A Chymotrypsin-Dependent Live-Attenuated Influenza Vaccine Provides Protective Immunity against Homologous and Heterologous Viruses
Abstract
:1. Introduction
2. Materials and Methods
2.1. Cell Lines
2.2. Plasmids and Proteins
CA4-R344F-F | CCGTCTATTCAATCTTTCGGCCTATTTGGGGCCATTG | 37 bp |
CA4-R344F-R | CCCCAAATAGGCCGAAAGATTGAATAGACGGGATATTCCTCAATC | 45 bp |
CA4-R344W-F | CCGTCTATTCAATCTTGGGGCCTATTTGGGGCCATTG | 37 bp |
CA4-R344W-R | CCCCAAATAGGCCCCAAGATTGAATAGACGGGATATTCCTCAATC | 45 bp |
CA4-R344Y-F | CCGTCTATTCAATCTTACGGCCTATTTGGGGCCATTG | 37 bp |
CA4-R344Y-R | CCCCAAATAGGCCGTAAGATTGAATAGACGGGATATTCCTCAATC | 45 bp |
2.3. Generation and Passage of Influenza Viruses
2.4. Immunofluorescence
2.5. ELISA
2.6. Plaque Assay
2.7. Ethics Statements
2.8. Animal Experiments
2.9. Quantitative Reverse Transcriptase PCR (qRT-PCR)
H1HA-F | GCATAACGGGAAACTATGCAA | 21 bp |
H1HA-R | GCTTGCTGTGGAGAGTGATTC | 21 bp |
H1HA-probe | FAM-TTACCCAAATGCAATGGGGCTACCCC-BBQ | 26 bp |
2.10. HA Assay
2.11. HAI Assay
2.12. Neutralization Assays
2.13. Statistics
3. Results
3.1. The Rescue of a Chymotrypsin-Dependent Influenza Virus by Reverse Genetics
3.2. The Similar Biological Characteristics between the Rescued Virus with Its Parent In Vitro
3.3. The Safety of CA04-F in Mice
3.4. The Humoral Immune Response Activity after Mucosal Immunization with CA04-F
3.5. Protective Activity of Homologous and Heterologous Viruses after CA04-F Mucosal Immunization
4. Discussion
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Iuliano, A.D.; Roguski, K.M.; Chang, H.H.; Muscatello, D.J.; Palekar, R.; Tempia, S.; Cohen, C.; Gran, J.M.; Schanzer, D.; Cowling, B.J.; et al. Estimates of global seasonal influenza-associated respiratory mortality: A modelling study. Lancet 2018, 391, 1285–1300. [Google Scholar] [CrossRef]
- Dushoff, J.; Plotkin, J.B.; Viboud, C.; Earn, D.J.; Simonsen, L. Mortality due to influenza in the United States--an annualized regression approach using multiple-cause mortality data. Am. J. Epidemiol. 2006, 163, 181–187. [Google Scholar] [CrossRef]
- Palese, P. Influenza: Old and new threats. Nat. Med. 2004, 10 (Suppl. S12), S82–S87. [Google Scholar] [CrossRef]
- Hulo, C.; de Castro, E.; Masson, P.; Bougueleret, L.; Bairoch, A.; Xenarios, I.; Le Mercier, P. ViralZone: A knowledge resource to understand virus diversity. Nucleic Acids Res. 2011, 39, D576–D582. [Google Scholar] [CrossRef]
- Hutchinson, E.C.; Yamauchi, Y. Understanding Influenza. Methods Mol. Biol. 2018, 1836, 1–21. [Google Scholar]
- Fereidouni, S.; Starick, E.; Karamendin, K.; Genova, C.D.; Scott, S.D.; Khan, Y.; Harder, T.; Kydyrmanov, A. Genetic characterization of a new candidate hemagglutinin subtype of influenza A viruses. Emerg. Microbes Infect. 2023, 12, 2225645. [Google Scholar] [CrossRef]
- Bahl, K.; Senn, J.J.; Yuzhakov, O.; Bulychev, A.; Brito, L.A.; Hassett, K.J.; Laska, M.E.; Smith, M.; Almarsson, Ö.; Thompson, J.; et al. Preclinical and Clinical Demonstration of Immunogenicity by mRNA Vaccines against H10N8 and H7N9 Influenza Viruses. Mol. Ther. J. Am. Soc. Gene Ther. 2017, 25, 1316–1327. [Google Scholar] [CrossRef]
- Taubenberger, J.K.; Morens, D.M. 1918 Influenza: The mother of all pandemics. Emerg. Infect. Dis. 2006, 12, 15–22. [Google Scholar] [CrossRef]
- Dawood, F.S.; Iuliano, A.D.; Reed, C.; Meltzer, M.I.; Shay, D.K.; Cheng, P.Y.; Bandaranayake, D.; Breiman, R.F.; Brooks, W.A.; Buchy, P.; et al. Estimated global mortality associated with the first 12 months of 2009 pandemic influenza A H1N1 virus circulation: A modelling study. Lancet Infect. Dis. 2012, 12, 687–695. [Google Scholar] [CrossRef]
- Venkatesan, P. Avian influenza spillover into mammals. Lancet Microbe 2023, 4, e492. [Google Scholar] [CrossRef]
- Bi, Y.; Tan, S.; Yang, Y.; Wong, G.; Zhao, M.; Zhang, Q.; Wang, Q.; Zhao, X.; Li, L.; Yuan, J.; et al. Clinical and Immunological Characteristics of Human Infections with H5N6 Avian Influenza Virus. Clin. Infect. Dis. 2019, 68, 1100–1109. [Google Scholar] [CrossRef]
- Dawood, F.S.; Chung, J.R.; Kim, S.S.; Zimmerman, R.K.; Nowalk, M.P.; Jackson, M.L.; Jackson, L.A.; Monto, A.S.; Martin, E.T.; Belongia, E.A.; et al. Interim Estimates of 2019-20 Seasonal Influenza Vaccine Effectiveness—United States, February 2020. Morb. Mortal. Wkly. Rep. 2020, 69, 177–182. [Google Scholar] [CrossRef]
- Widge, A.T.; Hofstetter, A.R.; Houser, K.V.; Awan, S.F.; Chen, G.L.; Burgos Florez, M.C.; Berkowitz, N.M.; Mendoza, F.; Hendel, C.S.; Holman, L.A.; et al. An influenza hemagglutinin stem nanoparticle vaccine induces cross-group 1 neutralizing antibodies in healthy adults. Sci. Transl. Med. 2023, 15, eade4790. [Google Scholar] [CrossRef]
- Kanekiyo, M.; Wei, C.J.; Yassine, H.M.; McTamney, P.M.; Boyington, J.C.; Whittle, J.R.; Rao, S.S.; Kong, W.P.; Wang, L.; Nabel, G.J. Self-assembling influenza nanoparticle vaccines elicit broadly neutralizing H1N1 antibodies. Nature 2013, 499, 102–106. [Google Scholar] [CrossRef]
- Sutton, T.C.; Chakraborty, S.; Mallajosyula, V.V.A.; Lamirande, E.W.; Ganti, K.; Bock, K.W.; Moore, I.N.; Varadarajan, R.; Subbarao, K. Protective efficacy of influenza group 2 hemagglutinin stem-fragment immunogen vaccines. NPJ Vaccines 2017, 2, 35. [Google Scholar] [CrossRef]
- Shet, A.; Carr, K.; Danovaro-Holliday, M.C.; Sodha, S.V.; Prosperi, C.; Wunderlich, J.; Wonodi, C.; Reynolds, H.W.; Mirza, I.; Gacic-Dobo, M.; et al. Impact of the SARS-CoV-2 pandemic on routine immunisation services: Evidence of disruption and recovery from 170 countries and territories. Lancet Glob. Health 2022, 10, e186–e194. [Google Scholar] [CrossRef]
- Cao, H.; Mai, J.; Zhou, Z.; Li, Z.; Duan, R.; Watt, J.; Chen, Z.; Bandara, R.A.; Li, M.; Ahn, S.K.; et al. Intranasal HD-Ad vaccine protects the upper and lower respiratory tracts of hACE2 mice against SARS-CoV-2. Cell Biosci. 2021, 11, 202. [Google Scholar] [CrossRef]
- Ye, T.; Jiao, Z.; Li, X.; He, Z.; Li, Y.; Yang, F.; Zhao, X.; Wang, Y.; Huang, W.; Qin, M.; et al. Inhaled SARS-CoV-2 vaccine for single-dose dry powder aerosol immunization. Nature 2023, 624, 630–638. [Google Scholar] [CrossRef]
- Hassan, A.O.; Kafai, N.M.; Dmitriev, I.P.; Fox, J.M.; Smith, B.K.; Harvey, I.B.; Chen, R.E.; Winkler, E.S.; Wessel, A.W.; Case, J.B.; et al. A Single-Dose Intranasal ChAd Vaccine Protects Upper and Lower Respiratory Tracts against SARS-CoV-2. Cell 2020, 183, 169–184.e13. [Google Scholar] [CrossRef]
- Zhang, L.; Jiang, Y.; He, J.; Chen, J.; Qi, R.; Yuan, L.; Shao, T.; Zhao, H.; Chen, C.; Chen, Y.; et al. Intranasal influenza-vectored COVID-19 vaccine restrains the SARS-CoV-2 inflammatory response in hamsters. Nat. Commun. 2023, 14, 4117. [Google Scholar] [CrossRef]
- Chen, J.; Wang, P.; Yuan, L.; Zhang, L.; Zhang, L.; Zhao, H.; Chen, C.; Wang, X.; Han, J.; Chen, Y.; et al. A live attenuated virus-based intranasal COVID-19 vaccine provides rapid, prolonged, and broad protection against SARS-CoV-2. Sci. Bull. 2022, 67, 1372–1387. [Google Scholar] [CrossRef]
- Han, P.F.; Li, J.; Hu, Y.; Sun, W.; Zhang, S.; Yang, Y.H.; Li, Y.C.; Kang, X.P.; Wu, X.Y.; Zhu, S.Y.; et al. H5N1 influenza A virus with K193E and G225E double mutations in haemagglutinin is attenuated and immunogenic in mice. J. Gen. Virol. 2015, 96, 2522–2530. [Google Scholar] [CrossRef]
- Ayllon, J.; García-Sastre, A. The NS1 protein: A multitasking virulence factor. Curr. Top. Microbiol. Immunol. 2015, 386, 73–107. [Google Scholar]
- Jefferson, T.; Rivetti, A.; Harnden, A.; Di Pietrantonj, C.; Demicheli, V. Vaccines for preventing influenza in healthy children. Cochrane Database Syst. Rev. 2008, 2, Cd004879. [Google Scholar]
- Böttcher, E.; Matrosovich, T.; Beyerle, M.; Klenk, H.D.; Garten, W.; Matrosovich, M. Proteolytic activation of influenza viruses by serine proteases TMPRSS2 and HAT from human airway epithelium. J. Virol. 2006, 80, 9896–9898. [Google Scholar] [CrossRef]
- Böttcher-Friebertshäuser, E.; Garten, W.; Matrosovich, M.; Klenk, H.D. The hemagglutinin: A determinant of pathogenicity. Curr. Top. Microbiol. Immunol. 2014, 385, 3–34. [Google Scholar]
- Wang, G.; Chen, R.; Huang, P.; Hong, J.; Cao, J.; Wu, Q.; Zheng, W.; Lin, L.; Han, Q.; Chen, Y.; et al. Adefovir dipivoxil efficiently inhibits the proliferation of pseudorabies virus in vitro and in vivo. Antivir. Res. 2021, 186, 105014. [Google Scholar] [CrossRef]
- Wang, G.; Huang, P.; Hong, J.; Fu, R.; Wu, Q.; Chen, R.; Lin, L.; Han, Q.; Chen, H.; Chen, Y.; et al. Establishment of a rapid ELISPOT assay for influenza virus titration and neutralizing antibody detection. J. Med. Virol. 2020, 93, 3455–3464. [Google Scholar] [CrossRef]
- Shen, C.; Chen, J.; Li, R.; Zhang, M.; Wang, G.; Stegalkina, S.; Zhang, L.; Chen, J.; Cao, J.; Bi, X.; et al. A multimechanistic antibody targeting the receptor binding site potently cross-protects against influenza B viruses. Sci. Transl. Med. 2017, 9, aam5752. [Google Scholar] [CrossRef]
- Fiore, A.E.; Shay, D.K.; Broder, K.; Iskander, J.K.; Uyeki, T.M.; Mootrey, G.; Bresee, J.S.; Cox, N.J. Prevention and control of seasonal influenza with vaccines: Recommendations of the Advisory Committee on Immunization Practices (ACIP), 2009. MMWR Recomm. Rep. Morb. Mortal. Wkly. Report. Recomm. Rep. 2009, 58, 1–52. [Google Scholar]
- Geall, A.J.; Verma, A.; Otten, G.R.; Shaw, C.A.; Hekele, A.; Banerjee, K.; Cu, Y.; Beard, C.W.; Brito, L.A.; Krucker, T.; et al. Nonviral delivery of self-amplifying RNA vaccines. Proc. Natl. Acad. Sci. USA 2012, 109, 14604–14609. [Google Scholar] [CrossRef]
- Shinya, K.; Fujii, Y.; Ito, H.; Ito, T.; Kawaoka, Y. Characterization of a neuraminidase-deficient influenza a virus as a potential gene delivery vector and a live vaccine. J. Virol. 2004, 78, 3083–3088. [Google Scholar] [CrossRef]
- Victor, S.T.; Watanabe, S.; Katsura, H.; Ozawa, M.; Kawaoka, Y. A replication-incompetent PB2-knockout influenza A virus vaccine vector. J. Virol. 2012, 86, 4123–4128. [Google Scholar] [CrossRef]
- Watanabe, T.; Watanabe, S.; Kim, J.H.; Hatta, M.; Kawaoka, Y. Novel approach to the development of effective H5N1 influenza A virus vaccines: Use of M2 cytoplasmic tail mutants. J. Virol. 2008, 82, 2486–2492. [Google Scholar] [CrossRef]
- Webby, R.J.; Perez, D.R.; Coleman, J.S.; Guan, Y.; Knight, J.H.; Govorkova, E.A.; McClain-Moss, L.R.; Peiris, J.S.; Rehg, J.E.; Tuomanen, E.I.; et al. Responsiveness to a pandemic alert: Use of reverse genetics for rapid development of influenza vaccines. Lancet 2004, 363, 1099–1103. [Google Scholar] [CrossRef]
- Masic, A.; Babiuk, L.A.; Zhou, Y. Reverse genetics-generated elastase-dependent swine influenza viruses are attenuated in pigs. J. Gen. Virol. 2009, 90 Pt 2, 375–385. [Google Scholar] [CrossRef]
- Higham, A.; Rattray, N.J.; Dewhurst, J.A.; Trivedi, D.K.; Fowler, S.J.; Goodacre, R.; Singh, D. Electronic cigarette exposure triggers neutrophil inflammatory responses. Respir. Res. 2016, 17, 56. [Google Scholar] [CrossRef]
- Chan, Y.A.; Zhan, S.H. The Emergence of the Spike Furin Cleavage Site in SARS-CoV-2. Mol. Biol. Evol. 2022, 39, msab327. [Google Scholar] [CrossRef]
- Johnson, B.A.; Xie, X.; Bailey, A.L.; Kalveram, B.; Lokugamage, K.G.; Muruato, A.; Zou, J.; Zhang, X.; Juelich, T.; Smith, J.K.; et al. Loss of furin cleavage site attenuates SARS-CoV-2 pathogenesis. Nature 2021, 591, 293–299. [Google Scholar] [CrossRef]
- Wang, G.; Zha, Z.; Huang, P.; Sun, H.; Huang, Y.; He, M.; Chen, T.; Lin, L.; Chen, Z.; Kong, Z.; et al. Structures of pseudorabies virus capsids. Nat. Commun. 2022, 13, 1533. [Google Scholar] [CrossRef]
- Li, Z.; Zhang, X.; Dong, L.; Pang, J.; Xu, M.; Zhong, Q.; Zeng, M.S.; Yu, X. CryoEM structure of the tegumented capsid of Epstein-Barr virus. Cell Res. 2020, 30, 873–884. [Google Scholar] [CrossRef]
- Wang, G.; Cao, J.; Gui, M.; Huang, P.; Zhang, L.; Qi, R.; Chen, R.; Lin, L.; Han, Q.; Lin, Y.; et al. The potential of swine pseudorabies virus attenuated vaccine for oncolytic therapy against malignant tumors. J. Exp. Clin. Cancer Res. CR 2023, 42, 284. [Google Scholar] [CrossRef]
- Rehman, H.; Silk, A.W.; Kane, M.P.; Kaufman, H.L. Into the clinic: Talimogene laherparepvec (T-VEC), a first-in-class intratumoral oncolytic viral therapy. J. Immunother. Cancer 2016, 4, 53. [Google Scholar] [CrossRef]
- Kaugars, K.; Dardick, J.; de Oliveira, A.P.; Weiss, K.A.; Lukose, R.; Kim, J.; Leung, L.; Rajagopalan, S.; Wolin, S.; Akabas, L.; et al. A recombinant herpes virus expressing influenza hemagglutinin confers protection and induces antibody-dependent cellular cytotoxicity. Proc. Natl. Acad. Sci. USA 2021, 118, e2110714118. [Google Scholar] [CrossRef]
- Chen, M.; Wang, M.H.; Shen, X.G.; Liu, H.; Zhang, Y.Y.; Peng, J.M.; Meng, F.; Wang, T.Y.; Bai, Y.Z.; Sun, M.X.; et al. Neuropilin-1 Facilitates Pseudorabies Virus Replication and Viral Glycoprotein B Promotes Its Degradation in a Furin-Dependent Manner. J. Virol. 2022, 96, e0131822. [Google Scholar] [CrossRef]
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
He, P.; Gui, M.; Chen, T.; Zeng, Y.; Chen, C.; Lu, Z.; Xia, N.; Wang, G.; Chen, Y. A Chymotrypsin-Dependent Live-Attenuated Influenza Vaccine Provides Protective Immunity against Homologous and Heterologous Viruses. Vaccines 2024, 12, 512. https://doi.org/10.3390/vaccines12050512
He P, Gui M, Chen T, Zeng Y, Chen C, Lu Z, Xia N, Wang G, Chen Y. A Chymotrypsin-Dependent Live-Attenuated Influenza Vaccine Provides Protective Immunity against Homologous and Heterologous Viruses. Vaccines. 2024; 12(5):512. https://doi.org/10.3390/vaccines12050512
Chicago/Turabian StyleHe, Peiqing, Mengxuan Gui, Tian Chen, Yue Zeng, Congjie Chen, Zhen Lu, Ningshao Xia, Guosong Wang, and Yixin Chen. 2024. "A Chymotrypsin-Dependent Live-Attenuated Influenza Vaccine Provides Protective Immunity against Homologous and Heterologous Viruses" Vaccines 12, no. 5: 512. https://doi.org/10.3390/vaccines12050512