Preliminary In Vivo Evidence of Oral Selenium Supplementation as a Potentiating Agent on a Vector-Based COVID-19 Vaccine in BALB/c Mice
Abstract
:1. Introduction
2. Materials and Methods
2.1. Ethical Approvals
2.2. Study Design and Sample Size Determination
2.3. Model Animals
2.4. Preparation and Administration of Treatments
2.5. Sample Collection
2.6. Serological Evaluation of SARS-CoV-2 Anti-Spike Protein IgG
2.7. Extraction of Total RNA from Spleen Tissue
2.8. Relative Quantification of IL-6 and IL-10 mRNA Levels
2.9. Haematological and Biochemical Analysis
2.10. Data Analysis
3. Results
3.1. Qualitative Determination of SARS-CoV-2 Anti-Spike IgG Antibody
3.1.1. Janssen COVID-19 Vaccine Supplemented with Oral Commercial Selenium Supplement and Sodium Selenite Induced Robust Immune Response
3.1.2. Supplementation with Selenium Increased IL-6 and IL-10 mRNA Levels in Mice Models
3.2. Toxicological Parameters in BALB/c Mice
Cautious Supplementation with Selenium Shows Generally Normal Toxicological Parameters
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- World Health Organization. COVID-19 Weekly Epidemiological Update; World Health Organization: Geneva, Switzerland, 2022; pp. 1–33. [Google Scholar]
- Alexandridi, M.; Mazej, J.; Palermo, E.; Hiscott, J. The Coronavirus pandemic—2022: Viruses, variants & vaccines. Cytokine Growth Factor Rev. 2022, 63, 1–9. [Google Scholar] [CrossRef] [PubMed]
- Stuart, A.S.V.; Shaw, R.H.; Liu, X.; Greenland, M.; Aley, P.K.; Andrews, N.J.; Cameron, J.C.; Charlton, S.; Clutterbuck, E.A.; Collins, A.M.; et al. Immunogenicity, safety, and reactogenicity of heterologous COVID-19 primary vaccination incorporating mRNA, viral-vector, and protein-adjuvant vaccines in the UK (Com-COV2): A single-blind, randomised, phase 2, non-inferiority trial. Lancet 2022, 399, 36–49. [Google Scholar] [CrossRef] [PubMed]
- Pelletier, A.N.; Sekaly, R.P.; Tomalka, J.A. Translating known drivers of COVID-19 disease severity to design better SARS-CoV-2 vaccines. Curr. Opin. Virol. 2022, 52, 89–101. [Google Scholar] [CrossRef]
- Forchette, L.; Sebastian, W.; Liu, T. A Comprehensive Review of COVID-19 Virology, Vaccines, Variants, and Therapeutics. Curr. Med. Sci. 2021, 41, 1037–1051. [Google Scholar] [CrossRef]
- Teerawattananon, Y.; Anothaisintawee, T.; Pheerapanyawaranun, C.; Botwright, S.; Akksilp, K.; Sirichumroonwit, N.; Budtarad, N.; Isaranuwatchai, W. A systematic review of methodological approaches for evaluating real-world effectiveness of COVID-19 vaccines: Advising resource-constrained settings. PLoS ONE 2022, 17, e0261930. [Google Scholar] [CrossRef]
- Zhang, N.; Li, K.; Liu, Z.; Nandakumar, K.S.; Jiang, S. A Perspective on the Roles of Adjuvants in Developing Highly Potent COVID-19 Vaccines. Viruses 2022, 14, 387. [Google Scholar] [CrossRef]
- Mao, L.; Chen, Z.; Wang, Y.; Chen, C. Design and application of nanoparticles as vaccine adjuvants against human corona virus infection. J. Inorg. Biochem. 2021, 219, 111454. [Google Scholar] [CrossRef]
- Pyrzynska, K.; Sentkowska, A. Biosynthesis of selenium nanoparticles using plant extracts. J. Nanostruct. Chem. 2021, 12, 467–480. [Google Scholar] [CrossRef]
- Ivory, K.; Prieto, E.; Spinks, C.; Armah, C.N.; Goldson, A.J.; Dainty, J.R.; Nicoletti, C. Selenium supplementation has beneficial and detrimental effects on immunity to influenza vaccine in older adults. Clin. Nutr. 2017, 36, 407–415. [Google Scholar] [CrossRef] [Green Version]
- Avery, J.C.; Hoffmann, P.R. Selenium, selenoproteins, and immunity. Nutrients 2018, 10, 1203. [Google Scholar] [CrossRef] [PubMed]
- Qiao, L.; Dou, X.; Yan, S.; Zhang, B.; Xu, C. Biogenic selenium nanoparticles synthesized by: Lactobacillus casei ATCC 393 alleviate diquat-induced intestinal barrier dysfunction in C57BL/6 mice through their antioxidant activity. Food Funct. 2020, 11, 3020–3031. [Google Scholar] [CrossRef] [PubMed]
- Kotur, N.; Skakic, A.; Klaassen, K.; Gasic, V.; Zukic, B.; Skodric-Trifunovic, V.; Stjepanovic, M.; Zivkovic, Z.; Ostojic, O.; Stevanovic, G.; et al. Association of Vitamin D, Zinc and Selenium Related Genetic Variants With COVID-19 Disease Severity. Front. Nutr. 2021, 8, 689419. [Google Scholar] [CrossRef] [PubMed]
- Fakhrolmobasheri, M.; Mazaheri-Tehrani, S.; Kieliszek, M.; Zeinalian, M.; Abbasi, M.; Karimi, F.; Mozafari, A.M. COVID-19 and Selenium Deficiency: A Systematic Review. Biol. Trace Elem. Res. 2021, 200, 3945–3956. [Google Scholar] [CrossRef] [PubMed]
- Khatiwada, S.; Subedi, A. A Mechanistic Link Between Selenium and Coronavirus Disease 2019. Curr. Nutr. Rep. 2021, 2019, 125–136. [Google Scholar] [CrossRef]
- Demircan, K.; Chillon, T.S.; Sun, Q.; Heller, R.A.; Klingenberg, G.J.; Hirschbil-Bremer, I.M.; Seemann, P.; Diegmann, J.; Bachmann, M.; Moghaddam, A.; et al. Humoral immune response to COVID-19 mRNA vaccination in relation to selenium status. Redox Biol. 2022, 50, 102242. [Google Scholar] [CrossRef]
- Charan, J.; Kantharia, N. How to calculate sample size in animal studies? J. Pharmacol. Pharmacother. 2013, 4, 303–306. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Zhang, L.; Xia, K.; Dai, J.; Huang, J.; Wang, Y.; Zhu, G.; Hu, Z.; Zeng, Z.; Jia, Y. Effects of dietary selenium on immune function of spleen in mice. J. Funct. Foods 2022, 89, 104914. [Google Scholar] [CrossRef]
- Zealanders, N. The Role of Selenium in Human Immunity. Med. J. Zambia 2014, 41, 181–185. [Google Scholar]
- Medrano, G.; Guan, P.; Barlow-Anacker, A.J.; Gosain, A. Comprehensive selection of reference genes for quantitative RT-PCR analysis of murine extramedullary hematopoiesis during development. PLoS ONE 2017, 12, e0181881. [Google Scholar] [CrossRef] [Green Version]
- Odukoya, O.A.; Ajjan, R.; Lim, K.; Watson, P.F.; Weetman, A.P.; Cooke, I.D. The pattern of cytokine mRNA expression in ovarian endometriomata. Mol. Hum. Reprod. 1997, 3, 393–397. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thompson, K.; Maltby, J.; Fallowfield, J.; Mcaulay, M.; Millward-Sadler, H.; Sheron, N. Interleukin-10 expression and function in experimental murine liver inflammation and fibrosis. Hepatology 1998, 28, 1597–1606. [Google Scholar] [CrossRef] [PubMed]
- Silva-Santana, G.; Bax, J.C.; Fernandes, D.C.S.; Bacellar, D.T.L.; Hooper, C.; Dias, A.A.S.O.; Silva, C.B.; de Souza, A.M.; Ramos, S.; Santos, R.A.; et al. Clinical hematological and biochemical parameters in Swiss, BALB/c, C57BL/6 and B6D2F1 Mus musculus. Anim. Model. Exp. Med. 2020, 3, 304–315. [Google Scholar] [CrossRef] [PubMed]
- Ayyappan Unnithan, A.K. Supplementation of Micronutrients against COVID-19. Arch. Clin. Biomed. Res. 2022, 06, 1–8. [Google Scholar] [CrossRef]
- Kelleni, M.T. Biomedicine & Pharmacotherapy Resveratrol-zinc nanoparticles or pterostilbene-zinc: Potential COVID-19 mono and adjuvant therapy. Biomed. Pharmacother. 2021, 139, 111626. [Google Scholar] [CrossRef]
- Razeghi Jahromi, S.; Moradi Tabriz, H.; Togha, M.; Ariyanfar, S.; Ghorbani, Z.; Naeeni, S.; Haghighi, S.; Jazayeri, A.; Montazeri, M.; Talebpour, M.; et al. The correlation between serum selenium, zinc, and COVID-19 severity: An observational study. BMC Infect. Dis. 2021, 21, 899. [Google Scholar] [CrossRef]
- Huang, Z.; Rose, A.H.; Hoffmann, P.R. The role of selenium in inflammation and immunity: From molecular mechanisms to therapeutic opportunities. Antioxid. Redox Signal. 2012, 16, 705–743. [Google Scholar] [CrossRef] [Green Version]
- Shenkin, A. Selenium in Intravenous Nutrition. Gastroenterology 2009, 137, S61–S69. [Google Scholar] [CrossRef]
- Farshi, E. Cytokine Storm Response to COVID-19 Vaccinations. J. Cytokine Biol. 2021, 6, 2–3. [Google Scholar]
- Sun, E.; Xu, H.; Liu, Q.; Zhou, J.; Zuo, P.; Wang, J. The mechanism for the effect of selenium supplementation on immunity. Biol. Trace Elem. Res. 1995, 48, 231–238. [Google Scholar] [CrossRef] [PubMed]
- Thyroiditis, H.; Kryczyk-kozioł, J.; Prochownik, E.; Bła, A.; Słowiaczek, M. Assessment of the Effect of Selenium Supplementation on Production of Selected Cytokines in Women with Hashimoto’s Thyroiditis. Nutrients 2022, 14, 2869. [Google Scholar] [CrossRef]
- Karaba, A.H.; Zhu, X.; Benner, S.E.; Akinde, O.; Eby, Y.; Wang, K.H.; Saraf, S.; Garonzik-wang, J.M.; Klein, S.L.; Bailey, J.R.; et al. Higher Proinflammatory Cytokines Are Associated With Increased Antibody Titer After a Third Dose of SARS-CoV-2 Vaccine in Solid Organ Transplant Recipients. Transplantation 2022, 106, 835–841. [Google Scholar] [CrossRef] [PubMed]
- Zanza, C.; Romenskaya, T.; Manetti, A.C.; Franceschi, F.; La Russa, R.; Bertozzi, G.; Maiese, A.; Savioli, G.; Volonnino, G.; Longhitano, Y. Cytokine Storm in COVID-19: Immunopathogenesis and Therapy. Medicina 2022, 58, 144. [Google Scholar] [CrossRef]
- Oliveira-Silva, J.; Reis, T.; Lopes, C.; Batista-Silva, R.; Ribeiro, R.; Marques, G.; Pacheco, V.; Rodrigues, T.; Afonso, A.; Pinheiro, V.; et al. Long-term serological SARS-CoV-2 IgG kinetics following mRNA COVID-19 vaccine: Real-world data from a large cohort of healthcare workers. Int. J. Infect. Dis. 2022, 122, 1–7. [Google Scholar] [CrossRef] [PubMed]
- Bellamkonda, N.; Lambe, U.P.; Sawant, S.; Nandi, S.S.; Chakraborty, C.; Shukla, D. Immune Response to SARS-CoV-2 Vaccines. Biomedicines 2022, 10, 1464. [Google Scholar] [CrossRef]
Group | Treatment Received (3 Mice per Group) |
---|---|
Non-Immunized (NI) | 40 μL Normal Saline (0.9% NaCl) |
VAC40 | 40 μL (4 × 109 VP) of Janssen vaccine |
VAC40 + SUP | 40 μL (4 × 109 VP) of Janssen vaccine + 200 μL daily diet of commercial selenium supplement |
VAC40 + SS | 40 μL of Janssen vaccine (4 × 109 VP) + 200 μL daily diet of sodium selenite |
SUP | 200 μL daily diet of commercial selenium supplement (0.04 mg/kg) |
SS | 200 μL daily diet of sodium selenite (0.04 mg/kg in normal saline) |
Step | Time | Temperature | Cycles |
---|---|---|---|
Pre-Denaturation | 10 min | 95 °C | 1 |
Denaturation | 15 s | 95 °C | 45 |
Annealing/Extension | 1 min | 60 °C |
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) | Amplicon Size (bp) | Tm (°C) | %GC | NCBI Accession | MGI Sequence ID | Reference |
---|---|---|---|---|---|---|---|---|
IL-6 | GAGGATACCACTCCCAACAGACC | AAGTGCATCATCGTTGTTCATACA | 141 | 60 | 56.52 37.50 | XM_021163844.1 | 96559 | [21] |
IL-10 | ATGCCCCAAGCTGAGAACCAAGACCCA | TCTCAAGGGGCTGGGTCAGCTATCCCA | 75 | 60 | 43.4 50.00 | NM_010548.2 | 96537 | [22] |
HPRT1 | TCCTCCTCAGACCGCTTTT | CCTGGTTCATCATCGCTAATC | 90 | 60 | 52.63 47.62 | NM_013556.2 | 96217 | [20] |
GADPH | TGTCCGTCGTGGATCTGAC | CCTGCTTCACCACCTTCTTG | 75 | 60 | 57.89 55.00 | 14433 | 95640 | [20] |
PARAMETER | VAC40 | VAC40 + SUP | VAC40 + SS | SUP | SS | NI Control | Range |
---|---|---|---|---|---|---|---|
RBC (×106/µL) | 7.91 ± 0.01 | 2.26 ± 0.01 * | 8.53 ± 0.01 | 8.40 ± 0.00 | 8.60 ± 0.00 | 7.83 ± 0.12 | 7.1–9.5 |
HGB (g/dL) | 13.93 ± 0.06 | 4.10 ± 0.10 * | 15.03 ± 0.06 | 14.53 ± 0.06 | 15.37 ± 0.06 | 14.70 ± 0.00 | 11.6–15.8 |
HCT (%) | 37.47 ± 0.06 | 10.70 ± 0.00 * | 40.70 ± 0.00 | 38.83 ± 0.06 | 38.87 ± 0.06 | 37.37 ± 0.06 | 37.4–51.7 |
MCV (fL) | 47.27 ± 0.12 | 47.30 ± 0.10 | 47.70 ± 0.10 | 46.13 ± 0.06 | 45.27 ± 0.06 | 48.10 ± 0.00 | 41.5–57.4 |
MCH (pg) | 17.60 ± 0.17 | 17.50 ± 0.00 | 17.50 ± 0.00 | 17.33 ± 0.06 | 17.77 ± 0.06 | 18.97 ± 0.06 | 14.1–18.4 |
MCHC (g/dL) | 37.07 ± 0.06 | 36.90 ± 0.10 | 36.90 ± 0.10 | 37.87 ± 0.06 | 39.43 ± 0.06 | 39.30 ± 0.00 | 30.5–34.2 |
WBC (×103/µL) | 8.53 ± 0.15 | 1.57 ± 0.06 * | 5.07 ± 0.06 | 5.57 ± 0.15 | 7.10 ± 0.10 | 5.60 ± 0.00 | - |
NEU/SEG (×102/µL) | 14.00 ± 1.00 | 13.67 ± 0.58 | 8.33 ± 0.58 | 15.00 ± 0.00 | 13.00 ± 0.00 | 9.00 ± 0.00 | 11–29 |
LYM (×102/µL) | 78.33 ± 0.58 | 75.33 ± 0.58 | 86.00 ± 1.00 | 69.67 ± 0.58 | 76.67 ± 0.58 | 86.33 ± 1.15 | 65–87 |
MON (×102/µL) | 6.97 ± 0.06 | 11.00 ± 0.00 * | 5.33 ± 0.58 | 14.00 ± 1.00 * | 10.00 ± 1.00 * | 5.67 ± 0.58 | 0–6 |
EOS (×102/µL) | 1.00 ± 0.00 | 1.33 ± 0.58 | 1.00 ± 0.00 | 1.33 ± 0.58 | 0.33 ± 0.58 | 1.67 ± 0.58 | 0–5 |
BOS (×102/µL) | 0.00 ± 0.00 | 0.00 ± 0.00 | 0.00 ± 0.00 | 0.00 ± 0.00 | 0.00 ± 0.00 | 0.00 ± 0.00 | 0–1 |
PLT (×103/µL) | 921.33 ± 2.52 * | 65.00 ± 0.00* | 1110.00 ± 0.00 * | 1099.00 ± 1.00 * | 1081.67 ± 0.58 * | 897.00 ± 1.73 | 325–888 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Mudenda, M.; Kimani, J.; Kinyua, J.; Kimotho, J. Preliminary In Vivo Evidence of Oral Selenium Supplementation as a Potentiating Agent on a Vector-Based COVID-19 Vaccine in BALB/c Mice. Vaccines 2023, 11, 57. https://doi.org/10.3390/vaccines11010057
Mudenda M, Kimani J, Kinyua J, Kimotho J. Preliminary In Vivo Evidence of Oral Selenium Supplementation as a Potentiating Agent on a Vector-Based COVID-19 Vaccine in BALB/c Mice. Vaccines. 2023; 11(1):57. https://doi.org/10.3390/vaccines11010057
Chicago/Turabian StyleMudenda, Muunda, Josephine Kimani, Johnson Kinyua, and James Kimotho. 2023. "Preliminary In Vivo Evidence of Oral Selenium Supplementation as a Potentiating Agent on a Vector-Based COVID-19 Vaccine in BALB/c Mice" Vaccines 11, no. 1: 57. https://doi.org/10.3390/vaccines11010057