C.; Ren, X.-Y.; Liu, J.-Y.; Xiong, Q.; et al. Antigenicity of tissues and organs from GGTA1/CMAH/β4GalNT2 triple gene knockout pigs. J. Biomed. Res. 2018, 33, 235–243. [Google Scholar]
- Cooper, D.K.; Ekser, B.; Ramsoondar, J.; Phelps, C.; Ayares, D. The role of genetically engineered pigs in xenotransplantation research. J. Pathol. 2016, 238, 288–299. [Google Scholar] [CrossRef]
- Xu, K.; Yu, H.; Chen, S.; Zhang, Y.; Guo, J.; Yang, C.; Jiao, D.; Nguyen, T.D.; Zhao, H.; Wang, J.; et al. Production of Triple-Gene (GGTA1, B2M and CIITA)-Modified Donor Pigs for Xenotransplantation. Front. Vet. Sci. 2022, 9, 848833. [Google Scholar] [CrossRef]
sgRNA (Name_Target Exon) | Sequences (5’-3’) | On-Target Score | Off-Target Score |
---|---|---|---|
GGTA1_7 | AACCAGATGGAAGGCTCCAGTGG | 70.5 | 35.7 |
CMAH_4 | CCT CCTGGAAGCTTCTGTCAAGA | 72.1 | 32.6 |
B4GALNT2_4 | GAGGCATCACTTCCACCCCGTGG | 74.3 | 40.3 |
Name | Sequence (5’-3’) | Annealing Temp. (°C) | Product Size (bp) |
---|---|---|---|
GGTA1_7F | GGATTCAAGGCCAGTCACCA | 59 | 241 |
GGTA1_7R | CCTTCCGACAGCAAAAACCG | 59.1 | |
GGTA1_7F_Se | CCAGCTGACTGGGGCTAAAA | 60.0 | 408 |
GGTA1_7R_Se | AAAATGGCCCTGTGACACCA | 60.1 | |
CMAH_4F | GCTCTGCTGATCTCTAACACG | 58.5 | 520 |
CMAH_4R | GTTGACAAGAGGGACCCCAA | 59.5 | |
CMAH_4F_2 | AGTCAGGGAAACACGAAGAGTC | 59.9 | 458 |
CMAH_4R_2 | ACAAGAGGGACCCCAATGAC | 59.3 | |
B4GALNT2_4F | CAGGGACAGGTATCAAGGCA | 59.1 | 324 |
B4GALNT2_4R | CAGTGGTGGAAACAGTGAGA | 57.4 | |
B4GALNT2_4F_Se | AAGAACGAACCAGTGGGAGC | 60.2 | 467 |
B4GALNT2_4R_Se | CCATGTCCAGCTTCACGGAT | 60.1 |
No. of Embryos Transferred | No. of Recipients (%) | No. of Cloned Piglets | Live Birth | No. of Knockout Piglets | Weight * (g) | |
---|---|---|---|---|---|---|
Day 30 | Delivered | |||||
1564 | 3/9 (33.3) | 2/9 (22.2) | 5 | 5 | 5 | 627.8 ± 100.2 |
ET No. | No. of Transferred Embryos | Day 30 Pregnancy Status * | No. of Piglets Born (Knockout) | Specificity |
---|---|---|---|---|
J-01 | 204 | + | Abortion | |
J-02 | 205 | − | ||
J-03 | 166 | − | ||
J-04 | 178 | + | 3 (3) | 3 live births |
J-05 | 153 | − | ||
J-06 | 149 | − | ||
J-07 | 161 | − | ||
J-08 | 172 | + | 2 (2) | 2 live births |
J-09 | 176 | − |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yoon, S.; Lee, S.; Park, C.; Choi, H.; Yoo, M.; Lee, S.C.; Hyun, C.-H.; Kim, N.; Kang, T.; Son, E.; et al. An Efficacious Transgenic Strategy for Triple Knockout of Xeno-Reactive Antigen Genes GGTA1, CMAH, and B4GALNT2 from Jeju Native Pigs. Vaccines 2022, 10, 1503. https://doi.org/10.3390/vaccines10091503
Yoon S, Lee S, Park C, Choi H, Yoo M, Lee SC, Hyun C-H, Kim N, Kang T, Son E, et al. An Efficacious Transgenic Strategy for Triple Knockout of Xeno-Reactive Antigen Genes GGTA1, CMAH, and B4GALNT2 from Jeju Native Pigs. Vaccines. 2022; 10(9):1503. https://doi.org/10.3390/vaccines10091503
Chicago/Turabian StyleYoon, Seungwon, Seulgi Lee, Chungyu Park, Hyunyong Choi, Minwoo Yoo, Sang Chul Lee, Cheol-Ho Hyun, Nameun Kim, Taeyoung Kang, Eugene Son, and et al. 2022. "An Efficacious Transgenic Strategy for Triple Knockout of Xeno-Reactive Antigen Genes GGTA1, CMAH, and B4GALNT2 from Jeju Native Pigs" Vaccines 10, no. 9: 1503. https://doi.org/10.3390/vaccines10091503